Corrigendum: Ultra-sensitive droplet digital PCR for detecting a low-prevalence somatic GNAQ mutation in Sturge-Weber syndrome.

This Article contains a typographical error in the name of fluorescence dye for the mutant LNA probe in Table 3. The correct Table 3 appears below.

Table 3

Primer information	Primer and probe sequences
PCR primers amplifying a 178-bp fragment containing a GNAQ mutation which was cloned into TA vector.	5′−ATTGTGTCTTCCCTCC−3′ (forward)
	5′−GGTTTCATGGACTCAG−3′ (reverse)
ddPCR primers amplfying a 114-bp fragment containing a GNAQ mutation	5′−CCTGCCTACGCAACAAGAT−3′ (forward)
	5′−AGGTTTCATGGACTCAGTTACTAC−3′ (reverse)
LNA probes	5′(HEX)−TGGGGAC+T+C+GAAC−3′(IABkFQ) (wild−type)
	5′(FAM)−TGGGG+AC+T+T+GAAC−3′(IABkFQ) (mutant)
PNA probe (wild type)	5′−GGGACTCGAACTCTA−3'