Literature DB >> 28114950

Regulation of TRIM24 by miR-511 modulates cell proliferation in gastric cancer.

Ziling Fang1, Ling Zhang1, Quan Liao1, Yi Wang1, Feng Yu1, Miao Feng1, Xiaojun Xiang2, Jianping Xiong3.   

Abstract

BACKGROUND: Increasing evidence highlights the important roles of tripartite motif containing 24 (TRIM24) in tumor initiation and malignant progression in many tumors, including gastric cancer (GC). Although TRIM24 expression is remarkably upregulated during GC carcinogenesis, the molecular mechanisms underlying TRIM24 dysregulation remain unexplored.
METHODS: In this study, miRNA target prediction tools were applied to explore miRNAs that potentially target TRIM24. Western blot and quantitative reverse-transcriptase PCR (qRT-PCR) were performed to detected TRIM24 and miR-511 expression in GC tissues and cell lines. Dual-luciferase reporter assay was utilized to validate if TRIM24 is a direct target gene of miR-511. CCK-8 assay, cell colony formation assay, EdU incorporation assay and cell cycle analysis were performed to determine whether miR-511-mediated regulation of TRIM24 could affect GC progression.
RESULTS: In our study, miR-511 was found to be downregulated in GC and an inverse correlation was observed between TRIM24 and miR-511 expression in primary GC tissues and cell lines. Dual-luciferase reporter assay further verified TRIM24 is a direct target of miR-511. Functional assays showed miR-511 overexpression inhibited cell growth, colony formation ability and cell cycle progression. Conversely, inhibition of endogenous miR-511 promoted these phenotypes in GC cells. Moreover, reintroduction of TRIM24 rescued miR-511-induced inhibitory effects on GC cells. Furthermore, miR-511 elicits tumor-suppressive effects through inactivating PI3K/AKT and Wnt/β-catenin pathways by suppressing TRIM24.
CONCLUSIONS: Our results provide the new evidence supporting the tumor-suppressive role of miR-511 in GC by suppressing TRIM24, suggesting that this novel miR-511/TRIM24 axis is critical in the control of gastric cancer tumorigenesis.

Entities:  

Keywords:  Cell proliferation; Gastric cancer; TRIM24; miR-511

Mesh:

Substances:

Year:  2017        PMID: 28114950      PMCID: PMC5259882          DOI: 10.1186/s13046-017-0489-1

Source DB:  PubMed          Journal:  J Exp Clin Cancer Res        ISSN: 0392-9078


Background

Gastric cancer is the second leading cause of cancer-related death globally [1], with a particularly high incidence in China, accounting for nearly half of all new cases worldwide [2]. Despite the decline in the incidence and mortality of gastric cancer in the past decades, the 5-year survival rate of gastric cancer patients remains poor. Therefore, comprehensive elucidation of the complex molecular mechanisms responsible for GC development and progression are urgently needed. TRIM24 (also known as TIF1α), belongs to the tripartite motif protein family, was reported to be aberrantly activated in a wide variety of cancers, including breast, head and neck, hepatocellular carcinomas and lung cancer [3-7]. Mounting evidence showed TRIM24 has a key role in the modulation of the biological and clinical behavior of tumor cells through interaction with tumor-suppressive or oncogenic pathways [8-13]. For example, TRIM24 binds and activates PIK3CA gene engaged oncogenic PI3K/AKT signaling pathway in prostate cancer and glioma [14, 15]. Moreover, TRIM24 accelerates tumor development and progression through promoting phosphorylated p53 ubiquitination and degradation [16-18]. In our previous study, we found TRIM24 was upregulated in GC and its overexpression promoted tumor malignant behaviors via activation of Wnt/β-catenin pathway [19]. Despite the well-defined outcome of TRIM24 overexpression in cancers, the mechanism underlying its upregulation in gastric cancer remains completely unknown. MicroRNAs (miRNAs), are small non-coding RNAs that negatively regulate their target gene expression at post-transcriptional levels by directly binding to the 3′ untranslated regions (3′UTRs) [20-22]. Numerous evidence regarding miRNAs has unveiled a new dimension to our understanding of tumorigenesis and its associated physiological processes, such as proliferation, cell cycle, apoptosis and invasion [23-28]. Of note, a subset of miRNAs has been linked to gastric cancer progression due to their roles in the regulation of oncogenes or tumor suppressor genes involved in GC tumorigenesis, such as miR-362, miR-223, miR-506 and miR-144 [29-32]. Given the important oncogenic role of TRIM24 in GC, we decided to investigate whether TRIM24 expression is regulated by specific miRNAs, with the underlying hypothesis that these regulatory miRNAs could also be critical in GC pathogenesis. In this study, miR-511, bioinformatically predicted as a regulating miRNA of TRIM24, was found to be downregulated and inversely correlated with TRIM24 expression in GC tissues and cell lines. We further found that upregulation of miR-511 inhibited GC proliferation, and the inhibition of miR-511 had opposite effects. Moreover, our study demonstrated that TRIM24 was a functional target gene of miR-511, and miR-511 inactivated PI3K/AKT and Wnt/β-catenin pathways by suppressing TRIM24. Taken together, our data unveiled the importance of miR-511/TRIM24 axis in gastric carcinogenesis, which may provide potential strategies for the treatment of GC.

