Barbara Celona1, John von Dollen2, Sarat C Vatsavayai3, Risa Kashima1, Jeffrey R Johnson2, Amy A Tang4, Akiko Hata1, Bruce L Miller3, Eric J Huang4, Nevan J Krogan2, William W Seeley3,4, Brian L Black1,5. 1. Cardiovascular Research Institute, University of California, San Francisco, San Francisco, United States. 2. Department of Cellular and Molecular Pharmacology, University of California, San Francisco, San Francisco, United States. 3. Department of Neurology, University of California, San Francisco, San Francisco, United States. 4. Department of Pathology, University of California, San Francisco, San Francisco, United States. 5. Department of Biochemistry and Biophysics, University of California, San Francisco, San Francisco, United States.
Abstract
Expanded GGGGCC repeats in the first intron of the C9orf72 gene represent the most common cause of familial amyotrophic lateral sclerosis (ALS), but the mechanisms underlying repeat-induced disease remain incompletely resolved. One proposed gain-of-function mechanism is that repeat-containing RNA forms aggregates that sequester RNA binding proteins, leading to altered RNA metabolism in motor neurons. Here, we identify the zinc finger protein Zfp106 as a specific GGGGCC RNA repeat-binding protein, and using affinity purification-mass spectrometry, we show that Zfp106 interacts with multiple other RNA binding proteins, including the ALS-associated factors TDP-43 and FUS. We also show that Zfp106 knockout mice develop severe motor neuron degeneration, which can be suppressed by transgenic restoration of Zfp106 specifically in motor neurons. Finally, we show that Zfp106 potently suppresses neurotoxicity in a Drosophila model of C9orf72 ALS. Thus, these studies identify Zfp106 as an RNA binding protein with important implications for ALS.
Expanded GGGGCC repeats in the first intron of the C9orf72 gene represent the most common cause of familial amyotrophic lateral sclerosis (ALS), but the mechanisms underlying repeat-induced disease remain incompletely resolved. One proposed gain-of-function mechanism is that repeat-containing RNA forms aggregates that sequester RNA binding proteins, leading to altered RNA metabolism in motor neurons. Here, we identify the zinc finger protein Zfp106 as a specific GGGGCC RNA repeat-binding protein, and using affinity purification-mass spectrometry, we show that Zfp106 interacts with multiple other RNA binding proteins, including the ALS-associated factors TDP-43 and FUS. We also show that Zfp106 knockout mice develop severe motor neuron degeneration, which can be suppressed by transgenic restoration of Zfp106 specifically in motor neurons. Finally, we show that Zfp106 potently suppresses neurotoxicity in a Drosophila model of C9orf72ALS. Thus, these studies identify Zfp106 as an RNA binding protein with important implications for ALS.
Entities:
Keywords:
D. melanogaster; RNA binding protein; knockout animals; mouse; neurodegeneration; neuroscience; transgenic animals; zinc finger protein
Expanded GGGGCC repeats in the first intron of the C9orf72 gene represent the most common cause of familial amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) (DeJesus-Hernandez et al., 2011; Renton et al., 2011). The repeat expansion has been identified in more than 40% of familial ALS and in at least 7% of sporadic cases (Majounie et al., 2012). Several gain-of-function mechanisms for how the expanded hexanucleotide repeats cause disease have been proposed. One idea suggests that toxic dipeptide repeat (DPR) proteins generated by repeat associated non-ATG (RAN) translation of the RNA repeats cause neurodegeneration (Kwon et al., 2014; Mizielinska et al., 2014; Mori et al., 2013). Another major proposed gain-of-function mechanism for C9orf72ALS is via the formation of pathogenic repeat RNA aggregates that sequester one or more RNA binding proteins, leading to altered RNA processing and metabolism in motor neurons (Cooper-Knock et al., 2015; Haeusler et al., 2014; Lee et al., 2013; Prudencio et al., 2015; Sareen et al., 2013).Zfp106 is a C2H2 zinc finger protein with four predicted zinc fingers and seven WD40 domains (Grasberger and Bell, 2005). The mouseZfp106 gene is located on chromosome 2 at 60.37 cM (Chr2:120,506,820–120,563,843 bp; Genome Reference Consortium, Mouse Build 38). In addition, the human ortholog, ZNF106, is located at human chromosome 15q15.1 (Chr15: 42,412,437–42,491,197; Genome Reference Consortium Human Build 38), a region with strong linkage to a rare recessive familial form of ALS (Hentati et al., 1998), suggesting a possible role in humanALS. Consistent with this notion, mice lacking Zfp106 function show evidence of nondevelopmental neuromuscular degeneration, also suggestive of a possible role for Zfp106 in ALS (Anderson et al., 2016; Joyce et al., 2016; van der Weyden et al., 2011).Here, we identify a previously unknown role for Zfp106 as an RNA binding protein that specifically interacts with GGGGCC repeats and with a network of ALS-associated RNA-binding proteins, including TDP-43. In addition, we establish that knockout of Zfp106 in mice results in an ALS-like motor phenotype and that transgenic restoration of Zfp106 expression specifically in motor neurons suppresses the neurodegenerative phenotype in knockout mice. Finally, we show that Zfp106 is a potent suppressor of neurotoxicity caused by expression of GGGGCC repeats in a Drosophila model of C9orf72ALS. Thus, these studies have important implications for the most common form of humanALS.
Results and discussion
Sequestration of RNA binding proteins by rGGGGCC repeats has been implicated in the pathology of C9orf72ALS (Mizielinska and Isaacs, 2014). Therefore, to identify rGGGGCC-binding proteins that may be sequestered by repeat-containing RNA and involved in the pathology of C9orf72ALS, we performed a pull-down assay using biotinylated r(GGGGCC)8 RNA and identified the zinc finger protein Zfp106 as a previously unknown rGGGGCC-binding protein. Zfp106 bound specifically to r(GGGGCC)8 but not the control sequence r(AAAACC)8 (Figure 1a). RNA electrophoretic mobility shift assay (EMSA) using purified Zfp106 protein demonstrated that Zfp106 bound directly to the rGGGGCC repeats and that this binding was specific since it was efficiently competed by unlabeled self oligonucleotide but not a 30× molar excess of the control oligonucleotide (Figure 1b). Importantly, Zfp106 binding to r(GGGGCC)4 was not competed by 30× molar excess of a mutated RNA probe of equal length, nor was it competed by 30× molar excess of rCUG repeats comprising a MBNL1 binding site (Figure 1—figure supplement 1a). Likewise, MBNL1, an unrelated RNA-binding protein involved in myotonic dystrophy (Miller et al., 2000), bound efficiently and specifically to rCUG repeats under conditions in which Zfp106 showed no binding to the same rCUG sequence (Figure 1—figure supplement 1b) and, as previously described (Reddy et al., 2013), was not able to bind GGGGCC repeats (Figure 1—figure supplement 1a). Together, these data demonstrate that Zfp106 binds efficiently and specifically to GGGGCC RNA repeats.
