Literature DB >> 28107376

Deletion of pH Regulator pac-3 Affects Cellulase and Xylanase Activity during Sugarcane Bagasse Degradation by Neurospora crassa.

Amanda Cristina Campos Antoniêto1, Wellington Ramos Pedersoli2, Lílian Dos Santos Castro1, Rodrigo da Silva Santos2, Aline Helena da Silva Cruz2, Karoline Maria Vieira Nogueira1, Rafael Silva-Rocha3, Antonio Rossi2, Roberto Nascimento Silva1.   

Abstract

Microorganisms play a vital role in bioethanol production whose usage as fuel energy is increasing worldwide. The filamentous fungus Neurospora crassa synthesize and secrete the major enzymes involved in plant cell wall deconstruction. The production of cellulases and hemicellulases is known to be affected by the environmental pH; however, the regulatory mechanisms of this process are still poorly understood. In this study, we investigated the role of the pH regulator PAC-3 in N. crassa during their growth on sugarcane bagasse at different pH conditions. Our data indicate that secretion of cellulolytic enzymes is reduced in the mutant Δpac-3 at alkaline pH, whereas xylanases are positively regulated by PAC-3 in acidic (pH 5.0), neutral (pH 7.0), and alkaline (pH 10.0) medium. Gene expression profiles, evaluated by real-time qPCR, revealed that genes encoding cellulases and hemicellulases are also subject to PAC-3 control. Moreover, deletion of pac-3 affects the expression of transcription factor-encoding genes. Together, the results suggest that the regulation of holocellulase genes by PAC-3 can occur as directly as in indirect manner. Our study helps improve the understanding of holocellulolytic performance in response to PAC-3 and should thereby contribute to the better use of N. crassa in the biotechnology industry.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 28107376      PMCID: PMC5249074          DOI: 10.1371/journal.pone.0169796

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The filamentous fungus Neurospora crassa is an appealing microorganism for use by the bioethanol industry, because it degrades biomass releasing fermentable sugars [1]. Many isolates of this species were collected from sugarcane plantations [2-4] exhibiting the synthesis and secretion of holocellulolytic enzymes involved in plant cell wall degradation [5]. The N. crassa genome contains 171 genes encoding glycosylhydrolases, about 15.5% less than the cellulolytic model fungus Trichoderma reesei. However, the N. crassa genome possesses 35 genes encoding cellulolytic enzymes, almost twice that of T. reesei [6, 7]. Three types of enzymes are common to all cellulose-degrading fungi, including N. crassa: endoglucanases, exoglucanases, and β-glucosidases, which act synergistically to degrade the cellulolytic complex into glucose monomers [5]. The whole process of lignocellulosic biomass deconstruction is finely regulated at the transcriptional level. In N. crassa, the transcription factor XLR-1 (xylan degradation regulator 1) is necessary for growth on hemicellulose, whereas its orthologs, XlnR from Aspergillus sp. and XYR1 from Trichoderma sp., are the primary transcriptional regulators of genes encoding both cellulases and hemicellulases [8, 9]. Two other transcription factors, CLR-1 and CLR-2, also have an important role for the growth and induction of cellulases and some hemicellulases on cellulose; however, they are not required for growth on xylan [9, 10]. It is also known that the zinc-finger transcription factor CRE-1 is responsible for carbon catabolite repression (CCR) in N. crassa and that deletion of this regulator results in increased expression of cellulolytic genes and enhanced enzymatic activity during growth on cellulose [11]. In some species like T. reesei, Aspergillus fumigatus, and N. crassa [12-15], cellulase production is affected not only by available carbon source but also by the pH of the culture medium, indicating that pH is an important factor in the effective expression of these enzymes [12, 16]. The transcription factor responsible for the pH-signaling pathway is the protein PacC. In Aspergillus nidulans, this regulator mediates cell adaptation to pH by both activation of genes that are preferentially expressed in alkaline medium and repression of specific acid-associated genes [17]. At alkaline pH, PAC-3 is activated by PalB-catalyzed proteolysis, and active PAC-3 binds to the DNA of its target genes through the core consensus 5ʹ-BGCCVAGV-3ʹ in N. crassa [18]. Although a link has been demonstrated between PacC and lignocellulolytic enzyme production in species such as A. nidulans, T. reesei, and Humicola grisea var. thermoideae [12, 13, 19, 20], little is known about the role of PAC-3 in the expression of cellulases or hemicellulases in N. crassa. Here, we investigated the role of the transcription factor PAC-3 in the activity of holocellulolytic enzymes as well as in the regulation of cellulase and hemicellulase genes in N. crassa. We show that in alkaline environments, pac-3 deletion results in decreased activity of endoglucanase and xylanase enzymes, as well as differential regulation of cellulase and hemicellulase gene expression. This study improves our understanding of the regulation of lignocellulosic biomass degradation in response to ambient pH in N. crassa for further application of metabolically engineered strains in the cellulosic production of ethanol.

Materials and Methods

Strains and growth conditions

Wild-type strain, St.L.74-OR23-1VA (FGSC No. 2489) and Δmus-52 (FGSC N°. 9568) (control) of Neurospora crassa were purchased from the Fungal Genetics Stock Center (FGSC; University of Missouri, MO, USA, http://www.fgsc.net) [21]. A N. crassa Δpac-3 knockout strain (pac-3) was generated following the knockout procedures described previously [22], based on the strain FGSC N° 9568 (mat a, mus-52::hyg) [23]. Strains were maintained on agar-based Vogel’s minimal (VM) medium at pH 5.8 [24], containing 2% sucrose at 30°C. For gene expression assays, conidia from each strain (approximately 107 cells per mL) were germinated in 100 mL of liquid VM medium, supplemented with 1% (w/v) sugarcane bagasse (i.e., the carbon source) at 30°C in an orbital shaker (200 rpm) for eight days at different pH conditions (pH 3, 5, 7, 8, and 10). After this culture period, the resulting mycelia were collected by filtration, frozen, and stored at –80°C until RNA isolation. Supernatants were used for secretome and enzymatic activity analysis. Fungal growth was indirectly measured by total protein quantification using the Quick Start Bradford protein assay kit (Bio-Rad) with bovine serum albumin (BSA) as a standard. All experiments were performed in three biological replicates.