Methods

Patients and tissue samples

Primary gastric cancer tissues and their paired adjacent normal tissues were obtained from 12 patients who received surgery resection at the Department of Surgery of the First Affiliated Hospital of Nanchang University. Following resection fresh tissue samples were frozen in liquid nitrogen and stored at −80 °C. Clinicopathological characteristics of patients were confirmed by two experienced pathologists and summarized in Additional file 1: Table S1. None of these patients received any chemotherapy and radiotherapy before surgery.

Cell lines and cell culture

Five human gastric cancer cell lines (AGS, BGC823, MGC803, HGC-27and SGC7901) and normal gastric epithelial cell line GES-1 were obtained from Sun Yat-Sen University Cancer Center. Cells were cultured in RPMI-1640 medium (Hyclone, Logan, USA) with 10% fetal bovine serum (FBS; Hyclone, Logan, USA), 100 U/mL penicillin, and 100 μg/mL streptomycin (Invitrogen, USA) in a humidified chamber at 37 °C and a 5% CO2 environment.

RNA extraction and quantitative reverse-transcriptase PCR analysis

In this study, total RNA was extracted from frozen tissue samples and cells by using TRIzol reagent (Invitrogen, Carlsbad, USA) according to the manufacturer’s instructions. The complementary DNA (cDNA) was synthesized using a reverse transcription kit (TransGen Biotech, Beijing, China). RT-PCR was performed using the ABI 7500 real-time fast PCR system (Applied Biosystems, Foster City, USA) and SYBR Green quantitative PCR SuperMix (Invitrogen, Carlsbad, USA). The cycling conditions were set as previously described [28]. Primers for miR-511 and TRIM24 were purchased from Genepharm Company (Shanghai, China). U6 or GAPDH were used as internal controls and all data were analyzed using the 2-△△Ct method. Primer sequences are presented in Table 1.
Table 1

Primer sequences used in quantitative real-time PCR

GenePrimers
miR-511forward: 5′- AGTGCTGGTGTCTTTTGCTCTG -3′reverse: 5′- TATGGTTGTTCACGAGTCCTTCAC -3′
TRIM24forward: 5′- CATATGCAGCAACAGCAACCG -3′reverse: 5′- GAAAGCCATCTGTAGGGGGT -3′
U6forward: 5′- AGAGCCTGTGGTGTCCG -3′reverse: 5′- CATCTTCAAAGCACTTCCCT -3′
GAPDHforward: 5′-CATCACCATCTTCCAGGAGCG-3reverse: 5′-TGACCTTGCCCACAGCCTTG-3′
Primer sequences used in quantitative real-time PCR

Western blot

Briefly, cells were lysed in lysis buffer consisting 50 mM Tris/HCl (pH 7.5), 150 mM NaCl, 1 mM dithiothreitol (DTT), 1 mM EDTA, 0.5% Nonidet P-40 (NP-40), 0.2 mM phenylmethylsulfonyl fluoride (PMSF), 10 μM pepstatin A and 1 mM leupeptin. Equal amount of clear cell lysates were separated by 10% SDS-PAGE and electroblotted onto PVDF membrane (Bio-Rad Laboratories, Hercules, USA). Membranes were blocked with 5% BSA solution and then incubated with the following primary antibodies overnight: TRIM24 (1:1000, Abcam, ab70560, USA), phospho-AKT (p-AKT) (1:1000, Cell Signaling Technology, #9297, USA), AKT (1:1000, Cell Signaling Technology, #9272, USA), β-catenin (1:1000, Cell Signaling Technology, #9562, USA), cyclinD1 (1:1000, Cell Signaling Technology, #2978, USA), c-Myc (1:1000, Cell Signaling Technology, #5605) and β-actin (1:1500, Abcam, #6267, USA). The following day, membranes were washed with TBST and then incubated with horseradish peroxidase (HRP)-conjugated corresponding second antibodies for 1 h at room temperature. β-actin was used as an internal control and protein bands were analyzed using Image J software (Rawak Software, Germany).

Cell transfection

In this study, MGC803 and HGC-27 cells were transfected with miR-511 mimics (sense:5′-GUGUCUUUUGCUCUGCAGUCA-3′, antisense:5′-AGUGCAGAGCAAAAGACACUU-3′) and negative control (NC, sense:5′-UUCUCCGAACGUGUCACGUTT-3′, antisense:5′-ACGUGACACGUUCGGAGAATT-3′). Then SGC7901 cells were transfected with miR-511 inhibitor (5′-UGACUGCAGAGCAAAAGACAC-3′) and inhibitor negative control (inhibitor NC, 5′-CAGUACUUUUGUGUAGUACAA-3′). TRIM24 expression vector without 3′-UTR (TRIM24-no UTR) was constructed by inserting its CDS sequence into the psiCHECK2 vector (Promega, USA). qRT-PCR analysis and Western blot were performed to confirm the transfection efficiency.

CCK-8 assay

To assess the cell viability, the Cell Counting Kit-8 (CCK-8) (Dojindo Molecular Technologies, USA) was used according to the manufacturer’s instructions. After transfection for 24 h, cells were seeded in 96-well plates. The cell viability was detected by adding WST-8 at a final concentration of 10%, and the absorbance of these samples were measured at 450 nm on a Microplate reader (Molecular Device, SpectraMax M5e, USA) every 24 h for 5 days. The data derived from triplicate samples are presented as mean ± SD.