Figure 1.
Zfp106 is an rGGGGCC binding protein.
(a) Western blot analysis of Zfp106 eluted from a biotinylated-RNA pulldown of Neuro-2a nuclear proteins. Endogenous Zfp106 was specifically pulled down by (GGGGCC)8 biotinylated RNA and not by the unrelated (AAAACC)8 biotinylated RNA oligonucleotide. (b) RNA EMSA performed with purified Zfp106 protein demonstrates that Zfp106 directly binds (GGGGCC)4 RNA in vitro. 30× molar excess of unlabeled self competitor, but not 30× r(AAAACC)4, competes with Zfp106 binding to r(GGGGCC)4, establishing specificity of the interaction. (c) Immunofluorescence with an anti-Zfp106 antibody detects Zfp106 expression in the nucleolus (arrowheads) and in other discrete nuclear puncta (arrows) in cultured Neuro-2a cells. The three images are the same section showing the red channel in (c), the blue channel in (c′), and both channels in (c′′). Scale bar, 20 μm. (d, d′) Immunohistochemical detection of human ZNF106 shows strong nucleolar expression in human motor neurons in the anterior horn of spinal cord. The two images are from different post-mortem individuals. Arrowheads mark nucleolar ZNF106 expression; arrows mark other nuclear and perinucleolar foci of ZNF106 expression. Scale bar, 25 µm.
DOI:
http://dx.doi.org/10.7554/eLife.19032.003
(a) RNA EMSA performed with purified Zfp106 protein demonstrates that Zfp106 binds specifically to r(GGGGCC)4in vitro since binding is efficiently competed by 30× molar excess of unlabeled self competitor but not 30× molar excess of r(AAAACC)4, r(CUG)8 or a mutated r(GGGGCC)4 sequence [mut, r(GAGGCCGGGACCGAGACCGAGGCC)]. Purified MBNL1 protein was used as a negative control for r(GGGGCC)4 binding. MBNL1 does not bind to r(GGGGCC)4 under the same conditions in which Zfp106 shows efficient binding. (b) RNA EMSA using purified Zfp106 protein demonstrates that Zfp106 does not bind r(CUG)8 repeats under conditions in which the RNA binding protein MBNL1 efficiently binds r(CUG)8. MBNL1 binding to r(CUG)8 is specific since binding is competed by 30× molar excess of self competitor but not 30× molar excess of r(GGGGCC)4.
DOI:
http://dx.doi.org/10.7554/eLife.19032.004
Figure 1—figure supplement 1.
Zfp106 binds specifically to rGGGGCC repeats.
(a) RNA EMSA performed with purified Zfp106 protein demonstrates that Zfp106 binds specifically to r(GGGGCC)4in vitro since binding is efficiently competed by 30× molar excess of unlabeled self competitor but not 30× molar excess of r(AAAACC)4, r(CUG)8 or a mutated r(GGGGCC)4 sequence [mut, r(GAGGCCGGGACCGAGACCGAGGCC)]. Purified MBNL1 protein was used as a negative control for r(GGGGCC)4 binding. MBNL1 does not bind to r(GGGGCC)4 under the same conditions in which Zfp106 shows efficient binding. (b) RNA EMSA using purified Zfp106 protein demonstrates that Zfp106 does not bind r(CUG)8 repeats under conditions in which the RNA binding protein MBNL1 efficiently binds r(CUG)8. MBNL1 binding to r(CUG)8 is specific since binding is competed by 30× molar excess of self competitor but not 30× molar excess of r(GGGGCC)4.
DOI:
http://dx.doi.org/10.7554/eLife.19032.004
Zfp106 is an rGGGGCC binding protein.
(a) Western blot analysis of Zfp106 eluted from a biotinylated-RNA pulldown of Neuro-2a nuclear proteins. Endogenous Zfp106 was specifically pulled down by (GGGGCC)8 biotinylated RNA and not by the unrelated (AAAACC)8 biotinylated RNA oligonucleotide. (b) RNA EMSA performed with purified Zfp106 protein demonstrates that Zfp106 directly binds (GGGGCC)4 RNA in vitro. 30× molar excess of unlabeled self competitor, but not 30× r(AAAACC)4, competes with Zfp106 binding to r(GGGGCC)4, establishing specificity of the interaction. (c) Immunofluorescence with an anti-Zfp106 antibody detects Zfp106 expression in the nucleolus (arrowheads) and in other discrete nuclear puncta (arrows) in cultured Neuro-2a cells. The three images are the same section showing the red channel in (c), the blue channel in (c′), and both channels in (c′′). Scale bar, 20 μm. (d, d′) Immunohistochemical detection of humanZNF106 shows strong nucleolar expression in human motor neurons in the anterior horn of spinal cord. The two images are from different post-mortem individuals. Arrowheads mark nucleolar ZNF106 expression; arrows mark other nuclear and perinucleolar foci of ZNF106 expression. Scale bar, 25 µm.DOI:
http://dx.doi.org/10.7554/eLife.19032.003
Zfp106 binds specifically to rGGGGCC repeats.