RNA extraction and quantitative real-time analysis (RT-qPCR)

Total RNA was isolated from mycelia with the TRIzol RNA kit (Invitrogen Life Technologies, CA, USA), per the manufacturer's instructions. RNA concentration was determined by spectrophotometric OD 260/280, and RNA integrity was verified by gel electrophoresis in 1% agarose. For RT-qPCR analysis, 1 μg of RNA was treated with DNase I (Thermo Fisher, MA, USA) and reverse-transcribed to cDNA with the First Strand cDNA kit Maxima Synthesis, per manufacturer's instructions. The cDNA was diluted 1/50-fold and used for RT-qPCR analysis in the Bio-Rad CFX96™ System, using SsoFast™ EvaGreen® Supermix (Bio-Rad, CA, USA) for signal detection. An actin-encoding gene (NCU04173) was used as an endogenous control. The following amplification reaction was used: 95°C for 10 minutes followed by 39 cycles of 95°C for 10 seconds and 60°C for 30 seconds, followed by a dissociation curve of 60°C to 95°C with an increment of 0.5°C for 10 seconds. Gene expression values were calculated according to the 2-ΔΔCT method [25] and fold change expressed as Log2 using the 74A strain grown on sugarcane bagasse as the reference sample. Primers utilized in the RT-qPCR experiments are described in Table 1. Data analysis was performed using GraphPad Prism v 5.0 software. All samples were analyzed in triplicate.
Table 1

qRT-PCR primers used in this study.

GENESSequence 5′→3′ (Forward)Sequence 5′→3′ (Reverse)
cbh-1ACCCCCTCCACCAACGGTGAACGCTGTAGAGACTTTGT
gh7-1GCCCTACTCCAGCATTCATGTGAAGGCGGTGGCG
gh3-2GGTGGAGAGGATGGATGATCCATCTGTTCGTTCGTCC
gh11-1GGCTCTTACTCTGTGAACTGGGTAGCCGTTGCCCGAG
gh10-4GGGTGGGAGGAATGAAGAATCCTCGCCGCACACA
gh43-5GAATGTTTATCAGGGCACGGCTCATACCCAGTCCCG
actATGTCGACGTCAGGAAGGATCTGAGCAGTGATCTCCTTCTGCAT
clr-1GTTGTATTGTGCTTCTCGTCTTGAACGCTGTTGGAGGTCATC
clr-2ACGCAGTGTGGTTTCTCTACTCCAATACCGCCTCAATCTG
cre-1GAGGATCACGATGACCACTATGGAGTAGCAAGTGGAGTGTGATC
xlr-1AGAGTACCACAGCAACCAAGTTCGCTCATATCGCTCATGG

cbh-1 = Cellobiohydrolase 1 (exoglucanase) NCU07340; gh7-1 = Endoglucanase 1 NCU05057; gh3-2 = β-glucosidase 1 NCU08054; gh11-1 = Endo-1,4-β-xylanase 1 NCU02855; gh10-4 = Endo-1,4-β-xylanase 2 NCU07130; gh43-5 = β-xylosidase NCU09652. clr-1 = Cellulose degradation regulator-1 NCU07705; clr-2 = Cellulose degradation regulator-2 NCU08042; cre-1 = Carbon catabolite regulation NCU08807; xlr-1 = Xylan degradation regulator-1 NCU06971; act = actin NCU04173

cbh-1 = Cellobiohydrolase 1 (exoglucanase) NCU07340; gh7-1 = Endoglucanase 1 NCU05057; gh3-2 = β-glucosidase 1 NCU08054; gh11-1 = Endo-1,4-β-xylanase 1 NCU02855; gh10-4 = Endo-1,4-β-xylanase 2 NCU07130; gh43-5 = β-xylosidase NCU09652. clr-1 = Cellulose degradation regulator-1 NCU07705; clr-2 = Cellulose degradation regulator-2 NCU08042; cre-1 = Carbon catabolite regulation NCU08807; xlr-1 = Xylan degradation regulator-1 NCU06971; act = actin NCU04173

Enzymatic activities

Total cellulase activity (FPase) was determined by an enzymatic reaction employing Whatman filter paper no. 1, 30 μL of 100 mM citrate-phosphate buffer pH 5.0, and 30 μL of sample. The reaction was incubated at 50°C for 30 minutes. Next, 60 μL of dinitrosalicylic acid (DNS) was added to the reaction, which was then heated at 95°C for 5 minutes. Carboxymethylcellulase (CMCase) activity was determined following the protocol previously described [26] with some modifications. The reaction consisted of 30 μL of carboxymethylcellulose (CMC) prepared in 1% sodium acetate buffer (50 mM and pH 5.0) and 30 μL of sample. The reaction was incubated at 50°C for 30 minutes, followed by the addition of 60 μL of DNS, and an additional heating step at 95°C for 5 minutes. Xylanase activity was determined by reacting 50 μL of xylan substrate (xylan from beechwood [Sigma, MO, USA] at 50 mg/mL + 100 mM sodium acetate at pH 5.0) with 25 μL of sample at 50°C for 30 minutes. After incubation, 75 μL of DNS was added, and the reaction was heated at 95°C for 5 minutes. All enzymatic activities were performed in a 96-well microplate, and absorbance was read at 540 nm using the xMark™ Microplate Spectrophotometer (Bio-Rad, CA, USA). One enzyme unit was defined as the amount of enzyme capable of liberating 1 μmol of reducing sugar per minute [27].