Colony formation assay

For the colony formation assay, MGC803, HGC-27 and SGC7901 cells (500 per well) were seeded in a 60 mm-dish at 24 h post-transfection and cultured in RPMI 1640 medium containing 10% fetal bovine serum for 10 days. Only colonies which reached more than 50 cells were fixed with 10% formaldehyde for 15 min and dyed with 8.0% crystal violet for 15 min. Each experiment was repeated three times.

EdU incorporation assay

The effect of miR-511 on cell proliferation was also examined by EdU (5-Ethynyl-2′-deoxyuridine) incorporation assay. Briefly, 24 h after transfection, indicated cells were incubated with 50 μM EdU for 2 h at 37 °C according to the manufacturer’s instructions (R11053.4, Apollo 567, RiboBio, China). Cells were then washed with PBS for three times, and fixed with 4% formaldehyde for 30 min at room temperature. Next, 0.5% Triton X-100 was applied for 10 min at room temperature to permeabilize cells. After washing with PBS for three times, cells were incubated with 1 × Apollo reaction cocktail for 30 min. DNA was stained with DAPI (4′,6-diamidino-2-phenylindole) for 30 min and results were visualized with a Zeiss confocal microscope (LSM 700, USA).

Flow cytometry analysis

Indicated cells were harvested by trypsinization, washed with cold PBS and fixed in 70% cold ethanol in PBS. Before staining, cells were spun down in a cooled centrifuge and resuspended in cold PBS. Next, 100 μL of RNase was added and cells were incubated at 37 °C for 30 min. Finally, cells were stained with PI (propidium iodide, Thermo Fisher Scientific, P1304MP, USA) for 30 min at 4 °C and 5 × 104 cells were analyzed by flow cytometry (Beckman-Coulter, Fullerton, CA, USA).

Dual-luciferase reporter assay

Prediction of miR-511 target genes was performed by two independent miRNA databases: miRanda (http://www.microrna.org/) and TargetScan (http://targetscan.org). The full length 3′-UTR of the TRIM24 gene and a mutant variant was amplified by PCR and cloned into the luciferase reporter psiCHECK2 vector (Promega, Madison, USA). The wild-type plasmid (TRIM24-Wt-3′UTR) was created containing the full-length 3′-UTR of TRIM24 with miR-511 complementary sequence. In addition, a mutant-type plasmid (TRIM24-Mut-3′UTR) with a degenerate 3′UTR was created by replacing AAAGACA with UUUCUGU in the miR-511 complementary sequence. GC cells were seeded in 2 × 105 cells per well in 12-well plates and transiently co-transfected with reporter plasmids (1 μg) and 100 nM of miR-511 mimics or miR-511 inhibitor using Lipofectamin 2000 (Thermo Fisher Scientific, #11668027, USA) for 48 h. The luciferase activity was measured using the Dual-luciferase Reporter Assay Kit (Promega, Madison, USA, E1910) according to the manufacturer’s protocols. Renilla luciferase was used for normalization and all experiments were performed three times.

Statistical analysis

Statistical analysis was performed using SPSS17.0 (Chicago, IL, USA). All data are presented as mean ± SD and each experiment was repeated in triplicate. Student’s t-test or variance (ANOVA) was employed to determine statistical significance. A p value < 0.05 or less was considered statistically significant.

Results

TRIM24 and miR-511 expression are inversely correlated in GC tissues and cell lines

In this study, we examined TRIM24 protein expression in 12 pairs of GC tissues and their corresponding adjacent non-cancerous gastric tissues. We found 10 out of 12 GC samples (83.3%) had increased TRIM24 expression as compared with matched adjacent non-cancerous gastric tissues (Fig. 1a, p < 0.05). To investigate the mechanism of TRIM24 upregulation, bioinformatic tools were used to identify the potential miRNAs targeting TRIM24. Although many different miRNAs were predicted, three candidates (miR-655, miR-374a and miR-511) attracted our attention, because they were reported to be downregulated in several cancers, while their biological functions in GC were unclear. Then we investigated the expression of these candidate miRNAs in above-mentioned GC tissues by qRT-PCR and found only miR-511 was markedly downregulated in GC tissues, therefore, we focused on miR-511 for further study.
Fig. 1

TRIM24 and miR-511 expression are inversely correlated in gastric cancer tissues and cell lines. a TRIM24 protein expression in 12 pairs in gastric cancer tissues (C) and corresponding adjacent non-cancerous gastric tissues (N) was detected by Western blot analysis. b The predicted TRIM24 interaction site and its candidate targeted-miRNA, miR-511. c qRT-PCR analysis of miR-511 expression in gastric tumors and their corresponding non-cancerous tissues, U6 was used as an internal control. d Correlation analysis of miR-511 expression and TRIM24 expression in clinical GC samples. e qRT-PCR analysis of miR-511 expression in gastric cancer cell lines, U6 was used as an internal control. f TRIM24 expression in human gastric cell lines we measured by qRT-PCR and Western blot. Data are presented as the mean ± SD. (*p < 0.05, **p < 0.01; n = 3)