(a) RNA EMSA performed with purified Zfp106 protein demonstrates that Zfp106 binds specifically to r(GGGGCC)4in vitro since binding is efficiently competed by 30× molar excess of unlabeled self competitor but not 30× molar excess of r(AAAACC)4, r(CUG)8 or a mutated r(GGGGCC)4 sequence [mut, r(GAGGCCGGGACCGAGACCGAGGCC)]. Purified MBNL1 protein was used as a negative control for r(GGGGCC)4 binding. MBNL1 does not bind to r(GGGGCC)4 under the same conditions in which Zfp106 shows efficient binding. (b) RNA EMSA using purified Zfp106 protein demonstrates that Zfp106 does not bind r(CUG)8 repeats under conditions in which the RNA binding protein MBNL1 efficiently binds r(CUG)8. MBNL1 binding to r(CUG)8 is specific since binding is competed by 30× molar excess of self competitor but not 30× molar excess of r(GGGGCC)4.DOI:
http://dx.doi.org/10.7554/eLife.19032.004Patients with C9orf72ALS show evidence of post-mortem nucleolar stress (Haeusler et al., 2014). Interestingly, in cultured Neuro-2a neuronal cells, Zfp106 was primarily present in the nucleolus and in other discrete nuclear puncta (Figure 1c). Likewise, in lower motor neurons from post-mortem human spinal cord samples, ZNF106 was primarily observed in the nucleolus (Figure 1d,d′) and also showed occasional localization in other puncta in the nucleus outside of the nucleolus (Figure 1d′). The localization of Zfp106 to the nucleolus is in accordance with previous studies showing that Zfp106 is predominantly located in the nucleolus of C2C12 myoblast cells (Grasberger and Bell, 2005), and taken together, the results presented in Figure 1 support a possible role for Zfp106 in the biology of C9orf72neurodegeneration.As noted above, previous studies have demonstrated a requirement for Zfp106 in neuromuscular function in mice. Abnormal skeletal morphology in Zfp106homozygous mice was briefly reported as part of a large-scale phenotypic screen of genetically modified mice by the Sanger Mouse Genetics Project (van der Weyden et al., 2011). More recently, more extensive phenotypic studies demonstrated progressive neuromuscular disease in the absence of Zfp106 gene function (Anderson et al., 2016; Joyce et al., 2016). These studies, combined with the interaction of Zfp106 with the C9orf72hexanucleotide repeat sequence, prompted us to examine Zfp106 knockout mice in additional detail and to determine whether the observed defects were autonomous to motor neurons. Therefore, we obtained the previously described Zfp106mice from the KOMP knockout consortium (van der Weyden et al., 2011) and generated the presumptive null allele (Zfp106; also referred to herein as Zfp106-null or Zfp106) using a universal germline deleter transgenicmouse line (Ehlers et al., 2014).Consistent with published studies, we found that loss of Zfp106 function caused a progressive neuromuscular phenotype. Zfp106-null mice were born at normal Mendelian frequency and were indistinguishable from control mice until approximately 4 weeks of age, when 100% of knockout mice began to exhibit evidence of a wasting disease and loss of muscle strength (Figure 2—figure supplement 1; Video 1). Transverse sections of the quadriceps from 4-week-old Zfp106-null mice showed increased variation in fiber size and evidence of grouped atrophy with very few centrally located nuclei (Figure 2a,b), consistent with neurogenic rather than myopathic disease (Baloh et al., 2007). By three months of age, near end stage disease, Zfp106-null mice displayed extensive muscular atrophy and severe degeneration of muscle fibers (Figure 2c,d). The number of choline acetyltransferase (ChAT)-positive motor neurons was also profoundly and significantly reduced in Zfp106 knockout spinal cords compared to littermate control mice (Figure 2e–i), providing further evidence that loss of Zfp106 in mice causes a neurodegenerative phenotype. Independently, we confirmed the knockout phenotype observed with the KOMP allele (van der Weyden et al., 2011) using CRISPR-mediated gene disruption by non-homologous end joining (NHEJ) and creation of a frameshift mutation leading to a premature stop codon. The CRISPR-generated mutation resulted in an essentially identical wasting and histological phenotype (data not shown).
Figure 2—figure supplement 1.
Zfp106 knockout mice exhibit progressive and severe weight and grip strength loss over time.
(a) Dorsal view of skinned wild type and Zfp106 knockout mice at 12-weeks of age. Zfp106 knockout mice show severe muscle wasting and kyphosis compared to wild type mice. (b) Female mice were weighed at the indicated ages, n = 5 for each group. Body weight of Zfp106 knockout mice was significantly reduced at 2 months of age compared to control and further reduced at 3 months of age. (c) Zfp106-null mice exhibit profound loss of grip strength; grip score: 1, 1–10 s; 2, 11–25 s; 3, 26–60 s; 4, 61–90 s; 5, > 90 s. n = 5 age-matched female mice for each group tested at the indicated ages. Graphical data are presented as the mean ± SD. Data were analyzed by one-way ANOVA and Bonferroni's Multiple Comparison Test. ns, not significant; ***p<0.001, ****p<0.0001.
DOI:
http://dx.doi.org/10.7554/eLife.19032.006
Video 1.
Zfp106-null mice exhibit a severe progressive neurodegenerative phenotype.
The video shows a Zfp106 knockout mouse and a littermate control at 10 weeks of age. The Zfp106 knockout displays abnormal gait due to hind limb paralysis, severe kyphosis, wasting, and persistent hind limb clasping at tail suspension. The wild type mouse displays normal gait and normal extension of the hind limbs away from the abdomen during the tail suspension test.
DOI:
http://dx.doi.org/10.7554/eLife.19032.010
Figure 2.
Zfp106 loss-of-function causes a severe neuromuscular phenotype in mice.
(a–h) Evidence of profound neuromuscular pathology in Zfp106-null mice. H&E stained sections of quadriceps muscles (a–d) from 4-week old and 12-week old wild type (a, c) and Zfp106 knockout (b, d) mice are shown. Note the presence of grouped small angular fibers in knockout mice (dashed circle), already clearly evident by 4-weeks of age (b, arrowheads) compared to the rounder, more evenly-shaped fibers in controls (a). By 12-weeks (end stage disease), Zfp106 knockout mice have profound pathology and the presence of atrophic and degenerated muscle fibers with numerous inclusions (d, asterisks). Scale bar, 100 μm. ChAT immunohistochemical staining (e–h) of lumbar spinal cord sections from 8-week old wild type (e, g) and Zfp106 knockout (f, h) mice show a drastic reduction in the number of ChAT+ motor neurons. Arrowheads mark ChAT-expressing motor neurons in the ventral horn. Scale bar, 200 μm in all panels. (i) Quantification of ChAT-positive neurons in the lumbar spinal cord of wild type and Zfp106 knockout mice at 8 weeks of age shows a ~ 47% loss of motor neurons in Zfp106 knockout mice. n = 5 mice for each genotype. Data are expressed as percent of control ± SD and were analyzed by t-test. ***p<0.001. (j) Schematic of the HB9-3×FLAG-2×STREP-Zfp106-IRES-gfp (HB9-Zfp106) transgene. (k, l, m) Transgenic expression of Zfp106 in motor neurons suppresses the wasting phenotype (k), the reduction in grip strength (l) and the loss of lumbar spinal cord motor neurons (m) in Zfp106 knockout mice. Wasting data are expressed as the mean weight ± SEM. Grip strength data are expressed as the mean grip score ± SD; grip score: 1, 1–10 s; 2, 11–25 s; 3, 26–60 s; 4, 61–90 s; 5, > 90 s. ChAT-positive neuron counts are expressed as percent of control ± SD. n = 5 female mice at 8 weeks of age for each genotype. Data were analyzed by one-way ANOVA and Bonferroni's Multiple Comparison Test. *p<0.05; ***p<0.001, ****p<0.0001.
