Phenotypic and genotypic characterization of locally isolated Salmonella strains used in preparation of Salmonella antigens in Egypt.

AIM: This work was conducted to study the phenotypic and genotypic characterization of locally isolated Salmonella strains (Salmonella Pullorum, Salmonella Enteritidis, and Salmonella Typhimurium) from poultry used in the preparation of Salmonella antigens in Egypt.
MATERIALS AND METHODS: The phenotypic characterization of Salmonella strains was done using standard microbiological, biochemical, and serological techniques. Molecular identification was done using different sets of primers on different genes using different polymerase chain reaction (PCR) techniques.
RESULTS: The phenotypic characterization of Salmonella strains was confirmed. Molecular identification revealed detection of 284 bp fragment of InvA gene in all studied Salmonella strains. Furthermore, multiplex PCR was used for more confirmation of being Salmonella spp., generally at 429 bp as well as genotyping of Salmonella Typhimurium and Salmonella Enteritidis at 559 and 312 bp, respectively, in one reaction.
CONCLUSION: The locally isolated field Salmonella strains were confirmed phenotypically and genotypically to be Salmonella Enteritidis, and Salmonella Typhimurium and could be used for the preparation of Salmonella antigens.

Introduction

Salmonella organisms are responsible for a variety of acute and chronic diseases in poultry, animals, and humans [1]. Salmonella bacteria are facultative intracellular pathogens causing localized or systemic infections, in addition to a chronic asymptomatic carrier state. Many different serotypes of Salmonella have been isolated from poultry, most of them have a public health significance, but some include Salmonella Typhimurium, Salmonella Enteritidis, Salmonella Pullorum, and Salmonella Gallinarum can cause considerable losses in birds of less than a few weeks of age [2]. Salmonella enterica serovars Typhimurium and Salmonella enterica serovars Enteritidis are the most frequently isolated serovar from foodborne outbreaks throughout the world [3]. Salmonella Pullorum is a typical bacterial disease that has threaten the modern poultry industry over the past years. Chicken becomes the carrier in the spread of Salmonella Pullorum and may cause economic losses worldwide through mortality, morbidity, and reductions in egg production [4]. Establishing conventional methods was applied to detect and identify Salmonella include selective enrichment and plating followed by biochemical tests and serological identification [5]. In general, these techniques are time-consuming since they give only presumptive results after 3-4 days and definitive results after 5-6 days [6]. However, because of controversy in interpreting results, low sensitivity and specificity of these methods, rapid detection methods, such as DNA or RNA probing, immuno-detection methods and nucleic acid hybridization have been developed, but they do not have enough sensitivity and specificity [7].

In vitro amplification of DNA by the polymerase chain reaction (PCR) method is a powerful tool in microbiological diagnostics [8]. Several genes have been used to detect Salmonella in natural environmental samples as well as food and fecal samples. Virulence chromosomal genes - including invA, invE and himA, phoP - are target genes for PCR amplification of Salmonella species [9]. The invA gene of Salmonella contains sequences unique to this genus and has been proved as a suitable PCR target with potential diagnostic applications [10]. Multiplex PCR simultaneously detecting several pathogens in a single-tube reaction and has the potential of saving time and effort, lowering testing-related laboratory cost [11]. Typing of Salmonella Enteritidis and Typhimurium using multiplex PCR reaction is depending on sefA gene which encodes for SEF14 fimbrial antigen characteristic for Salmonella Enteritidis while fliC gene variable region encoding for flagellin H1 was characteristic for Salmonella Typhimurium [12].

The objective of this work was to characterize the locally isolated Salmonella strains used in the preparation of Salmonella antigens in Egypt by both phenotypic and genotypic methods.

Materials and Methods

Ethical approval

The approval from the Institutional Animal Ethics Committee to carry out this study was not required as no invasive technique was used.