Western blotting

The proteins secreted by N. crassa were transferred to nitrocellulose (GE Healthcare, Buckinghamshire, UK). Rabbit secondary antibodies and anti-cellulase-Trichoderma viride antibodies (LS-C147688, LifeSpan Biosciences, WA, USA) were used as previously described [28]. Antibodies were visualized by enhanced chemiluminescence (Santa Cruz Biotechnology, TX, USA).

In silico analysis of putative PAC-3 binding sites in N. crassa promoters

The complete genome sequence of N. crassa OR74A [29] was downloaded from https://www.broadinstitute.org/fungal-genome-initiative/neurospora-crassa-genome-project and was used to obtain the 5′ -upstream regions (1 kb) for each gene. The occurrence of the PAC-3 motifs 5′ -BGCCVAGV-3′ [30] were determined in the genes analyzed in this study, as well as for the 9730 genes in N. crassa genome, using an ad hoc Perl script. The motif frequency was calculated as the number of motif occurrences per kb.

Statistical analysis

All tests of statistical significance were performed using one-way ANOVA (nonparametric) followed by the Bonferroni test (comparing all pairs of columns), available in the Prism software v. 5.0. Significance was indicated in the form of probability values (*P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001).

Results

pac-3 deletion affects cellulase and xylanase activities

Since the growth rate of the Δpac-3 mutant on solid medium is affected by pH [31], we investigated the final growth (total protein content) of 74A, Δpac-3, and Δmus-52 in the cultured medium at pH 3.0, 5.0, 7.0, 8.0, and 10.0. The Δpac-3 mutant grew better at acidic (3.0 and 5.0) rather than neutral (7) or alkaline (8.0 and 10.0) pH when compared with 74A and Δmus-52 strains (Fig 1A). We conclude that the different growth rates observed in the Δpac-3 mutant can affect enzyme production; thus, all enzymatic activities were normalized by total protein content and expressed as specific activity. We also observed changes in the medium pH after the N. crassa strains 74A, Δpac-3, and Δmus-52 were cultivated for eight days on sugarcane bagasse. However, only the Δpac-3 strain showed a significant difference at both pH 3 and 8, probably because of its poor growth under these culture conditions (Fig 1B).
Fig 1

Total protein content (A) and pH changes (B) after growth of N. crassa for eight days on sugarcane bagasse.

Strains 74A, Δmus-52, and Δpac-3, were cultivated on sugarcane bagasse at pH 3.0, 5.0, 7.0, 8.0, and 10.0 (initial pH). The final growth and pH was measured on the eighth day. The error bar indicates the standard deviation. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Total protein content (A) and pH changes (B) after growth of N. crassa for eight days on sugarcane bagasse.

Strains 74A, Δmus-52, and Δpac-3, were cultivated on sugarcane bagasse at pH 3.0, 5.0, 7.0, 8.0, and 10.0 (initial pH). The final growth and pH was measured on the eighth day. The error bar indicates the standard deviation. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. To determine whether PAC-3 affects the secretion of hollocellulolytic enzymes by the fungus, we analyzed the profile of total cellulolytic (FPase), endoglucanase (CMCase), and xylanolytic activities in strains 74A, Δpac-3, and Δmus-52 (Fig 2).
Fig 2

PAC-3 influences holocellulase activity in N. crassa.

Total cellulolytic (FPase) (A), endoglucanase (CMCase) (B), and xylanolytic activities (C) were assayed in the supernatant of the strains 74A, Δmus-52, and Δpac-3 after their cultivation for eight days on sugarcane bagasse. Values show the mean of three replicates. The error bar indicates the standard deviation. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

PAC-3 influences holocellulase activity in N. crassa.

Total cellulolytic (FPase) (A), endoglucanase (CMCase) (B), and xylanolytic activities (C) were assayed in the supernatant of the strains 74A, Δmus-52, and Δpac-3 after their cultivation for eight days on sugarcane bagasse. Values show the mean of three replicates. The error bar indicates the standard deviation. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. With respect to total cellulolytic activity, we observed that the Δpac-3 strain showed nearly a 4-fold decrease in activity at an acidic pH of 3.0 and a 2.5-fold decrease at pH 5.0 as compared to that in the 74A strain (Fig 2A). However, after raising the pH to 7.0, 8.0, or 10.0, we observed an increase in specific FPase activity in the Δpac-3 strain (approximately 1-fold, 3-fold, and 4.5-fold, respectively) as compared to that in the parental strains, suggesting that the PAC-3 protein acts in neutral to alkaline pH by modulating the enzymatic activity and, consequently, the total specific cellulolytic activity (Fig 2A). As with FPAse activity, the same pattern was observed for the specific activity of endoglucanase (CMCase). At acidic pH environments, endoglucanase showed about 3-fold (pH 3.0) and 2.5-fold (pH 5.0) less activity than the parental strains (Fig 2B). At neutral pH, CMCase activity was approximately 2-fold higher than that of the parental strains. On the other hand, at alkaline pH, the endoglucanase activity only showed a significant difference at pH 10 (approximately 3-fold higher than the parental strains) (Fig 2B). When the xylanase activity profile was evaluated, a significant decrease was observed in the mutant strain Δpac-3 as compared to the 74A and Δmus-52 strains at pH 3.0 (6.5-fold), pH 5.0 (5.5-fold), pH 7.0 (2.7-fold), and pH 10.0 (2-fold) (Fig 2C). Except at pH 8.0, the protein PAC-3 appears to upregulate the expression of xylanase activity regardless of the initial culture pH value (Fig 2C). Since cellobiohydrolase I (CBH-1) is the most highly produced extracellular protein during N. crassa growth on cellulose [32], we performed western blot analysis to evaluate the influence of PAC-3 on cellulase secretion. Western blot analysis showed a high level of cellulase secretion in a pac-3+mus52+ background (strain 74A) irrespective of the initial pH but preferentially at neutral to alkaline pH (Fig 3). In a pac-3+mus52− background (strain Δmus-52), cellulase secretion preferentially occurred at neutral to alkaline pH. Unlike to observed for both strains, a decreased cellulase secretion was observed in the Δpac-3 strain at alkaline pH (pH 10.0). Thus, regardless of the initial culture pH, the protein PAC-3 affects the secretion of CBHI (Fig 3) as well as cellulase activity (Fig 2A).
Fig 3