DOI:
http://dx.doi.org/10.7554/eLife.19032.005
(a) Dorsal view of skinned wild type and Zfp106 knockout mice at 12-weeks of age. Zfp106 knockout mice show severe muscle wasting and kyphosis compared to wild type mice. (b) Female mice were weighed at the indicated ages, n = 5 for each group. Body weight of Zfp106 knockout mice was significantly reduced at 2 months of age compared to control and further reduced at 3 months of age. (c) Zfp106-null mice exhibit profound loss of grip strength; grip score: 1, 1–10 s; 2, 11–25 s; 3, 26–60 s; 4, 61–90 s; 5, > 90 s. n = 5 age-matched female mice for each group tested at the indicated ages. Graphical data are presented as the mean ± SD. Data were analyzed by one-way ANOVA and Bonferroni's Multiple Comparison Test. ns, not significant; ***p<0.001, ****p<0.0001.
DOI:
http://dx.doi.org/10.7554/eLife.19032.006
Expression of Zfp106 as detected by β-galactosidase activity in quadriceps (a) and spinal cord (b) of 8-week-old Zfp106laczflox/+ mice. β-galactosidase is expressed from a lacZ knock-in at the Zfp106 locus. A section of the quadriceps muscle from an 8-week old Zfp106laczflox/+ mouse stained with X-gal is shown in (a). Arrowheads show β-galactosidase-expressing muscle fibers, weakly detectable by X-gal staining; scale bar, 100 μm. A section through the ventral horn of the spinal cord (lumbar region) of a Zfp106laczflox/+ mouse is shown in (b). The same section is shown in all three panels in (b); the green channel shows expression of the neuronal marker NeuN; the red channel shows expression of β-galactosidase expressed from the Zfp106 locus. Arrows denote co-expression of β-galactosidase and NeuN in large motor neurons in the ventral horn of the spinal cord; scale bar, 50 μm.
DOI:
http://dx.doi.org/10.7554/eLife.19032.007
(a) Evaluation of Zfp106 expression by RT-qPCR in lumbar spinal cord of wild type, KOMP Zfp106 knockout and CRISPR Zfp106 knockout mice. Expression of Zfp106 mRNA is drastically and significantly reduced in lumbar spinal cord of both KOMP and CRISPR knockout mice. (b) Schematic of the transgenic construct used for generation of the motor neuron specific Zfp106 mice. The HB9 promoter drives expression of a 3xFLAG-2xSTREP N-terminally tagged Zfp106 and IRES-EGFP. (c) Evaluation of transgene expression by RT-qPCR in lumbar spinal cord at P10. Expression of Zfp106 mRNA ranged from ~1.5 to 2 fold of wild type expression in two independent transgenic mouse lines, as assessed by qPCR with primers amplifying both endogenous and transgenic Zfp106. Data in a, c were analyzed by one-way ANOVA and Bonferroni's Multiple Comparison Test. *p<0.05; ***p<0.001.
DOI:
http://dx.doi.org/10.7554/eLife.19032.008
Representative images of transverse sections of lumbar spinal cord from wild type (a), motor neuron-specific Zfp106 transgenic (b), Zfp106 knockout (c), and Zfp106 knockout/motor neuron-specific Zfp106 transgenic mice (d), stained by anti-ChAT antibody. Arrowheads mark ChAT+ motor neurons. Scale bar, 200 µm.
DOI:
http://dx.doi.org/10.7554/eLife.19032.009
Zfp106 loss-of-function causes a severe neuromuscular phenotype in mice.
(a–h) Evidence of profound neuromuscular pathology in Zfp106-null mice. H&E stained sections of quadriceps muscles (a–d) from 4-week old and 12-week old wild type (a, c) and Zfp106 knockout (b, d) mice are shown. Note the presence of grouped small angular fibers in knockout mice (dashed circle), already clearly evident by 4-weeks of age (b, arrowheads) compared to the rounder, more evenly-shaped fibers in controls (a). By 12-weeks (end stage disease), Zfp106 knockout mice have profound pathology and the presence of atrophic and degenerated muscle fibers with numerous inclusions (d, asterisks). Scale bar, 100 μm. ChAT immunohistochemical staining (e–h) of lumbar spinal cord sections from 8-week old wild type (e, g) and Zfp106 knockout (f, h) mice show a drastic reduction in the number of ChAT+ motor neurons. Arrowheads mark ChAT-expressing motor neurons in the ventral horn. Scale bar, 200 μm in all panels. (i) Quantification of ChAT-positive neurons in the lumbar spinal cord of wild type and Zfp106 knockout mice at 8 weeks of age shows a ~ 47% loss of motor neurons in Zfp106 knockout mice. n = 5 mice for each genotype. Data are expressed as percent of control ± SD and were analyzed by t-test. ***p<0.001. (j) Schematic of the HB9-3×FLAG-2×STREP-Zfp106-IRES-gfp (HB9-Zfp106) transgene. (k, l, m) Transgenic expression of Zfp106 in motor neurons suppresses the wasting phenotype (k), the reduction in grip strength (l) and the loss of lumbar spinal cord motor neurons (m) in Zfp106 knockout mice. Wasting data are expressed as the mean weight ± SEM. Grip strength data are expressed as the mean grip score ± SD; grip score: 1, 1–10 s; 2, 11–25 s; 3, 26–60 s; 4, 61–90 s; 5, > 90 s. ChAT-positive neuron counts are expressed as percent of control ± SD. n = 5 female mice at 8 weeks of age for each genotype. Data were analyzed by one-way ANOVA and Bonferroni's Multiple Comparison Test. *p<0.05; ***p<0.001, ****p<0.0001.DOI:
http://dx.doi.org/10.7554/eLife.19032.005
Zfp106 knockout mice exhibit progressive and severe weight and grip strength loss over time.
(a) Dorsal view of skinned wild type and Zfp106 knockout mice at 12-weeks of age. Zfp106 knockout mice show severe muscle wasting and kyphosis compared to wild type mice. (b) Female mice were weighed at the indicated ages, n = 5 for each group. Body weight of Zfp106 knockout mice was significantly reduced at 2 months of age compared to control and further reduced at 3 months of age. (c) Zfp106-null mice exhibit profound loss of grip strength; grip score: 1, 1–10 s; 2, 11–25 s; 3, 26–60 s; 4, 61–90 s; 5, > 90 s. n = 5 age-matched female mice for each group tested at the indicated ages. Graphical data are presented as the mean ± SD. Data were analyzed by one-way ANOVA and Bonferroni's Multiple Comparison Test. ns, not significant; ***p<0.001, ****p<0.0001.DOI:
http://dx.doi.org/10.7554/eLife.19032.006
Zfp106 is expressed in skeletal muscle and motor neurons.