Bacterial strains

Three local field Salmonella strains (Salmonella Pullorum, Salmonella Enteritidis, and Salmonella Typhimurium) isolated from chickens, kindly obtained from Bacterial Sera and Antigens Research Department, Veterinary Serum and Vaccine Research Institute, Abbasia, Egypt were used to study their phenotypic and genotypic characterization. All isolates were confirmed as Salmonella different types using both morphological and biochemical identification [13]. Serological typing was performed using reference Salmonella antisera [14].

Total DNA extraction of Salmonella isolates

That was performed by boiling the overnight incubated culture broth for 10 min in dry bath and centrifuged at 5000 ×g for 10 min. The supernatant was used for amplification by PCR using Salmonella-specific primers. The extract was divided into aliquots and kept at −20°C until use as PCR template [15].

Primers set

Primers used were supplied by Metabion (Germany) and summarized in Table-1. For diagnosis of Salmonella spp. generally, a primer set was used for amplification of 284 bp of InvA gene [10]. Another primer sets were used for general identification of Salmonella spp. as well as typing of Salmonella Typhimurium and Salmonella Enteritidis in a multiplex PCR reaction [12]. Typing of Salmonella Pullorum was done using a duplex PCR, to differentiate between Salmonella Gallinarum and Salmonella Pullorum depending on the presence of speC gene in both strains but glgC gene is unique for Salmonella Gallinarum only [16].

Table-1

Primer sets for Salmonella strains PCR.

Primer set	Salmonella strain	Target gene	Primer sequence 5’ 3’	Length	Amplicon fragment (bp)
S139	Salmonella spp.	invA gene	GTG AAA TTA TCG CCA CGT TCG GGC AA	26	284
S141			TCA TCG CAC CGT CAA AGG AAC C	22
ST11	Salmonella spp.	Randomly cloned chromosomal fragment	AGCCAACCATTGCTAAATTGGCGCA	25	429
ST15			GGTAGAAATTCCCAGCGGGTACTG	24
Fli 15	Salmonella Typhimurium	fliC	CGG TGT TGC CCA GGT TGG TAA T	22	559
Tym			ACT CTT GCT GGC GGT GCG ACT T	22
Sef167	Salmonella Enteritidis	SefA gene	AGG TTC AGG CAG CGG TTA CT	20	312
Sef478			GGG ACA TTT AGC GTT TCT TG	20
SG-L	Salmonella Pullorum	glgC	GAT CTG CTG CCA GCT CAA	18	252
SG-R			GCG CCC TTT TCA AAA CAT A	19
SGP-L		speC	CGG TGT ACT GCC CGC TAT	18	174
SGP-R			CTG GGC ATT GAC GCA AA	17

PCR=Polymerase chain reaction

PCR amplification

Amplification was performed as following: 12.5 µl of ×2 Dream Taq Green PCR Master Mix (Fermentas), 100 pmol of upstream primer, 100 pmol of downstream primer, 4 µl of template DNA and nuclease-free water up to 25 µl using thermal cycler PerkinElmer Gene Amp PCR system 9700. Amplification conditions of 284 bp of InvA gene where the thermal cycler were adjusted to 1 cycle at 95°C for 1 min, then 35 cycles at 95°C for 1 min, 64°C for 30 s, 72°C for 30 s followed by 1 cycle at 94°C for 4 min [17]. For multiplex PCR, the amplification conditions were adjusted to 1 cycle at 94°C for 1 min, 35 cycles at 94°C for 30 s, 56°C for 1 min 30 s, 72°C for 30 s followed by 1 cycle at 72°C for 10 min [12]. Duplex PCR was performed [16,18], with a wide range of annealing temperatures, where PCR conditions were 1 cycle at 95°C for 5 min, 35 cycle of 95°C for 30 s, 55-65°C for 30 s, and 72°C for 30 s followed by a final extension step at 72°C for 10 min. Sterile DNase and RNase free water were used as negative PCR control.

