| Literature DB >> 28095669 |
Jian Li1, Fu-Nan He1, Hong-Xiang Zheng1, Rui-Xiang Zhang1, Yi-Jing Ren1,2, Wei Hu1,3.
Abstract
Armillifer agkistrodontis (Ichthyostraca: Pantastomida) is a parasitic pathogen, only reported in China, which can cause a zoonotic disease, pentastomiasis. A complete mitochondrial (mt) genome was 16,521 bp comprising 13 protein-coding genes (PCGs), 22 tRNA genes, 2 rRNA genes, and 1 non-coding region (NCR). A phylogenetic tree drawn with the concatenated amino acid sequences of the 6 conserved PCGs (atp6, cox1-3, and nad2) showed that A. agkistrodontis and Armillifer armillatus constituted a clade Pentastomida which was a sister group of the Branchiura. The complete mt genome sequence of A. agkistrodontis provides important genetic markers for both phylogenetic and epidemiological studies of pentastomids.Entities:
Keywords: Armillifer agkistrodontis; mitochondrial genome; pentastome; pentastomid; phylogenetics
Mesh:
Year: 2016 PMID: 28095669 PMCID: PMC5266366 DOI: 10.3347/kjp.2016.54.6.813
Source DB: PubMed Journal: Korean J Parasitol ISSN: 0023-4001 Impact factor: 1.341
Primer sequences used to amplify PCR fragments of Armillifer agkistrodontis
| Primer name | Sequences (5′-3′) | Size (kb) |
|---|---|---|
| AA-1 | F: ACTTATTAGTCGAACAGA | ~6 |
| AA-2 | F: ACCTTCAAAGCTGGAAAT | ~2.2 |
| AA-3 | F: CTTGCCAACTCCTCCATTGATACTGCC | ~1.8 |
| AA-4 | F: TATAACCATAATTGAACTCCTCAGC | ~2.6 |
| AA-5 | F: CATTCATCGCACATCCTG | ~3.4 |
| AA-6 | F: TTCTCCTCATAATAACTTC | ~3 |
Fig. 1The mitochondrial genome of Armillifer agkistrodontis. The underlined genes are transcribed anticlockwise, while those without underlining are transcribed clockwise. All the tRNA genes are indicated with the 1-letter code of their corresponding amino acids. There are 2 tRNA genes for leucine: L1 for codons CUN and L2 for UUR; and 2 tRNA genes for serine: S1 for codons AGN and S2 for UCN. “NCR” refers to the non-coding region.
Fig. 2A phylogenetic tree of Armillifer agkistrodontis with other arthropods based on 6 conserved mitochondrial protein coding genes. Opisthopatus cinctipes and Metaperipatus inae (Onychophora) were used as outgroups.
Organization of the mitochondrial genome of Armillifer agkistrodontis
| Gene/region | Strand | Positions | Size (bp) | No. of aa1 | Ini/Ter codons | Anticodons | In |
|---|---|---|---|---|---|---|---|
| + | 1–54 | 54 | TGA | 0 | |||
| + | 61–120 | 60 | GAT | 6 | |||
| + | 122–182 | 61 | CAT | 1 | |||
| + | 183–1,145 | 963 | 320 | ATT/TAG | 0 | ||
| + | 1,144–1,200 | 57 | TCA | −2 | |||
| − | 1,193–1,252 | 60 | GCA | −8 | |||
| − | 1,251–1,315 | 65 | TTG | −2 | |||
| − | 1,318–1,377 | 60 | GTA | 2 | |||
| + | 1,379–2,903 | 1,525 | 508 | CTG/T | 1 | ||
| + | 2,904–2,966 | 63 | TAA | 0 | |||
| + | 2,967–3,630 | 664 | 221 | ATA/T | 0 | ||
| + | 3,631–3,685 | 55 | GTC | 0 | |||
| + | 3,686–3,796 | 111 | 36 | ATA/TAA | 0 | ||
| + | 3,793–4,446 | 654 | 218 | ATA/TAA | −4 | ||
| + | 4,446–5,226 | 781 | 260 | ATG/T | −1 | ||
| + | 5,227–5,282 | 56 | TCC | 0 | |||
| + | 5,283–5,627 | 345 | 114 | ATC/TAA | 0 | ||
| + | 5,626–5,682 | 57 | TGC | −2 | |||
| + | 5,682–5,744 | 63 | TCG | −1 | |||
| + | 5,744–5,800 | 57 | TTT | −1 | |||
| + | 5,800–5,852 | 53 | GTT | −1 | |||
| + | 5,852–5,908 | 57 | TCT | −1 | |||
| + | 5,909–5,963 | 55 | TTC | 0 | |||
| − | 5,962–6,018 | 57 | GAA | −2 | |||
| − | 6,019–7,624 | 1,606 | 535 | ATG/T | 0 | ||
| − | 7,626–7,687 | 62 | GTG | 1 | |||
| − | 7,687–8,947 | 1,261 | 420 | ATG/T | −1 | ||
| − | 8,941–9,210 | 270 | 89 | ATA/TAG | −7 | ||
| − | 9,227–9,282 | 56 | TGT | 16 | |||
| − | 9,283–9,338 | 56 | TGG | 0 | |||
| + | 9,340–9,783 | 444 | 148 | ATC/TAA | 1 | ||
| + | 9,783–10,892 | 1,110 | 370 | ATG/TAA | −1 | ||
| − | 10,915–11,832 | 918 | 305 | ATG/TAA | 22 | ||
| rnl | 11,833–12,976 | 1,144 | 0 | ||||
| − | 12,977–13,033 | 57 | TAC | 0 | |||
| 13,034–13,692 | 659 | 0 | |||||
| − | 13,693–13,752 | 60 | TAG | 0 | |||
| 13,753–16,521 | 2,769 | 0 |