Expression of Zfp106 as detected by β-galactosidase activity in quadriceps (a) and spinal cord (b) of 8-week-old Zfp106laczflox/+ mice. β-galactosidase is expressed from a lacZ knock-in at the Zfp106 locus. A section of the quadriceps muscle from an 8-week old Zfp106laczflox/+ mouse stained with X-gal is shown in (a). Arrowheads show β-galactosidase-expressing muscle fibers, weakly detectable by X-gal staining; scale bar, 100 μm. A section through the ventral horn of the spinal cord (lumbar region) of a Zfp106laczflox/+ mouse is shown in (b). The same section is shown in all three panels in (b); the green channel shows expression of the neuronal marker NeuN; the red channel shows expression of β-galactosidase expressed from the Zfp106 locus. Arrows denote co-expression of β-galactosidase and NeuN in large motor neurons in the ventral horn of the spinal cord; scale bar, 50 μm.DOI:
http://dx.doi.org/10.7554/eLife.19032.007
Expression of Zfp106 in wild type, knockout and HB9-Zfp106 transgenic mice.
(a) Evaluation of Zfp106 expression by RT-qPCR in lumbar spinal cord of wild type, KOMP Zfp106 knockout and CRISPRZfp106 knockout mice. Expression of Zfp106 mRNA is drastically and significantly reduced in lumbar spinal cord of both KOMP and CRISPR knockout mice. (b) Schematic of the transgenic construct used for generation of the motor neuron specific Zfp106mice. The HB9 promoter drives expression of a 3xFLAG-2xSTREP N-terminally tagged Zfp106 and IRES-EGFP. (c) Evaluation of transgene expression by RT-qPCR in lumbar spinal cord at P10. Expression of Zfp106 mRNA ranged from ~1.5 to 2 fold of wild type expression in two independent transgenicmouse lines, as assessed by qPCR with primers amplifying both endogenous and transgenicZfp106. Data in a, c were analyzed by one-way ANOVA and Bonferroni's Multiple Comparison Test. *p<0.05; ***p<0.001.DOI:
http://dx.doi.org/10.7554/eLife.19032.008
Rescue of ChAT+ motor neuron loss by restoration of Zfp106 to motor neurons in Zfp106 knockout mice.
Representative images of transverse sections of lumbar spinal cord from wild type (a), motor neuron-specific Zfp106transgenic (b), Zfp106 knockout (c), and Zfp106 knockout/motor neuron-specific Zfp106transgenic mice (d), stained by anti-ChAT antibody. Arrowheads mark ChAT+ motor neurons. Scale bar, 200 µm.DOI:
http://dx.doi.org/10.7554/eLife.19032.009
Zfp106-null mice exhibit a severe progressive neurodegenerative phenotype.
The video shows a Zfp106 knockout mouse and a littermate control at 10 weeks of age. The Zfp106 knockout displays abnormal gait due to hind limb paralysis, severe kyphosis, wasting, and persistent hind limb clasping at tail suspension. The wild type mouse displays normal gait and normal extension of the hind limbs away from the abdomen during the tail suspension test.DOI:
http://dx.doi.org/10.7554/eLife.19032.010To gain insight into the cell autonomous requirements for Zfp106, we used the KOMP lacZ knock-in allele (van der Weyden et al., 2011) to examine Zfp106 expression using β-galactosidase activity as a sensitive method for detecting expression. This approach showed Zfp106 expression in both skeletal muscle and motor neurons (Figure 2—figure supplement 2a,b). Given the multiple lines of evidence for a role of Zfp106 in neurodegeneration, and the evident denervation observed in the knockout mice, we hypothesized that the primary requirement for Zfp106 was likely to be in motor neurons. We confirmed a highly significant and dramatic reduction in Zfp106 expression in spinal cord (Figure 2—figure supplement 3a). The ~80% reduction in Zfp106 expression is consistent with previous studies (Anderson et al., 2016; Joyce et al., 2016). Therefore, we used a transgenic approach in mice to restore Zfp106 expression only in motor neurons under the control of the Mnx1 promoter (herein called HB9, HB9-Zfp106) on a Zfp106 germline knockout background (Figure 2j; and Figure 2—figure supplement 3b,c). Importantly, restoration of Zfp106 specifically in motor neurons significantly suppressed the Zfp106 knockout wasting and muscle grip phenotypes and resulted in restoration of the number of ChAT-expressing motor neurons (Figure 2j–m; Figure 2—figure supplement 4), indicating a cell autonomous requirement for Zfp106 in motor neurons.
Figure 2—figure supplement 2.
Zfp106 is expressed in skeletal muscle and motor neurons.
Expression of Zfp106 as detected by β-galactosidase activity in quadriceps (a) and spinal cord (b) of 8-week-old Zfp106laczflox/+ mice. β-galactosidase is expressed from a lacZ knock-in at the Zfp106 locus. A section of the quadriceps muscle from an 8-week old Zfp106laczflox/+ mouse stained with X-gal is shown in (a). Arrowheads show β-galactosidase-expressing muscle fibers, weakly detectable by X-gal staining; scale bar, 100 μm. A section through the ventral horn of the spinal cord (lumbar region) of a Zfp106laczflox/+ mouse is shown in (b). The same section is shown in all three panels in (b); the green channel shows expression of the neuronal marker NeuN; the red channel shows expression of β-galactosidase expressed from the Zfp106 locus. Arrows denote co-expression of β-galactosidase and NeuN in large motor neurons in the ventral horn of the spinal cord; scale bar, 50 μm.
DOI:
http://dx.doi.org/10.7554/eLife.19032.007
Figure 2—figure supplement 3.
Expression of Zfp106 in wild type, knockout and HB9-Zfp106 transgenic mice.
(a) Evaluation of Zfp106 expression by RT-qPCR in lumbar spinal cord of wild type, KOMP Zfp106 knockout and CRISPR Zfp106 knockout mice. Expression of Zfp106 mRNA is drastically and significantly reduced in lumbar spinal cord of both KOMP and CRISPR knockout mice. (b) Schematic of the transgenic construct used for generation of the motor neuron specific Zfp106 mice. The HB9 promoter drives expression of a 3xFLAG-2xSTREP N-terminally tagged Zfp106 and IRES-EGFP. (c) Evaluation of transgene expression by RT-qPCR in lumbar spinal cord at P10. Expression of Zfp106 mRNA ranged from ~1.5 to 2 fold of wild type expression in two independent transgenic mouse lines, as assessed by qPCR with primers amplifying both endogenous and transgenic Zfp106. Data in a, c were analyzed by one-way ANOVA and Bonferroni's Multiple Comparison Test. *p<0.05; ***p<0.001.
DOI:
http://dx.doi.org/10.7554/eLife.19032.008
Figure 2—figure supplement 4.
Rescue of ChAT+ motor neuron loss by restoration of Zfp106 to motor neurons in Zfp106 knockout mice.