Analysis of PCR products

All amplified products were analyzed by electrophoresis using 1-1.5% agarose gel (Applichem, Germany, GmbH) and visualized by ultraviolet transilluminator after gel staining with ethidium bromide stain (Fisher). The product size was measured using 100 bp DNA Ladder (Fermentas) that was used as a marker for PCR products. The gel was photographed by a gel documentation system (Alpha Innotech, Biometra), and the data were analyzed through computer software.

DNA sequence and analysis

PCR fragment of speC gene of Salmonella Pullorum was purified with agarose gel extraction kit Qiaquick (Qiagen, Germany). Sequence analysis of this fragment was performed using the same PCR primers (Macrogen Inc., Seoul, Korea).

Results

In this study, three locally fields isolated Salmonella strains used in preparation of Salmonella antigens in Egypt were tested and confirmed to be Salmonella species phenotypically by culturing and biochemical testing. Furthermore, these strains were confirmed serologically to be Salmonella Pullorum, Salmonella Enteritidis, and Salmonella Typhimurium (Table-2). On the other hand, strains were confirmed to be related to Salmonella spp. by invA specific PCR methods as all isolates showed positive bands at 284 bp (Figure-1).

Table-2

Results of serotyping of Salmonella strains.

Salmonella groups and types	Antigenic formula
	O	H
		1	2
Salmonella Pullorum	1, 9, 12
Salmonella Typhimurium	1, 4, 5, 12	I	1, 2
Salmonella Enteritidis	1, 9, 12	g, m	(1, 7)

( )=May be absent

Figure-1

Agarose gel electrophoresis showing amplification of 284 bp of Inv A gene of Salmonella spp. Lane M: 100 bp DNA ladder (Fermentas), Lane 1: Salmonella Typhimurium, Lane 2: Salmonella Enteritidis, Lane 3: Salmonella Pullorum, Lane 4: Negative polymerase chain reaction control.

Genotype identification was done using multiplex PCR assay with simultaneous characterization of Salmonella spp. generally. The results obtained showed that the three used strains were positive by PCR primers set (ST11, ST15) showing specific bands at 429 bp (Figure-2) for all Salmonella spp. Multiplex PCR could differentiate between Salmonella Enteritidis and Salmonella Typhimurium that showing sharp specific bands at 312 and 559 bp, respectively (Figure-2).

Figure-2

Genotyping of Salmonella strains by multiplex polymerase chain reaction (PCR). Lane M: 100 bp DNA ladder (Fermentas), All strains shared the same band at 429 bp which is general for all Salmonella spp. Lane 1 showed band at 312 bp specific for Salmonella Enteritidis. Lane 2 showed band at 559 bp specific for Salmonella Typhimurium, Lane 3 Salmonella Pullorum was negative for both Salmonella Typhimurium and Salmonella Enteritidis and showed only band 429 bp general for all Salmonella spp., Lane 4: Negative PCR control.

Duplex PCR for identification of Salmonella Pullorum results as shown in Figure-3 revealed a band at 220 bp at 60°C annealing temperature only. None other bands were obtained by repeating the test with different PCR conditions. Furthermore, this test showed negative results or no product when tested with Salmonella Typhimurium and Salmonella Enteritidis. This band was purified for sequence analysis. The data obtained from sequence analysis of this fragment (data not shown) showed that this PCR fragment is not related to speC or glgC genes at all but it was related to yejBEF gene which is common among many other Salmonella spp.

Figure-3

Duplex polymerase chain reaction (PCR) analysis to differentiate between biovars Gallinarum and Pullorum, Lane M: 100 bp DNA ladder (Fermentas), Lane 1: Salmonella Pullorum showing band at 220 bp, Lane 2: Salmonella Typhimurium, Lane 3: Salmonella Enteritidis, Lane 4: Negative PCR control.