TRIM24 and miR-511 expression are inversely correlated in gastric cancer tissues and cell lines. a TRIM24 protein expression in 12 pairs in gastric cancer tissues (C) and corresponding adjacent non-cancerous gastric tissues (N) was detected by Western blot analysis. b The predicted TRIM24 interaction site and its candidate targeted-miRNA, miR-511. c qRT-PCR analysis of miR-511 expression in gastric tumors and their corresponding non-cancerous tissues, U6 was used as an internal control. d Correlation analysis of miR-511 expression and TRIM24 expression in clinical GC samples. e qRT-PCR analysis of miR-511 expression in gastric cancer cell lines, U6 was used as an internal control. f TRIM24 expression in human gastric cell lines we measured by qRT-PCR and Western blot. Data are presented as the mean ± SD. (*p < 0.05, **p < 0.01; n = 3) As shown in Fig. 1b, miR-511 has potential target sites in the 3′-UTR region of TRIM24 mRNA. qRT-PCR results showed that miR-511 was consistently downregulated in 12 matched paired of GC tissues (Fig. 1c, p < 0.01), and was inversely correlated with TRIM24 (Fig. 1d, r = −0.618, p < 0.01). Furthermore, miR-511 and TRIM24 expression were also examined in five human GC cell lines (AGS, BGC823, MGC803, HGC-27, SGC7901) and normal gastric epithelial cell lines GES-1, respectively. Additionally, the miR-511 expression was much lower in MGC803 and HGC-27 cells, but relatively higher in other three cancer cell lines, which was inversely correlated with TRIM24 protein expression (Fig. 1e and f). Thus, the inverse expression levels of miR-511 and TRIM24 in GC tissues and cell lines indicate that loss of miR-511 was related to the upregulation of TRIM24.

TRIM24 is a direct target of miR-511

To determine whether TRIM24 is a direct target of miR-511 in GC, we synthesized wild-type and mutant TRIM24-3′UTR luciferase reporter constructs, in which full length wild type or mutant TRIM24 3′UTR sequence was placed downstream of the luciferase reporter gene (Fig. 2a). The miR-511 expression were detected by qRT-PCR after transfection with miR-511 mimics or inhibitor (Fig. 2b, p < 0.01). As shown in Fig. 2c, miR-511 mimics markedly decreased the luciferase activity of Wt-TRIM24-3′UTR plasmid in MGC803 and HGC-27 cells (p < 0.01), whereas miR-511 inhibitor upregulated the luciferase activity in SGC7901 cells (p < 0.05). Moreover, qRT-PCR results showed that overexpression or knockdown of miR-511 did not affect degradation of TRIM24 mRNA (Fig. 2d). However, western blot analysis showed that miR-511 upregulation significantly suppressed TRIM24 protein expression in MGC803 and HGC-27 cells, and miR-511 downregulation increased TRIM24 expression in SGC7901 cells (Fig. 2e and Additional file 2: Figure S1), indicating that miR-511 regulates TRIM24 through translational inhibition. Collectively, these results strongly suggest that TRIM24 is a direct target of miR-511.
Fig. 2

Validation of TRIM24 as a direct target of miR-511. a Wild type (Wt) and Mutant type (Mut) TRIM24 3′UTR sequences were cloned into a psi-CHECK reporter vector. b The miR-511 expression was detected by qRT-PCR at 48 h post-transfection, U6 was used as an internal control. c The relative luciferase activity was detected by dual-luciferase reporter assay in indicated cell lines. d qRT-PCR analysis of TRIM24 mRNA expression in indicated cell lines 24 h post-transfection. e TRIM24 protein expression was detected by Western blot in indicated cell lines post-transfection. (*p < 0.05, **p < 0.01; n = 3)

Validation of TRIM24 as a direct target of miR-511. a Wild type (Wt) and Mutant type (Mut) TRIM24 3′UTR sequences were cloned into a psi-CHECK reporter vector. b The miR-511 expression was detected by qRT-PCR at 48 h post-transfection, U6 was used as an internal control. c The relative luciferase activity was detected by dual-luciferase reporter assay in indicated cell lines. d qRT-PCR analysis of TRIM24 mRNA expression in indicated cell lines 24 h post-transfection. e TRIM24 protein expression was detected by Western blot in indicated cell lines post-transfection. (*p < 0.05, **p < 0.01; n = 3)

Ectopic expression of miR-511 inhibits proliferation of GC cells

The above data promoted us to further explore the biological functions of miR-511 in GC cells. As presented in Fig. 3a, the CCK8 assay showed that restoration of miR-511 resulted in a markedly decreased cell viability of MGC803 and HGC-27 cells. Consistently, a colony formation assay revealed that the colony formation ability of MGC803 and HGC-27 cells was reduced in response to miR-511 mimics (Fig. 3b, p<0.01). Moreover, the level of DNA synthesis, detected with an EdU incorporation assay, was significantly suppressed in cells transfected with miR-511 mimics, whereas the negative control (NC) cells displayed relatively higher EdU incorporation rates (Fig. 3c, p < 0.01). Furthermore, flow cytometry analysis revealed a significant increase in the percentage of cells in G1/G0 phase and a decrease in the percentage of cells in S phase in cells transfected with miR-511 mimics (Fig. 3d, p < 0.01). Taken together, these results clearly suggest that ectopic expression of miR-511 inhibits cell proliferation of GC cells.
Fig. 3