Western blot analysis shows a reduced amount of cellulase (CBHI) at both neutral and alkaline pH.

The analysis was performed using supernatants collected from the N. crassa 74A, Δmus-52, and Δpac-3 strains after growth for eight days on sugarcane bagasse at pH 3.0, 5.0, 7.0, 8.0, and 10.0. Anti-cellulase antibody from Trichoderma viride were used to detect CBH-1.

Western blot analysis shows a reduced amount of cellulase (CBHI) at both neutral and alkaline pH.

The analysis was performed using supernatants collected from the N. crassa 74A, Δmus-52, and Δpac-3 strains after growth for eight days on sugarcane bagasse at pH 3.0, 5.0, 7.0, 8.0, and 10.0. Anti-cellulase antibody from Trichoderma viride were used to detect CBH-1.

PAC-3 affects holocellulolytic genes in different ways

To evaluate the influence of the transcription factor PAC-3 on the expression of holocellulolytic genes, we used RT-qPCR to determine the expression profiles of the cellulases-encoding genes cbh1, gh7-1 and gh3-2 and the hemicellulases-ecoding genes gh11-1, gh10-4 and gh43-5 in the N. crassa strains 74A, Δpac-3, and Δmus-52 (Fig 4).
Fig 4

Gene expression profiles of holocellulolytic enzymes in N. crassa.

The strains 74A, Δmus-52, and Δpac-3 grown on sugarcane bagasse at different pH (3.0, 5.0, 7.0, 8.0, and 10.0) were used for RT-qPCR experiments. (A) cbh-1 = Cellobiohydrolase 1 (exoglucanase) NCU07340; (B) gh7-1 = Endoglucanase 1 NCU05057; (C) gh3-2 = β-glucosidase 1 NCU08054; (D) gh11-1 = Endo-1,4-β-xylanase 1 NCU02855; (E) gh10-4 = Endo-1,4-β-xylanase 2 NCU07130; (F) gh43-5 = β-xylosidase NCU09652. Values show the mean of three replicates. The error bar indicates the standard deviation. *P < 0.05, **P < 0.01, ***P < 0.001.

Gene expression profiles of holocellulolytic enzymes in N. crassa.

The strains 74A, Δmus-52, and Δpac-3 grown on sugarcane bagasse at different pH (3.0, 5.0, 7.0, 8.0, and 10.0) were used for RT-qPCR experiments. (A) cbh-1 = Cellobiohydrolase 1 (exoglucanase) NCU07340; (B) gh7-1 = Endoglucanase 1 NCU05057; (C) gh3-2 = β-glucosidase 1 NCU08054; (D) gh11-1 = Endo-1,4-β-xylanase 1 NCU02855; (E) gh10-4 = Endo-1,4-β-xylanase 2 NCU07130; (F) gh43-5 = β-xylosidase NCU09652. Values show the mean of three replicates. The error bar indicates the standard deviation. *P < 0.05, **P < 0.01, ***P < 0.001. The behavior of holocellulolytic genes was quite varied in response to deletion of the pac-3 gene. Regarding cellulases, we observed that the absence of pac-3 decreased the expression of cbh1 in acidic (4-fold at pH 3.0 and 5.6-fold at pH 5.0), neutral (4-fold), and alkaline (7.5-fold at pH 8.0) media (Fig 4A). These results indicate that PAC-3 can serve as a positive regulator of cbh1 in acidic, neutral, and alkaline media. Expression of the endoglucanase gene (gh7-1) in Δpac-3 revealed a reduction at pH 3.0 (0.5-fold), pH 5.0 (2.7-fold), and pH 8.0 (1.6-fold) and an upregulation at pH 7.0 (1.6-fold) and pH 10.0 (approximately 6.5-fold) (Fig 4B). In contrast, the expression of β-glucosidase 1 (gh3-2) increased as compared to the parental strains at all tested pH conditions—except at pH 5.0—reaching a maximum expression at pH 10.0 (approximately 7.5-fold increase) (Fig 4C). This result suggests that PAC-3 can act as a repressor of β-glucosidase during the growth of N. crassa on sugarcane bagasse, principally in alkaline medium. Concerning the behavior of hemicellulases during the growth of N. crassa on sugarcane bagasse, we observed that expression of the gh11-1 gene decreased at all tested pH conditions (reaching an almost 5-fold reduction at pH 7.0), except at pH 10 (approximately 2-fold higher) (Fig 4D). In contrast, expression of the gh10-4 gene was null in the Δpac-3 strain in acidic and alkaline cultures (pH 3.0, pH 5.0, pH 8.0, and pH 10.0) as compared to that in 74A. However, at pH 7.0, the expression was dramatically reduced as compared to the parental strain (almost 4-fold) (Fig 4E). Thus, we believe that PAC-3 may be important in inducing the expression of the ebx2 gene at neutral pH. Similar to the gh11-1 gene, pac-3 deletion caused a reduction of gh43-5 expression in acidic and alkaline media (reaching 2.5-fold reduction at pH 5.0) (Fig 4F), suggesting that PAC-3 upregulates the expression of these genes. Our data reveal that PAC-3 affects the expression of holocellulolytic genes and can serve as a positive or negative regulator, depending on the initial pH of the cultures. Therefore, this transcription factor may be involved in fungal adaptation to different pH conditions, implicating a critical role for PAC-3 in the regulation of lignocellulosic biomass deconstruction in N. crassa. In order to understand how PAC-3 regulates cellulase and xylanase gene expression, we performed a genome-wide analysis of PAC-3 binding motifs. The results are presented in Fig 5. As can be observed, all studied genes showed potential motifs for PAC-3 binding [18]. The cellulase genes cbh-1 and gh7-1 contained three potential sites, while the gh3-2 glucosidase-encoding gene contained only two sites. For xylanases-encoding genes, the gene gh11-1 showed four potential PAC-3 binding sites, whereas gh10-4 and gh43-5 only contained one site. This data suggests that the transcription factor PAC-3 can directly regulate the expression of cellulases and xylanases.
Fig 5