Discussion

Salmonella contamination of eggs has been identified as a public health concern worldwide. Globally, Salmonella is one of the most prevalent causes of foodborne illness [19]. Culture techniques are universally recognized as standard methods for detection of bacterial pathogens, such as Salmonella in foodstuffs [20]. These techniques generally take longer time [8] and are less sensitive compared to PCR-based methods [21]. InvA gene specific PCR method is the most used in diagnostic and research laboratories, and Salmonella identification by molecular techniques is the simplest and less expensive method [10].

In this study, all the three locally field isolated strains used in the preparation of Salmonella antigens in Egypt were tested and confirmed phenotypically to be Salmonella Pullorum, Salmonella Enteritidis and Salmonella Typhimurium by culturing, biochemical testing and serological characterization. These strains were confirmed to be related to Salmonella spp. by invA specific PCR methods as all isolates showed positive bands at 284 bp (Figure-1) which agree with the previously reported results [10,17]. Genotype identification was done using multiplex PCR assay with simultaneous characterization of Salmonella spp. generally. The results obtained showed that the three used strains were positive by PCR primers set (ST11, ST15) showing specific bands at 429 bp (Figure-2) for all Salmonella spp. Multiplex PCR could differentiate between Salmonella Enteritidis and Salmonella Typhimurium that showing sharp specific bands at 312 and 559 bp, respectively (Figure-2). Using the conventional PCR technique is a convenient tool for rapid and accurate identity of different Salmonella spp. as well as genotypic characterization of different Salmonella type either Salmonella Typhimurium, Salmonella Enteritidis and can be used as confirmatory tool with high sensitivity even if biochemical or serological tests were not available or the time factor is critical [6,12].

Duplex PCR results as shown in Figure-3 revealed a band at 220 bp. It was not the expected specific size of Salmonella Pullorum at 174 bp [16] but it was the only band obtained at different PCR conditions as well as it was negative with other used strains. The possibility of insertions was reported previously through mapped genomes of serovar Pullorum [22] and its comparisons with the genomes of other Salmonella serovars revealed several insertions, deletions, and rearrangements in serovars Gallinarum [23]. All these results drove us to suspect that the resulted band at 220 bp was due to nucleotide insertion either characteristic for Egyptian field isolates or due to serial passage. For clarification of this conflict, this band was purified for sequence analysis. The data obtained from sequence analysis of this fragment (data not shown) showed that this PCR fragment is not related to speC or glgC genes at all but it was related to yejBEF gene which is common among many other Salmonella spp. [24] that contributes to the virulence and antimicrobial resistance [25]. The false positive band at nonspecific size 220 bp may be due to false priming of downstream primer of speC gene at yejBEF gene within Salmonella genome as the primer design was based on an 11 bp deletion in the glgC gene and a 4 bp deletion in speC. Furthermore, it was found that glgC gene was a pseudogene in Salmonella Gallinarum while speC was a pseudogene in both biovars. In bacterial genomes, pseudogenes are continually created from ongoing mutational processes and are subject to degradation and removal by further accumulation of mutations. Their retention time seems to be extremely short and, even in very closely related bacteria, they tend to be deleted at a relatively rapid rate [26]. All these findings decreased the sensitivity and reliability of this duplex PCR. More investigations are required for rapid and easy identification of Salmonella Pullorum, as the previously reported conventional DNA-based methods are not feasible due to a high level of sequence similarities among Salmonella serovars as well as the limitation in resolution between biovars Gallinarum and Pullorum [27,28]. Furthermore, post-PCR steps as RFLP is laborious and time-consuming [29,30].

Conclusion

The locally isolated field Salmonella strains were confirmed phenotypically and genotypically to be Salmonella Enteritidis and Salmonella Typhimurium and could be used for the preparation of Salmonella antigens. Further studies are required to develop and establish rapid and accurate protocols for genotyping of Salmonella Pullorum.

Authors’ Contributions

HMI and HAA designed the work. HMI, DAMA and HAA conducted the research work. Data analysis and manuscript were written by HMI, DAMA and HAA under the guidance of MIE. All the authors have read and approved the final manuscript.