Ectopic expression of miR-511 inhibits cell proliferation in GC cells. a The effect of miR-511 overexpression on cell viability was detected by CCK-8 assay. b Representative micrographs (left) and quantification (right) of crystal violet-stained cell colonies. c Representative micrographs (left) and quantification (right) of EdU incorporating-cells of indicated GC cells. d The effect of miR-511 upregulation on cell cycle progression of GC cells was detected by flow cytometry analysis. (*p < 0.05, **p < 0.01; n = 3)

Ectopic expression of miR-511 inhibits cell proliferation in GC cells. a The effect of miR-511 overexpression on cell viability was detected by CCK-8 assay. b Representative micrographs (left) and quantification (right) of crystal violet-stained cell colonies. c Representative micrographs (left) and quantification (right) of EdU incorporating-cells of indicated GC cells. d The effect of miR-511 upregulation on cell cycle progression of GC cells was detected by flow cytometry analysis. (*p < 0.05, **p < 0.01; n = 3)

Inhibition of miR-511 accelerates cell proliferation of GC cells

We further assessed the effects of miR-511 inhibition on GC cell proliferation in SGC7901 cells. As shown in Fig. 4a and b, downregulation of miR-511 dramatically enhanced the cell growth ability of SGC7901 cells compared with that of cells transfected with negative control (inhibitor NC), as analyzed by CCK8 and colony formation assays. In addition, the level of DNA synthesis was significantly elevated in cells transfected with miR-511 inhibitor, whereas the control cells displayed relatively lower EdU incorporation rates (Fig. 4c, p < 0.01). Moreover, cell cycle analysis revealed that transfection of miR-511 inhibitor drastically increased the percentage of cells in S peak while decreased percentages of cells in G1/G0 peak (Fig. 4d, p < 0.05). Collectively, these data indicate that downregulation of endogenous miR-511 expression accelerates cell proliferation of GC cells.
Fig. 4

Inhibition of miR-511 promotes cell proliferation in GC cells. a At indicated time points, the cell growth rate was evaulated by CCK-8 assay. b Colony formation analysis of GC cells after indicated transfection. c Representative micrographs (left) and quantification (right) of EdU incorporating-cells of after transfection with miR-511 inhibitor or inhibitor negative control (inhibitor NC). d The effect of miR-511 inhibition on the cell cycle progression of GC cells was determined by flow cytometry analysis. (*p < 0.05, **p < 0.01; n = 3)

Inhibition of miR-511 promotes cell proliferation in GC cells. a At indicated time points, the cell growth rate was evaulated by CCK-8 assay. b Colony formation analysis of GC cells after indicated transfection. c Representative micrographs (left) and quantification (right) of EdU incorporating-cells of after transfection with miR-511 inhibitor or inhibitor negative control (inhibitor NC). d The effect of miR-511 inhibition on the cell cycle progression of GC cells was determined by flow cytometry analysis. (*p < 0.05, **p < 0.01; n = 3)

Overexpression of TRIM24 partially attenuates miR-511-induced effects on GC cell proliferation

To ascertain whether the proliferation-inhibitory role of miR-511 in GC cells was attributable to reduced TRIM24 expression, we carried out a series of rescue experiments in MGC803 and HGC-27 cells. A TRIM24 overexpression construct was synthesized to contain only the coding sequences of TRIM24 without its 3′-UTR (TRIM24-no UTR), yielding an mRNA that is resistant to miR-511-mediated inhibition of translation. Then, miR-511 mimics, with or without TRIM24-no UTR construct, were co-transfected into MGC803 and HGC-27 cells. As illustrated in Fig. 5a, the resulting constitutive expression of TRIM24 partially ameliorated the inhibition of TRIM24 protein expression mediated by miR-511. Furthermore, CCK8, colony formation and Edu incorporation assays, as well as cell cycle analysis, demonstrated that the restoration of TRIM24 partially rescued miR-511-mediated inhibitory effects on GC cell proliferation (Fig. 5b–e). Taken together, these results further demonstrate that TRIM24 is a main functional mediator of miR-511.
Fig. 5

Overexpression of TRIM24 partially rescues miR-511-induced effects on GC cell proliferation. a Western blot analysis of TRIM24 protein expression after transfection of MGC803 and HGC-27 cells with miR-511 mimics or miR-511 mimics and TRIM24-no UTR (TRIM24 without its 3′-UTR, shown as TRIM24). b At the indicated time points post-transfection, the cell growth rate was evaluated using the CCK8 assay. c Colony formation assay analysis of GC cells after indicated treatments. d Representative micrographs (left) and quantification (right) of EdU incorporating-cells after transfection with miR-511 mimics, or miR-511 mimics and TRIM24-no UTR. e The cell cycle distribution was detected by flow cytometric analysis at 48 h post-transfection. (*p < 0.05, **p < 0.01; n = 3)