Schematic representation of putative PAC-3 binding sites (5′ -BGCCVAGV-3′).

The analysis was performed using the region 1.0-kbp upstream of cellulolytic and xylanolytic genes. The position of the motifs is relative to the translation initiation codon (ATG). B = C or G or T; V = A or C or G, according to International Union of Pure and Applied Chemistry (IUPAC) norms.

Schematic representation of putative PAC-3 binding sites (5′ -BGCCVAGV-3′).

The analysis was performed using the region 1.0-kbp upstream of cellulolytic and xylanolytic genes. The position of the motifs is relative to the translation initiation codon (ATG). B = C or G or T; V = A or C or G, according to International Union of Pure and Applied Chemistry (IUPAC) norms.

The deletion of pac-3 affects the expression of transcription factor-encoding genes

Although PAC-3 appears to directly regulate cellulase and xylanase genes, we decided to investigate if PAC-3 also influences the expression of the major transcription factors that are known to regulate hollocelluases genes [9, 11]: xlr-1, cre-1, clr-1, and clr-2. First, we performed genome-wide analysis of the PAC-3 binding motifs in the promoters (1 kb upstream the start codon) of genes encoding these transcription factors. Only the gene cre-1 did not contain a potential binding site for PAC-3, whereas xlr-1 contained four sites, followed by two sites for clr-2, and one site for clr-1 (data not shown). The expression of transcription factor-encoding genes evaluated by RT-qPCR showed that, indeed, PAC-3 can regulate the expression of these factors, depending on pH conditions. Expression of xlr-1 decreased in all tested pH conditions, showing a 0.5-fold reduction at pH 8.0 when compared to that in the parental 74A strain (Fig 6A). Although, cre-1 does not contain a potential binding site for PAC-3, the expression of this gene was significantly decreased in acidic (pH 3.0) and alkaline (pH 8.0 and 10.) media, suggesting an indirect regulation of carbon catabolite repression mediated by CRE-1 by PAC-3 (Fig 6B). The expression of clr-1 and clr-2 were decreased in acidic (pH 3.0 and 5.0) and alkaline (pH 8.0) conditions. Notably, at pH 7.0, both transcription factors, clr-1 and clr-2, were upregulated when compared to the strain 74A (Fig 6C and 6D). Also, we noted that the deletion of the gene mus52 affected the expression of both cre-1 and clr-2 (Fig 6B and 6D). These results indicate that cellulase- and xylanase-encoding genes can be regulated by PAC-3 in both a direct and indirect manner.
Fig 6

Effect of pac-3 deletion on transcriptional factors gene expression.

The strains 74A, Δmus-52, and Δpac-3 grown on sugarcane bagasse at different pH (3.0, 5.0, 7.0, 8.0, and 10.0) were used for RT-qPCR experiments. (A) xlr-1 = Xylan degradation regulator-1 NCU06971; (B) cre-1 = Carbon catabolite regulator NCU08807; (C) clr-1 = Cellulose degradation regulator-1 NCU07705 and (D) clr-2 = Cellulose degradation regulator-2 NCU08042. Values show the mean of three replicates. The error bar indicates the standard deviation. *P < 0.05, **P < 0.01, ***P < 0.001.

Effect of pac-3 deletion on transcriptional factors gene expression.

The strains 74A, Δmus-52, and Δpac-3 grown on sugarcane bagasse at different pH (3.0, 5.0, 7.0, 8.0, and 10.0) were used for RT-qPCR experiments. (A) xlr-1 = Xylan degradation regulator-1 NCU06971; (B) cre-1 = Carbon catabolite regulator NCU08807; (C) clr-1 = Cellulose degradation regulator-1 NCU07705 and (D) clr-2 = Cellulose degradation regulator-2 NCU08042. Values show the mean of three replicates. The error bar indicates the standard deviation. *P < 0.05, **P < 0.01, ***P < 0.001.