Representative images of transverse sections of lumbar spinal cord from wild type (a), motor neuron-specific Zfp106 transgenic (b), Zfp106 knockout (c), and Zfp106 knockout/motor neuron-specific Zfp106 transgenic mice (d), stained by anti-ChAT antibody. Arrowheads mark ChAT+ motor neurons. Scale bar, 200 µm.
DOI:
http://dx.doi.org/10.7554/eLife.19032.009
To gain additional insights into the molecular function of Zfp106, we used mass spectrometry to identify all proteins co-immunoprecipitated by Zfp106 from 293T cells (Figure 3). Several controls were included in the mass spectrometry experiments, including the DNA-binding factors Etv2 and MEF2C and the RNA-binding proteins Vif and Tat. The interactomes for each of the controls were compared to the Zfp106 interactome using the previously described MiST algorithm, which determines specific interactions based on enrichment, reproducibility, and specificity compared to interaction with the negative controls (Jager et al., 2012). These experiments identified thirty-nine proteins that specifically interacted with Zfp106 (Figure 3a; Supplementary file 1). Gene ontology (GO) and protein complex analyses revealed a significant enrichment in interactors with roles in RNA processing, metabolism, and splicing (Figure 3a,b; Supplementary file 2), suggesting that Zfp106 may also play roles in these processes.
Figure 3.
Zfp106 interacts with a network of other ALS-associated RNA-binding proteins.
(a) Network representation of the Zfp106 interactome generated by Cytoscape. Zfp106 (yellow node) interacts with 39 proteins with top 5% MiST score (blue nodes). Curated protein-protein interactions from the CORUM database are indicated as nodes connected by green lines. (b) Gene Ontology (GO) Biological Process analysis of the Zfp106 interactome ranked by p value. The number of interacting proteins (top 5% by MiST score) in each category is indicated inside each bar. (c) Selected ALS-associated proteins within the top 5% MiST-scoring hits from the Zfp106 interactome are listed with putative functions associated with the pathobiology of ALS indicated.
DOI:
http://dx.doi.org/10.7554/eLife.19032.011
Endogenous TDP43 and Nup107 coimmunoprecipitated with Zfp106 in Neuro-2a cells. Cells were transfected with 3×FLAG-2×STREP-Zfp106 or 3×FLAG-2×STREP parental vector and lysates were subjected to immunoprecipitation with anti-FLAG beads, followed by anti-FLAG (top), anti-Nup107 (middle), and anti-TDP43 (bottom) western blotting. Nup107 and TDP43 were coimmunoprecipitated by anti-FLAG IP only in lysates from cells expressing FLAG-Zfp106. The immunoglobulin heavy chain (IgG HC) of the anti-FLAG antibody is indicated. Molecular weight markers in kD are indicated on the left.
DOI:
http://dx.doi.org/10.7554/eLife.19032.012
Zfp106 interacts with a network of other ALS-associated RNA-binding proteins.
(a) Network representation of the Zfp106 interactome generated by Cytoscape. Zfp106 (yellow node) interacts with 39 proteins with top 5% MiST score (blue nodes). Curated protein-protein interactions from the CORUM database are indicated as nodes connected by green lines. (b) Gene Ontology (GO) Biological Process analysis of the Zfp106 interactome ranked by p value. The number of interacting proteins (top 5% by MiST score) in each category is indicated inside each bar. (c) Selected ALS-associated proteins within the top 5% MiST-scoring hits from the Zfp106 interactome are listed with putative functions associated with the pathobiology of ALS indicated.DOI:
http://dx.doi.org/10.7554/eLife.19032.011
Zfp106 interacts with TDP43 and Nup107 in Neuro-2a cells.
Endogenous TDP43 and Nup107 coimmunoprecipitated with Zfp106 in Neuro-2a cells. Cells were transfected with 3×FLAG-2×STREP-Zfp106 or 3×FLAG-2×STREP parental vector and lysates were subjected to immunoprecipitation with anti-FLAG beads, followed by anti-FLAG (top), anti-Nup107 (middle), and anti-TDP43 (bottom) western blotting. Nup107 and TDP43 were coimmunoprecipitated by anti-FLAG IP only in lysates from cells expressing FLAG-Zfp106. The immunoglobulin heavy chain (IgG HC) of the anti-FLAG antibody is indicated. Molecular weight markers in kD are indicated on the left.DOI:
http://dx.doi.org/10.7554/eLife.19032.012There is growing and compelling genetic and pathological evidence that dysregulated RNA processing and metabolism contribute to the development of ALS and C9orf72ALS in particular (Ling et al., 2013; Prudencio et al., 2015). Interestingly, several of the Zfp106-interacting proteins identified in our affinity purification-mass spectrometry experiment are proteins directly associated with ALS and/or C9orf72ALS, including splicing factors TDP-43 and FUS, the nucleolar protein Nucleolin, and the nuclear pore component Nup107 (Freibaum et al., 2015; Haeusler et al., 2014; Lagier-Tourenne et al., 2010; Ling et al., 2013); Figure 3c; Supplementary file 1). We further examined the interaction of Zfp106 with TDP-43 and Nup107, as examples of interacting proteins, by anti-Flag-Zfp106 immunoprecipitation followed by western blot for TDP43 and Nup107 in Neuro-2a cells (Figure 3—figure supplement 1). These experiments confirmed and validated the interaction with these other ALS-associated proteins and support the notion that Zfp106 is part of an RNA metabolic pathway (or pathways) that when dysregulated leads to neurodegeneration.
Figure 3—figure supplement 1.
Zfp106 interacts with TDP43 and Nup107 in Neuro-2a cells.
Endogenous TDP43 and Nup107 coimmunoprecipitated with Zfp106 in Neuro-2a cells. Cells were transfected with 3×FLAG-2×STREP-Zfp106 or 3×FLAG-2×STREP parental vector and lysates were subjected to immunoprecipitation with anti-FLAG beads, followed by anti-FLAG (top), anti-Nup107 (middle), and anti-TDP43 (bottom) western blotting. Nup107 and TDP43 were coimmunoprecipitated by anti-FLAG IP only in lysates from cells expressing FLAG-Zfp106. The immunoglobulin heavy chain (IgG HC) of the anti-FLAG antibody is indicated. Molecular weight markers in kD are indicated on the left.