Overexpression of TRIM24 partially rescues miR-511-induced effects on GC cell proliferation. a Western blot analysis of TRIM24 protein expression after transfection of MGC803 and HGC-27 cells with miR-511 mimics or miR-511 mimics and TRIM24-no UTR (TRIM24 without its 3′-UTR, shown as TRIM24). b At the indicated time points post-transfection, the cell growth rate was evaluated using the CCK8 assay. c Colony formation assay analysis of GC cells after indicated treatments. d Representative micrographs (left) and quantification (right) of EdU incorporating-cells after transfection with miR-511 mimics, or miR-511 mimics and TRIM24-no UTR. e The cell cycle distribution was detected by flow cytometric analysis at 48 h post-transfection. (*p < 0.05, **p < 0.01; n = 3)

MiR-511 inactivates PI3K/AKT and Wnt/β-catenin signaling pathways via suppressing TRIM24 in GC cells

TRIM24 was reported to exert its oncogenic activities in many cancers through regulating PI3K/AKT pathways. And our previous study demonstrated that TRIM24 was a positive regulator of Wnt/β-catenin pathway. Thus, we deduced that miR-511 might inhibit cell proliferation through inactivation of PI3K/AKT and Wnt/β-catenin pathways. As shown in Fig. 6a and b, miR-511 upregulation decreased, while miR-511 downregulation increased the expression of p-AKT, β-catenin, cyclinD1 and c-Myc. However, the total levels of AKT in all groups were not significantly changed. Another key question was whether miR-511 repressed these two pathways in a TRIM24-dependent manner. To investigate this hypothesis, we overexpressed miR-511 together with a construct expressing TRIM24 without 3′-UTR (TRIM24-no UTR) in MGC803 and HGC-27 cells. Strikingly, we found that overexpression of TRIM24 markedly but not completely rescued the miR-511-mediated inhibition on PI3K/AKT and Wnt/β-catenin pathways. Overall, these results indicate that miR-511 suppresses the activity of PI3K/AKT and Wnt/β-catenin pathways via TRIM24.
Fig. 6

MiR-511 inactivates PI3K/AKT and Wnt/β-catenin signaling pathways via suppressing TRIM24 in GC cells. a Western blot analysis of PI3K/AKT and Wnt/β-catenin pathways target genes after transfection in MGC803 and HGC-27 cells with miR-511 mimics or negative control (NC). b Western blot analysis of PI3K/AKT and Wnt/β-catenin pathways target genes after transfection with miR-511inhibitor or inhibitor negative control in SGC7901 cells (inhibitor NC). c Western blot analysis of PI3K/AKT and Wnt/β-catenin pathways target genes after transfected with miR-511 or co-transfection with miR-511 mimics and TRIM24-no UTR. β-actin was used as an internal control. (*p < 0.05, **p < 0.01; n = 3)

MiR-511 inactivates PI3K/AKT and Wnt/β-catenin signaling pathways via suppressing TRIM24 in GC cells. a Western blot analysis of PI3K/AKT and Wnt/β-catenin pathways target genes after transfection in MGC803 and HGC-27 cells with miR-511 mimics or negative control (NC). b Western blot analysis of PI3K/AKT and Wnt/β-catenin pathways target genes after transfection with miR-511inhibitor or inhibitor negative control in SGC7901 cells (inhibitor NC). c Western blot analysis of PI3K/AKT and Wnt/β-catenin pathways target genes after transfected with miR-511 or co-transfection with miR-511 mimics and TRIM24-no UTR. β-actin was used as an internal control. (*p < 0.05, **p < 0.01; n = 3)