Discussion

Different pH conditions lead microorganisms to adapt physiologically to ensure their survival and reproduction. For this purpose, organisms have developed signal transduction pathways, allowing the secretion of enzymes with optimal activity at specific pH values. The regulation of gene expression and secretion of extracellular hydrolytic enzymes is part of this process and is crucial to improving lignocellulosic biomass degradation [33]. Our data show that the transcription factor PAC-3, a well-defined pH regulator in several species of filamentous fungi [12, 13, 19, 20], is also involved in the regulation of holocellulolytic enzyme production in Neurospora crassa. A study by Mello-de-Souza et al. [19] involving the thermophilic fungus H. grisea var. thermoidea showed that the transcription factor PacC is responsible for the regulation of those genes encoding cellulases and xylanases, which are strongly induced in sugarcane bagasse cultures at alkaline pH. This regulation can occur in a direct or an indirect manner. Another transcriptome study with the phytopathogen fungus Colletotrichum gloeosporioides showed that pacC deletion affects the expression of several genes, including cell wall-degrading enzymes [34]. Considering cellulase secretion, we observed that PAC-3 does not interfere with the expression of endoglucanase (CMCase activity) in acidic media, similar to that found by He and collaborators [12] in T. reesei during growth on cellulose. In this same study, they observed that total cellulolytic activity was higher in the mutant strain ΔTrpac1 at neutral pH, as we showed for N. crassa, suggesting that T. reesei and N. crassa may share a similarity in PAC-3. However, the role of PAC1 in regulating cellulase-encoding genes in T. reesei is still unclear, since cellulase was not affected by pac1 deletion in another study [20]. PAC-3 both positively and negatively regulates the expression of holocellulolytic genes during the cultivation of N. crassa on sugarcane bagasse. A study of T. reesei using genome-wide transcriptional analysis showed that, although pac1 deletion affected several genes, few cellulases and hemicellulases were PAC1-regulated at pH 6.0, whereas β-glucosidase (Tr_47268) and alpha-1,6-mannanase (Tr_122495) were both downregulated in the Δpac1 mutant [20]. Analyzing the expression of a β-glucosidase (bg1), we noted that PAC-3 served as a repressor in both neutral and alkaline pH, different from that observed for the candidate β-glucosidase Tr_47268 from T. reesei. However, it is important to highlight that there are at least 11 β-glucosidases annotated in the T. reesei genome that could potentially be targeted for regulation. In contrast, our results agree with a previous report where the expression of bgl1 increased dramatically in the mutant ΔTrpac1 at neutral pH [12]. In A. nidulans, the induction or repression of cellulase genes is delayed in absence of the regulator PacC. RNA-sequencing analysis showed that genes encoding β-endoglucanases, cellobiohydrolases, and β-endoxylanases are among the major CAZy genes downregulated in ΔpacC mutant during growth on cellobiose at alkaline pH [13]. Our results also showed that in N. crassa there is a reduction in the expression of the genes cbh-1, gh11-1, and gh10-4 in Δpac-3 compared to that of the parental strain at all analyzed pH conditions, except for gh11-1 at pH 10.0. Also in A. nidulans, Perez-Gonzalez et al. [35] showed that during the growth on D-xylose, expression of β-xylosidase (xlnD) is partially reduced in the mutant strain pacC14, suggesting that this transcription factor serves to positively regulate xlnD. Our results suggest a similar regulation in N. crassa, considering that the expression of the β-xylosidase gene gh43-5 was also downregulated in the N. crassa Δpac-3 mutant. A study involving the phytopathogen fungus Alternaria alternata showed that environmental pH has a large influence on the expression of the endoglucanase AaK1 gene [36]. Examining the effect of PAC-3 on the expression of the eg1 gene in N. crassa, we observed that the Δpac-3 mutant showed reduced expression of eg1 at pH 8.0, whereas it increased considerably at pH 10.0. Thus, the effect of PAC-3 on the regulation of endoglucanase in N. crassa remains unclear. Overall, the transcription factor PAC-3 is involved in secretion and gene expression regulation of cell wall-degrading enzymes. Notably, genes with similar functions can be positively or negatively regulated by PAC-3 depending on pH conditions, as found in A. nidulans [13]. This observation may be related to the dual regulatory role of PacC, previously described by MacCabe et al. [37], in which two xylanases from A. nidulans have opposite expression patterns depending on environmental pH. This interesting finding should promote more detailed studies in understanding how pH is sensed by N. crassa and how PAC-3 is involved in synergism of holocellulase action. In Summary, our results suggest that PAC-3 acts inducing total cellulolytic activity and endoglucanase activity at acidic pH environments whereas acting as a repressor of total cellulolytic and endoglucanase activity at neutral and alkaline pH. On the other hand, for xylanase activity, PAC-3 acts as a positive regulator in all pH environments (except at pH 8.0). It is well known that holocellulolytic enzymes are both directly and indirectly regulated [13, 19], by PacC. Our study showed that all studied genes can be directly targeted by PAC-3, probably at transcriptional level. On the other hand, PAC-3 can also regulate the major transcription factors that regulate the expression of holocellulase-encoding genes. Given the regulons of these transcription factors [9, 11] and our results, we propose a simple model of hollocellulase regulation by PAC-3 during sugarcane bagasse degradation (Fig 7).
Fig 7

The model proposed for the regulation of holocellulolytic-encoding genes in N. crassa by PAC-3.

Changes in the pH environment lead to activation of PAC-3, which directly or indirectly regulates transcription of cellulases and xylanases as well as the transcription factors XLR-1, CLR-1, and CLR-2 genes. The transcription factor CLR-1 regulate transcription of both xlr-1 and clr-2 genes. These transcription factors can also regulate cellulases and xylanases. XLR-1 regulate transcription of gh3-1, gh11-1, and gh43-5 genes (purple arrows); CLR-1 regulate transcription of cbh-1 and gh7-1 genes (green arrows), and CLR-2 regulate transcription of cbh-1, gh7-1, and gh11-1 genes (red arrows). (?) Missing component in regulation of cre-1 by PAC-3.

