| Literature DB >> 28103859 |
Tero Puolakkainen1, Hongqian Ma2,3, Heikki Kainulainen2, Arja Pasternack4, Timo Rantalainen5, Olli Ritvos4, Kristiina Heikinheimo6,7,8, Juha J Hulmi2,9, Riku Kiviranta10,11.
Abstract
BACKGROUND: Inhibition of activin/<span class="Gene">myostatin pathway has emerged as a novel approach to increase muscle mass and bone strength. Duchenne muscular dystrophy (DMD) is a neuromuscular disorder that leads to progressive muscle degeneration and also high incidence of fractures. The aim of our study was to test whether inhibition of activin receptor IIB ligands with or without exercise could improve bone strength in the mdx mouse model for DMD.Entities:
Keywords: Animal models; Bone μCT; Bone-muscle interactions; Exercise; TGF-βs
Mesh:
Substances:
Year: 2017 PMID: 28103859 PMCID: PMC5244551 DOI: 10.1186/s12891-016-1366-3
Source DB: PubMed Journal: BMC Musculoskelet Disord ISSN: 1471-2474 Impact factor: 2.362
Fig. 1Reconstructed 3D images of the distal femur of control (a) and Act-R-Fc treated mice (b) showing a significant increase in bone mass in the treated group. μCT analysis of the distal femur showing (c) increased bone volume (BV/TV), (d) trabecular numbers (Tb.N), (e) decreased trabecular separation and (f) increased volumetric bone mineral density (vBMD) in ActRIIB-Fc-treated mice compared to controls. Significant increases in (g) cortical thickness and (h) mean total cross-area parameters were also noted. Running combined with ActRIIB-Fc treatment did not further improve these parameters N = 7-9 per group. # = p < 0.05 compared to PBS, * = p < 0.05 compared to PBS-R
Fig. 2Reconstructed 3D images of the 2nd lumbar vertebrae also showing a noticeable difference in bone mass between the control (a) and treatment group (b). Similar to the distal femur, (c) bone volume (BV/TV), (d) trabecular number (Tb.N) and (e) volumetric bone mineral density (vBMD) were increased while (f) trabecular separation (Tb. Sp) was decreased in ActRIIB-Fc-treated mice compared to controls. ActRIIB-Fc and running did not result in further beneficial effect. # = p < 0.05 compared to PBS, * = p < 0.05 compared to PBS-R
Fig. 3Histological images (H&E staining) of the distal femur showing an increase of trabecular numbers in ActRIIB-Fc treated group (b) compared to PBS controls (a). TRACP staining of distal femurs of control (c) and Act-R-Fc treated mice (d). Histomorphometric analysis showed increased bone volume (e) and trabecular number (f) and decreased trabecular separation (g) as in μCT. Interestingly, the number of TRACP positive osteoclasts was reduced in Act-R-Fc-treated mice (h). The region of interest from which the trabecular islands and the stained osteoclasts were analyzed consisted of an 800μm x 1200μm area near the distal growth plate. N = 8-9 per group. # = p < 0.05 compared to PBS
Fig. 4qPCR analyses show changes in the expression of key markers for bone metabolism. Abbreviations in order: Runt related transcription factor 2, Type I collagen, Osteopontin, Dentin matrix protein 1, Sclerostin, Dickkopf-related protein 1, Receptor activator of nuclear factor kappa-B ligand, Osteoprotegerin, Tartrate resistant acid phosphatase, Cathepsin K. N = 6-7 per group. * = p ≤ 0.05 compared to PBS group
Fig. 5Biomechanical testing of femurs and tibias. A significant increase in both maximum force and stiffness was measured in the Act-R-Fc treated mice compared to the control group. However there was no statistical significance between the ActRIIB-Fc-treated and control running groups. N = 7-9 per group. # = p < 0.05 compared to PBS, * = p < 0.05 compared to PBS-R
| Primer | Forward sequence | Reverse sequence |
|
| CGTGGGCCGCCCTAGGCACCA | TTGGCCTTAGGGTTCAGGGGG |
|
| GCCCAGGCGTATTTCAGA | TGCCTGGCTCTTCTTACTGAG |
|
| GAGCGGAGAGTACTGGATCG | GCTTCTTTTCCTTGGGGTTC |
|
| ATCTGGGTGCAGGCTGTAA | CCCGGTGAAAGTGACTGATT |
|
| TTGGGATGCGATTCCTCTAC | GGTTTTGACCTTGTGGGAAA |
|
| GCAGCTGTACTCGGACACATC | TCCTGAGAACAACCAGACCA |
|
| GACAACTACCAGCCCTACCC | GATCTGTACACCTCCGACGC |
|
| TGAAGACACACTACCTGACTCCTG | CCACAATGTGTTGCAGTTCC |
|
| ACCCAGAAACTGGTCATCAGC | CTGCAATACACACACTCATCACT |
|
| CGTCTCTGCACAGATTGCAT | AAGCGCAAACGGTAGTAAGG |
|
| AGGCATTGACTCTGAAGATGCT | TCCCCACAGGAATCTCTCTG |