DOI:
http://dx.doi.org/10.7554/eLife.19032.012
Prior studies have used Drosophila as an in vivo gain-of-function model of C9orf72neurodegeneration (Freibaum et al., 2015; Tran et al., 2015; Xu et al., 2013; Zhang et al., 2015). Here, we used the GAL4-UAS system to coexpress mouseZfp106 and GGGGCC repeats in the fly in a gain-of-function approach to determine if the interaction between Zfp106 and GGGGCC repeats had a functional consequence in this model (Figure 4; Figure 4—figure supplement 1a). Expression of 30 tandem copies of the GGGGCC hexanucleotide in the 5′-untranslated region of a UAS-dependent gfp transcript (30R-GFP) in glutamatergic neurons using OK371-GAL4 (Mahr and Aberle, 2006) caused ~50% lethality due to an apparent failure of flies to eclose from the pupal case (Figure 4a). Furthermore, 28 day-old OK371; 30R-GFP-expressing flies that did manage to successfully eclose exhibited profound defects in locomotor activity compared to control flies (Figure 4b). No overt eclosion or locomotor phenotype was observed in flies expressing GFP only, 3R-GFP, or Zfp106 alone in glutamatergic neurons (Figure 4a,b). Previous studies have also shown that expression of 30R-GFP causes a reduction in the number of active zones in Drosophila larval neuromuscular junctions (Zhang et al., 2015). Consistent with those studies, we found that expression of 30R-GFP reduced active zones as measured by anti-Bruchpilot (Brp) immunofluorescence and quantification (Figure 4c–f). Remarkably, co-expression of Zfp106 with 30R-GFP restored Brp expression at larval active zones (Figure 4c–f) and completely suppressed the ~50% lethality caused by expression of 30R-GFP (Figure 4a). Moreover, co-expression of Zfp106 partially suppressed the adult locomotor defect caused by expression of 30R-GFP (Figure 4b). Importantly, co-expression of Zfp106 did not result in a reduction in the expression of 30R-GFP mRNA Figure 4—figure supplement 1b), indicating that the suppression of the neurotoxic phenotype in Drosophila was not due to dilution of GAL4 protein. Taken together, these data show that Zfp106 is a potent suppressor of neurodegeneration in a C9orf72ALS model, and the results from this gain-of-function model support the idea that Zfp106 functionally interacts with C9orf72GGGGCC RNA repeats.
Figure 4.
Zfp106 suppresses GGGGCC-mediated neurotoxicity in Drosophila.
(a) Schematics and Punnett squares from crosses of UAS-Zfp106; UAS-30R-GFP (left) and UAS-Zfp106; UAS-3R-GFP (right) transgenic flies to OK371-GAL4 flies. The Punnett squares show the number of flies that eclosed from the indicated crosses and show that expression of 30R-GFP resulted in failure of ~50% of flies to eclose (25 actual versus 54.5 predicted); this defect was completely suppressed by co-expression of Zfp106. The Chi-square test (χ2) was used to determine the significance of the differences between the observed and expected frequencies of the expected genotypes. (b) Locomotor activity of 28-day post-eclosion flies of the indicated genotypes assessed by rapid iterative negative geotaxis (RING) assay. Data are presented as the mean height climbed ± SEM. A two-way ANOVA analysis of the locomotor data revealed a significant effect of repeat expression (p<0.0001) and Zfp106 expression (p<0.01) on locomotor activity, with a significant interaction between the two factors (p<0.01); i.e. Zfp106 coexpression significantly suppresses neurotoxicity induced by expression of 30R (p<0.01) by Bonferroni's posthoc Multiple Comparison Test. n = 25 male flies for each genotype; ****p<0.0001, **p<0.01. (c, d, e) Representative NMJs of muscle 6/7 in abdominal segment A3 of third instar larvae of the indicated genotypes co-stained with anti-HRP (neuronal marker, red channel) and anti-Bruchpilot (Brp) (active zone marker, green channel). Staining of the active zone component Brp shows that expression of 30R causes a reduction in Brp-positive active zones [arrowheads in (d) compared to control in c]. Coexpression of Zfp106 suppressed the reduction in Brp-positive active zones caused by 30R [arrowheads in e compared to d]. (f) Quantification of active zones as total voxel occupancy by Brp signal at each terminal shows that Zfp106 significantly suppresses the reduction in active zone caused by expression of 30R. Data were analyzed by one-way ANOVA and Bonferroni's Multiple Comparison Test. ***p<0.001, ****p<0.0001.
DOI:
http://dx.doi.org/10.7554/eLife.19032.013
(a) Anti-FLAG western blot conducted on lysates from heads dissected from transgenic flies of the indicated genotypes. The band in lane 3 migrating below the 225 kD marker indicates that UAS-3×FLAG-2×STREP-Zfp106 (UAS-Zfp106) transgenic flies express Zfp106 in a GAL4-dependent manner. (b) Evaluation of 30R-gfp expression by RT-qPCR in flies expressing 30R alone or coexpressing 30R and Zfp106. Zfp106 coexpression does not cause alterations in 30R-gfp mRNA levels.
DOI:
http://dx.doi.org/10.7554/eLife.19032.014
Figure 4—figure supplement 1.
GAL4-dependent expression of Zfp106 in Drosophila does not affect 30R-gfp mRNA levels.
(a) Anti-FLAG western blot conducted on lysates from heads dissected from transgenic flies of the indicated genotypes. The band in lane 3 migrating below the 225 kD marker indicates that UAS-3×FLAG-2×STREP-Zfp106 (UAS-Zfp106) transgenic flies express Zfp106 in a GAL4-dependent manner. (b) Evaluation of 30R-gfp expression by RT-qPCR in flies expressing 30R alone or coexpressing 30R and Zfp106. Zfp106 coexpression does not cause alterations in 30R-gfp mRNA levels.
DOI:
http://dx.doi.org/10.7554/eLife.19032.014
Zfp106 suppresses GGGGCC-mediated neurotoxicity in Drosophila.