The model proposed for the regulation of holocellulolytic-encoding genes in N. crassa by PAC-3.

Changes in the pH environment lead to activation of PAC-3, which directly or indirectly regulates transcription of cellulases and xylanases as well as the transcription factors XLR-1, CLR-1, and CLR-2 genes. The transcription factor CLR-1 regulate transcription of both xlr-1 and clr-2 genes. These transcription factors can also regulate cellulases and xylanases. XLR-1 regulate transcription of gh3-1, gh11-1, and gh43-5 genes (purple arrows); CLR-1 regulate transcription of cbh-1 and gh7-1 genes (green arrows), and CLR-2 regulate transcription of cbh-1, gh7-1, and gh11-1 genes (red arrows). (?) Missing component in regulation of cre-1 by PAC-3. Changes in the media pH activate the transcription factor PAC-3, which can then directly activate cellulase- and xylanases-encoding genes. In addition, PAC-3 can also directly activate xlr-1, which activates ß-glucosidase (gh3-1) as well as endo-xylanase (gh11-1) and ß-xylosidase (gh43-5). In this regulatory network, the transcription factor CLR-1 seems to have an important role. Directly, CLR-1 can activate only cellulases (cbh-1 and gh7-1); however CLR-1 can also activate xyr-1 and clr-2 [9], which in turn will activate holocellulases-encoding genes. Finally, CLR-2 can activate both cellulases (cbh-1 and gh7-1) and endo-xylanases (gh11-1) (Fig 7). CRE-1 mediates carbon catabolite repression, and PAC-3 can be involved in cre-1 expression in an indirect manner. However, despite these evidences of regulation, how the overlapping regulation between PAC-3 and other transcription factors, especially CLR-1, is governed remains unclear. Indirect regulation or overlapping regulation with transcriptional factors seems to be related to the availability of low molecular weight inducers in A. nidulans [13]. However, more detailed studies will be necessary to elucidate the mechanism involved.

Conclusion

Our data shows that the transcription factor PAC-3 from N. crassa influences the expression profile and secretion of cell wall-degrading enzymes during growth in sugarcane bagasse. At the different pH levels examined, we show that cellulase secretion is reduced in the absence of pac-3 at an alkaline pH, and xylanolytic activity is positively regulated by PAC-3 at pH 5.0, 7.0, and 10.0. Regarding holocellulolytic genes, we observed differential regulation depending on the pH of the culture medium, suggesting that N. crassa can adapt to different environmental conditions. PAC-3 can also activate the major transcription factors that regulate holocellulase gene expression, suggesting that regulation occurs in both a direct and indirect manner. Ambient pH is a key factor in the industrial production of biomass-degrading enzymes. Our study contributes to a better understanding of the mechanisms involved in holocellulase production in response to pH, thereby improving its use in several industrial processes.
  32 in total

1.  Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.

Authors:  K J Livak; T D Schmittgen
Journal:  Methods       Date:  2001-12       Impact factor: 3.608

2.  Cellulase of Neurospora crassa.

Authors:  B M Eberhart; R S Beck; K M Goolsby
Journal:  J Bacteriol       Date:  1977-04       Impact factor: 3.490

Review 3.  The Fungal Genetics Stock Center: from molds to molecules.

Authors:  Kevin McCluskey
Journal:  Adv Appl Microbiol       Date:  2003       Impact factor: 5.086

4.  Microplate-based carboxymethylcellulose assay for endoglucanase activity.

Authors:  Zhizhuang Xiao; Reginald Storms; Adrian Tsang
Journal:  Anal Biochem       Date:  2005-02-15       Impact factor: 3.365

5.  A high-throughput gene knockout procedure for Neurospora reveals functions for multiple transcription factors.

Authors:  Hildur V Colot; Gyungsoon Park; Gloria E Turner; Carol Ringelberg; Christopher M Crew; Liubov Litvinkova; Richard L Weiss; Katherine A Borkovich; Jay C Dunlap
Journal:  Proc Natl Acad Sci U S A       Date:  2006-06-26       Impact factor: 11.205

6.  The genome sequence of the filamentous fungus Neurospora crassa.

Authors:  James E Galagan; Sarah E Calvo; Katherine A Borkovich; Eric U Selker; Nick D Read; David Jaffe; William FitzHugh; Li-Jun Ma; Serge Smirnov; Seth Purcell; Bushra Rehman; Timothy Elkins; Reinhard Engels; Shunguang Wang; Cydney B Nielsen; Jonathan Butler; Matthew Endrizzi; Dayong Qui; Peter Ianakiev; Deborah Bell-Pedersen; Mary Anne Nelson; Margaret Werner-Washburne; Claude P Selitrennikoff; John A Kinsey; Edward L Braun; Alex Zelter; Ulrich Schulte; Gregory O Kothe; Gregory Jedd; Werner Mewes; Chuck Staben; Edward Marcotte; David Greenberg; Alice Roy; Karen Foley; Jerome Naylor; Nicole Stange-Thomann; Robert Barrett; Sante Gnerre; Michael Kamal; Manolis Kamvysselis; Evan Mauceli; Cord Bielke; Stephen Rudd; Dmitrij Frishman; Svetlana Krystofova; Carolyn Rasmussen; Robert L Metzenberg; David D Perkins; Scott Kroken; Carlo Cogoni; Giuseppe Macino; David Catcheside; Weixi Li; Robert J Pratt; Stephen A Osmani; Colin P C DeSouza; Louise Glass; Marc J Orbach; J Andrew Berglund; Rodger Voelker; Oded Yarden; Michael Plamann; Stephan Seiler; Jay Dunlap; Alan Radford; Rodolfo Aramayo; Donald O Natvig; Lisa A Alex; Gertrud Mannhaupt; Daniel J Ebbole; Michael Freitag; Ian Paulsen; Matthew S Sachs; Eric S Lander; Chad Nusbaum; Bruce Birren
Journal:  Nature       Date:  2003-04-24       Impact factor: 49.962

Review 7.  Ambient pH gene regulation in fungi: making connections.