Discussion

TRIM24, as a founding member of TRIM family, has been identified as being involved in physiologic and pathological processes, including cell growth, apoptosis, invasion and cancer development. Recent studies shed important insights into the expression and function of TRIM24 in carcinogenesis [33, 34]. Others and our previous study showed that TRIM24 expression was abnormally upregulated in GC as compared with adjacent gastric tissues, indicating the potential role of TRIM24 in GC progression. To date, few studies have investigated the mechanism underlying TRIM24 overexpression in GC. In this study, we identify miR-511 as a negative regulator of TRIM24 in GC tumorigenesis. MiRNAs are important non-coding RNAs, frequently expressed aberrantly in tumorigenesis. Numerous evidence has defined a role for miRNAs in modulation of the process of GC proliferation, apoptosis, metastasis and multidrug resistance. miR-511 has been reported to be negatively regulated in different cancer types, including lung cancer, hepatocellular carcinoma and ovarian cancer [35-37]. It has also been found to act as a cancer-suppressive miRNA by targeting important oncogenes, such as PIK3R3, TRIB2 and Bax [37-39]. However, some researchers found that miR-511 served as a onco-miR in other cancers, such as HCV-associated diffuse large B-cell lymphoma as well as in human blood monocyte-derived dendritic cells and macrophages [40, 41]. Based on these reports, it seems that miR-511 displays contrasting roles in different tumor types, implying that the cancer type determines the role of miR-511 as an oncogene or tumor suppressor gene. However, few studies have paid attention to the role of miR-511 in GC. In our study, miR-511 was computationally predicted as a regulatory miRNA of TRIM24. And we further clarified that miR-511 is significantly downregulated in gastric cancer tissues when compared to corresponding non-cancerous gastric tissues. Moreover, the expression patterns of TRIM24 were inversely correlated with those of miR-511 in GC clinical samples and cell lines. Furthermore, TRIM24 was validated as a direct target gene of miR-511 by luciferase reporter assay and Western blot. These data further underscore a potentially important role of miR-511 downregulation, which consequently leads to TRIM24 upregulation in GC tumorigenesis. In the present study, we further studied the biological functions of miR-511 in GC cells and found that ectopic expression of miR-511 inhibited cell growth, colony formation ability and resulted in G0/G1 arrest in GC cells, whereas miR-511 inhibition displayed opposing phenotypes. To further confirm whether TRIM24 is a functional target of miR-511, we co-transfected miR-511 and TRIM24 and found that regulation of TRIM24 by miR-511 relies on the TRIM24 3′UTR. More importantly, our functional experiments revealed that restoration of TRIM24 expression could attenuate the growth inhibition caused by miR-511 overexpression in GC cells. This provided direct evidence that miR-511 inhibit GC cell proliferation by suppressing TRIM24 expression. In addition, it is worth noting that ectopic expression of TRIM24 did not completely abrogate miR-511-induced effects, implying that other downstream targets may be also involved in miR-511 functions. Collectively, our data present the new evidence to show that miR-511 serves as a tumor suppressor in GC through negatively regulating TRIM24 expression. However, the molecular mechanisms by which miR-511-TRIM24 promotes cell proliferation still need to be further elucidated. It is well-documented that PI3K/AKT and Wnt/β-catenin pathways participate in a wide variety of cellular process, such as cell growth, cell cycle, differentiation, and tumorigenesis [42, 43]. Others and our data showed TRIM24 was involved in activation of PI3K/AKT and Wnt/β-catenin pathways [19, 44]. In this study, based on the results that GC cell proliferation was affected by miR-511 and TRIM24 expression, we studied whether PI3K/AKT and Wnt/β-catenin pathways are also involved in this process. Our results showed that miR-511 overexpression significantly decreased the expression of p-Akt, β-catenin, c-Myc and cyclinD1, suggesting that miR-511 acts as a negative regulator of these two pathways. Previous study also showed that miR-511 acts as a negative regulator of PI3K/AKT pathway in liver cancer [38]. Further findings showed overexpression of TRIM24 lacking its 3′-UTR significantly restored PI3K/AKT and Wnt/β-catenin pathways in miR-511-transfected GC cells. Taken together, these data imply that miR-511 suppresses PI3K/AKT and Wnt/β-catenin pathways via targeting TRIM24, thus, inactivation of PI3K/AKT and Wnt/β-catenin signaling pathways are also involved in the anti-proliferative effects of miR-511 in GC.

Conclusions

In conclusion, our study indicates that downregulation of miR-511 accounts for the aberrant overexpression of TRIM24 in GC tumorigenesis. MiR-511-mediated suppression of TRIM24 inhibits cell proliferation through PI3K/AKT and Wnt/β-catenin pathways. Our characterization of this newly miR-511/TRIM24 axis provide an improved understanding of the development and progression of GC, and may provide new avenues for GC therapy.
  44 in total

Review 1.  MicroRNAs: genomics, biogenesis, mechanism, and function.

Authors:  David P Bartel
Journal:  Cell       Date:  2004-01-23       Impact factor: 41.582

Review 2.  MicroRNAs: novel biomarkers for gastrointestinal carcinomas.

Authors:  Li Xie; Xiaoping Qian; Baorui Liu
Journal:  Mol Cell Biochem       Date:  2010-04-27       Impact factor: 3.396

3.  Clarifications on miRNA and cancer.

Authors:  Gary Ruvkun
Journal:  Science       Date:  2006-01-06       Impact factor: 47.728

Review 4.  MicroRNA signatures in human cancers.

Authors:  George A Calin; Carlo M Croce
Journal:  Nat Rev Cancer       Date:  2006-11       Impact factor: 60.716

5.  MicroRNA expression profiles of human blood monocyte-derived dendritic cells and macrophages reveal miR-511 as putative positive regulator of Toll-like receptor 4.

Authors:  Liina Tserel; Toomas Runnel; Kai Kisand; Maire Pihlap; Lairi Bakhoff; Raivo Kolde; Hedi Peterson; Jaak Vilo; Pärt Peterson; Ana Rebane
Journal:  J Biol Chem       Date:  2011-06-06       Impact factor: 5.157

6.  Deregulation of miR-519a, 153, and 485-5p and its clinicopathological relevance in ovarian epithelial tumours.

Authors:  Tae Heon Kim; Yu Kyung Kim; Youngdo Kwon; Jin Hyung Heo; Haeyoun Kang; Gwangil Kim; Hee Jung An
Journal:  Histopathology       Date:  2010-11       Impact factor: 5.087

7.  Prognostic significance of TRIM24/TIF-1α gene expression in breast cancer.

Authors:  Monique Chambon; Béatrice Orsetti; Marie-Laurence Berthe; Caroline Bascoul-Mollevi; Carmen Rodriguez; Vanessa Duong; Michel Gleizes; Sandrine Thénot; Frédéric Bibeau; Charles Theillet; Vincent Cavaillès
Journal:  Am J Pathol       Date:  2011-04       Impact factor: 4.307

Review 8.  Regulation of p53: TRIM24 enters the RING.