Authors:  Miguel A Peñalva; Joan Tilburn; Elaine Bignell; Herbert N Arst
Journal:  Trends Microbiol       Date:  2008-05-03       Impact factor: 17.079

8.  Systems analysis of plant cell wall degradation by the model filamentous fungus Neurospora crassa.

Authors:  Chaoguang Tian; William T Beeson; Anthony T Iavarone; Jianping Sun; Michael A Marletta; Jamie H D Cate; N Louise Glass
Journal:  Proc Natl Acad Sci U S A       Date:  2009-12-15       Impact factor: 11.205

9.  pH regulates endoglucanase expression and virulence of Alternaria alternata in persimmon fruit.

Authors:  Dani Eshel; Itay Miyara; Tong Ailing; Amos Dinoor; Dov Prusky
Journal:  Mol Plant Microbe Interact       Date:  2002-08       Impact factor: 4.171

10.  Identification of the CRE-1 cellulolytic regulon in Neurospora crassa.

Authors:  Jianping Sun; N Louise Glass
Journal:  PLoS One       Date:  2011-09-29       Impact factor: 3.240

View more
  10 in total

Review 1.  Functional diversity in the pH signaling pathway: an overview of the pathway regulation in Neurospora crassa.

Authors:  Stela Virgilio; Maria Célia Bertolini
Journal:  Curr Genet       Date:  2017-11-08       Impact factor: 3.886

Review 2.  Conservation and diversity of the regulators of cellulolytic enzyme genes in Ascomycete fungi.

Authors:  Emi Kunitake; Tetsuo Kobayashi
Journal:  Curr Genet       Date:  2017-04-27       Impact factor: 3.886

Review 3.  Regulators of plant biomass degradation in ascomycetous fungi.

Authors:  Tiziano Benocci; Maria Victoria Aguilar-Pontes; Miaomiao Zhou; Bernhard Seiboth; Ronald P de Vries
Journal:  Biotechnol Biofuels       Date:  2017-06-12       Impact factor: 6.040

4.  mus-52 disruption and metabolic regulation in Neurospora crassa: Transcriptional responses to extracellular phosphate availability.

Authors:  Maíra P Martins; Eriston V Gomes; Pablo R Sanches; Wellington R Pedersoli; Nilce M Martinez-Rossi; Antonio Rossi
Journal:  PLoS One       Date:  2018-04-18       Impact factor: 3.240

5.  Extracellular vesicles carry cellulases in the industrial fungus Trichoderma reesei.

Authors:  Renato Graciano de Paula; Amanda Cristina Campos Antoniêto; Karoline Maria Vieira Nogueira; Liliane Fraga Costa Ribeiro; Marina Campos Rocha; Iran Malavazi; Fausto Almeida; Roberto Nascimento Silva
Journal:  Biotechnol Biofuels       Date:  2019-06-15       Impact factor: 6.040

6.  Proteomic analysis reflects an environmental alkalinization-coupled pH-dependent mechanism of regulating lignocellulases in Trichoderma guizhouense NJAU4742.

Authors:  Youzhi Miao; Xing Chen; Tuo Li; Han Zhu; Siyu Tang; Dongyang Liu; Qirong Shen
Journal:  Biotechnol Biofuels       Date:  2020-01-11       Impact factor: 6.040

7.  High Quality Aspergillus aculeatus Genomes and Transcriptomes: A Platform for Cellulase Activity Optimization Toward Industrial Applications.

Authors:  Wuttichai Mhuantong; Salisa Charoensri; Aphisit Poonsrisawat; Wirulda Pootakham; Sithichoke Tangphatsornruang; Chatuphon Siamphan; Surisa Suwannarangsee; Lily Eurwilaichitr; Verawat Champreda; Varodom Charoensawan; Duriya Chantasingh
Journal:  Front Bioeng Biotechnol       Date:  2021-01-27

8.  Plasma Promotes Fungal Cellulase Production by Regulating the Levels of Intracellular NO and Ca2.

Authors:  Nan-Nan Yu; Wirinthip Ketya; Eun-Ha Choi; Gyungsoon Park
Journal:  Int J Mol Sci       Date:  2022-06-15       Impact factor: 6.208

9.  Analysis of the phosphorylome of trichoderma reesei cultivated on sugarcane bagasse suggests post-translational regulation of the secreted glycosyl hydrolase Cel7A.

Authors:  Wellington Ramos Pedersoli; Renato Graciano de Paula; Amanda Cristina Campos Antoniêto; Cláudia Batista Carraro; Iasmin Cartaxo Taveira; David Batista Maués; Maíra Pompeu Martins; Liliane Fraga Costa Ribeiro; André Ricardo de Lima Damasio; Rafael Silva-Rocha; Antônio Rossi Filho; Roberto N Silva
Journal:  Biotechnol Rep (Amst)       Date:  2021-06-22

10.  Insights into the Lignocellulose-Degrading Enzyme System of Humicola grisea var. thermoidea Based on Genome and Transcriptome Analysis.

Authors:  Andrei Stecca Steindorff; Luana Assis Serra; Eduardo Fernandes Formighieri; Fabrícia Paula de Faria; Marcio José Poças-Fonseca; João Ricardo Moreira de Almeida
Journal:  Microbiol Spectr       Date:  2021-09-15
  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.