Authors:  Abhinav K Jain; Michelle Craig Barton
Journal:  Cell Cycle       Date:  2009-11-02       Impact factor: 4.534

9.  Trim24 targets endogenous p53 for degradation.

Authors:  Kendra Allton; Abhinav K Jain; Hans-Martin Herz; Wen-Wei Tsai; Sung Yun Jung; Jun Qin; Andreas Bergmann; Randy L Johnson; Michelle Craig Barton
Journal:  Proc Natl Acad Sci U S A       Date:  2009-06-25       Impact factor: 11.205

10.  TRIM24 links a non-canonical histone signature to breast cancer.

Authors:  Wen-Wei Tsai; Zhanxin Wang; Teresa T Yiu; Kadir C Akdemir; Weiya Xia; Stefan Winter; Cheng-Yu Tsai; Xiaobing Shi; Dirk Schwarzer; William Plunkett; Bruce Aronow; Or Gozani; Wolfgang Fischle; Mien-Chie Hung; Dinshaw J Patel; Michelle Craig Barton
Journal:  Nature       Date:  2010-12-16       Impact factor: 49.962

View more
  19 in total

1.  miR-511-5p Suppresses Cell Migration, Invasion and Epithelial-Mesenchymal Transition Through Targeting PAK2 in Gastric Cancer.

Authors:  Wenjing Yong; Ke Zhang; Youming Deng; Weisen Tang; Ran Tao
Journal:  Biochem Genet       Date:  2021-09-20       Impact factor: 1.890

2.  FOXCUT Promotes the Proliferation and Invasion by Activating FOXC1/PI3K/AKT Pathway in Colorectal Cancer.

Authors:  Xiaojie Zhang; Shanyong Yi; Guochen Xing; Huili Wu; Ying Zhu; Xiaodan Guo; Lei Zhang
Journal:  Cancer Manag Res       Date:  2020-07-24       Impact factor: 3.989

Review 3.  MicroRNAs are involved in the development and progression of gastric cancer.

Authors:  Xiaolin Liu; Ruixia Ma; Bin Yi; Adam I Riker; Yaguang Xi
Journal:  Acta Pharmacol Sin       Date:  2020-10-09       Impact factor: 7.169

4.  Therapeutic effects of human monoclonal PSMA antibody-mediated TRIM24 siRNA delivery in PSMA-positive castration-resistant prostate cancer.

Authors:  Sheng-Jia Shi; Li-Juan Wang; Dong-Hui Han; Jie-Heng Wu; Dian Jiao; Kai-Liang Zhang; Jiang-Wei Chen; Yu Li; Fa Yang; Jing-Liang Zhang; Guo-Xu Zheng; An-Gang Yang; Ai-Zhi Zhao; Wei-Jun Qin; Wei-Hong Wen
Journal:  Theranostics       Date:  2019-02-07       Impact factor: 11.556

5.  Tripartite-motif family genes associated with cancer stem cells affect tumor progression and can assist in the clinical prognosis of kidney renal clear cell carcinoma.

Authors:  Guangzhen Wu; Yingkun Xu; Lin Li; Jianyi Li; Ningke Ruan; Jian Dong; Zhuyuan Si; Qinghua Xia; Qifei Wang
Journal:  Int J Med Sci       Date:  2020-10-18       Impact factor: 3.738

6.  miR-509-3-5P inhibits the invasion and lymphatic metastasis by targeting PODXL and serves as a novel prognostic indicator for gastric cancer.

Authors:  Jing Zhang; Zhonglin Zhu; Jinxin Sheng; Zhilong Yu; Bin Yao; Kejian Huang; Lisheng Zhou; Zhengjun Qiu; Chen Huang
Journal:  Oncotarget       Date:  2017-05-23

7.  TRIM44, a crucial target of miR-410, functions as a potential oncogene in osteosarcoma.

Authors:  Heng Wang; Zi-Ling Fang; Gong-Hao Zhang; Xin Ma
Journal:  Onco Targets Ther       Date:  2018-06-21       Impact factor: 4.147

8.  IL-21R functions as an oncogenic factor and is regulated by the lncRNA MALAT1/miR-125a-3p axis in gastric cancer.

Authors:  Lei Yan; Jing Zhang; Dong Guo; Ji Ma; Shao-Feng Shui; Xin-Wei Han
Journal:  Int J Oncol       Date:  2018-10-31       Impact factor: 5.650

9.  Long non-coding RNA NCK1-AS1 promotes the tumorigenesis of glioma through sponging microRNA-138-2-3p and activating the TRIM24/Wnt/β-catenin axis.

Authors:  Lifa Huang; Xu Li; Hui Ye; Yajun Liu; Xiaolong Liang; Chao Yang; Lin Hua; Zhaoxian Yan; Xin Zhang
Journal:  J Exp Clin Cancer Res       Date:  2020-04-15

10.  MiR-511 mimic transfection inhibits the proliferation, invasion of osteosarcoma cells and reduces metastatic osteosarcoma tumor burden in nude mice via targeting MAPK1.

Authors:  Junxue Wu; Chao Zhang; Lu Chen
Journal:  Cancer Biomark       Date:  2019       Impact factor: 4.388

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.