(a) Schematics and Punnett squares from crosses of UAS-Zfp106; UAS-30R-GFP (left) and UAS-Zfp106; UAS-3R-GFP (right) transgenic flies to OK371-GAL4 flies. The Punnett squares show the number of flies that eclosed from the indicated crosses and show that expression of 30R-GFP resulted in failure of ~50% of flies to eclose (25 actual versus 54.5 predicted); this defect was completely suppressed by co-expression of Zfp106. The Chi-square test (χ2) was used to determine the significance of the differences between the observed and expected frequencies of the expected genotypes. (b) Locomotor activity of 28-day post-eclosion flies of the indicated genotypes assessed by rapid iterative negative geotaxis (RING) assay. Data are presented as the mean height climbed ± SEM. A two-way ANOVA analysis of the locomotor data revealed a significant effect of repeat expression (p<0.0001) and Zfp106 expression (p<0.01) on locomotor activity, with a significant interaction between the two factors (p<0.01); i.e. Zfp106 coexpression significantly suppresses neurotoxicity induced by expression of 30R (p<0.01) by Bonferroni's posthoc Multiple Comparison Test. n = 25 male flies for each genotype; ****p<0.0001, **p<0.01. (c, d, e) Representative NMJs of muscle 6/7 in abdominal segment A3 of third instar larvae of the indicated genotypes co-stained with anti-HRP (neuronal marker, red channel) and anti-Bruchpilot (Brp) (active zone marker, green channel). Staining of the active zone component Brp shows that expression of 30R causes a reduction in Brp-positive active zones [arrowheads in (d) compared to control in c]. Coexpression of Zfp106 suppressed the reduction in Brp-positive active zones caused by 30R [arrowheads in e compared to d]. (f) Quantification of active zones as total voxel occupancy by Brp signal at each terminal shows that Zfp106 significantly suppresses the reduction in active zone caused by expression of 30R. Data were analyzed by one-way ANOVA and Bonferroni's Multiple Comparison Test. ***p<0.001, ****p<0.0001.DOI:
http://dx.doi.org/10.7554/eLife.19032.013
GAL4-dependent expression of Zfp106 in Drosophila does not affect 30R-gfp mRNA levels.
(a) Anti-FLAG western blot conducted on lysates from heads dissected from transgenic flies of the indicated genotypes. The band in lane 3 migrating below the 225 kD marker indicates that UAS-3×FLAG-2×STREP-Zfp106 (UAS-Zfp106) transgenic flies express Zfp106 in a GAL4-dependent manner. (b) Evaluation of 30R-gfp expression by RT-qPCR in flies expressing 30R alone or coexpressing 30R and Zfp106. Zfp106 coexpression does not cause alterations in 30R-gfp mRNA levels.DOI:
http://dx.doi.org/10.7554/eLife.19032.014The ability of Zfp106 to suppress the neurotoxic gain-of-function effect of rGGGGCC repeats has important implications for understanding and possibly ameliorating the pathology of C9orf72ALS. Previous studies have suggested roles for Zfp106 in rDNA transcription and in pre-rRNA processing (Ide and Dejardin, 2015; Tafforeau et al., 2013). Zfp106 was also identified as a polyadenylated mRNA binding protein in an interactome capture study aimed at defining an atlas of mammalian mRNA binding proteins (Castello et al., 2012). Interestingly, our interactome data also suggest possible roles for Zfp106 in multiple steps of RNA metabolism and processing and interaction with key RNA binding proteins involved in various forms of neurodegeneration. Precisely how disrupting these processes leads to neurodegeneration and exactly how this relates to C9orf72ALS/FTD remains to be determined. A simple model is that sequestration of Zfp106 by the expanded repeats disrupts normal Zfp106 function in patients with C9orf72ALS in a sponge-like mechanism (Cooper-Knock et al., 2014; Mizielinska and Isaacs, 2014). Alternatively, one might speculate that Zfp106 plays other functions important in the biology of C9orf72, such as influencing dipeptide repeat protein (DPR) production or affecting nucleolar function or nucleocytoplasmic transport via interactions with Nucleolin or Nup107, which have also been implicated in the pathobiology of C9orf72ALS (Boeynaems et al., 2016; Freibaum et al., 2015; Haeusler et al., 2014; Jovičić et al., 2015; Kwon et al., 2014; Zhang et al., 2015). Future studies will address the molecular targets and mechanisms of action of Zfp106 in order to gain further insights into the pathogenesis of C9orf72ALS and to identify new possible therapeutic targets for neuroprotection.
Materials and methods
Plasmids
A murineZfp106 cDNA corresponding to NCBI accession number XM_006499044.2 and a murineMbnl1 cDNA corresponding to NCBI accession number NM_020007.4 were cloned by PCR from an E13.5 embryonic heart cDNA library; the amplified cDNAs were subcloned into mammalian expression plasmid pcDNA4/TO (Invitrogen, Carlsbad, CA) modified to include N-terminal 3×FLAG-2×STREP tags. The 3×FLAG-2×STREP-Zfp106 cassette was subsequently subcloned into the EcoRI/XhoI sites of pUAST (Brand and Perrimon, 1993; Flybase ID FBmc0000383) for subsequent generation of transgenic flies, and into the AgeI/SpeI sites of HB9-MCS-IRES-EGFP (Addgene plasmid #16283) for generation of motor neuron-specific HB9-Zfp106transgenic mice.
Mice, flies, and cells
The Zfp106Δ allele was generated by CRISPR-mediated genome editing (Wang et al., 2013). 5′-atattgtgccacatcgtgtatgg-3’ and 5′-tttttgagccatacacgatgtgg-3’ sgRNAs, which target exon 1 (ENSMUSE00001311370) of mouseZfp106, were transcribed in vitro using the MEGAshortscript T7 kit (Life Technologies, AM1354) and were purified using the MEGAclear kit (Life Technologies, AM1908). Purified sgRNAs and in vitro-transcribed Cas9 mRNA were co-injected into the cytoplasm of fertilized mouse oocytes using standard transgenic technology as described previously (De Val et al., 2004). Two independent F0 founders were independently outcrossed to wild-type mice, and F1 offspring were used for subsequent Zfp106Δ intercrosses.The mouse strain Zfp106tm1a(KOMP)Wtsi (RRID:IMSR_KOMP:CSD26348-1a-Wtsi) was generated from ES cell clone EPD0033_4_C03, obtained from the NCRR-NIH supported KOMP Repository (www.komp.org) and generated by the CSD consortium for the NIH funded Knockout Mouse Project (KOMP). The targeted allele contains a promoterless LacZ-Neo cassette, which also contains an En2 splicing acceptor (En2 SA) and polyadenylation signal (pA), flanked by FRT sites; the targeted allele also has loxP sites flanking exon 2 (Testa et al., 2004; ENSMUSE00000454975). To generate Zfp106laczΔ/+ mice, male Zfp106mice were crossed to female Mef2c-AHF-Cre mice (Verzi et al., 2005); RRID:MMRRC_030262-UNC). When crossed from the female, Mef2c-AHF-Cre functions as a universal deleter line due to Cre expression in the female germline, resulting in Cre-dependent recombination in all cells in all offspring (Ehlers et al., 2014).TransgenicHB9-3×FLAG-2×STREP-Zfp106-IRES-egfp (HB9-Zfp106) mice expressing Zfp106 in motor neurons under the control of the promoter of the Mnx1 gene (herein called HB9), were generated by standard pronuclear injection of the HB9-3×FLAG-2×STREP-Zfp106-IRES-EGFP plasmid linearized by XhoI digestion. Injected embryos were implanted into pseudo-pregnant females, and F0 founders were screened by PCR. Grip strength was measured by Kondziella inverted screen test (Deacon, 2013; Kondziella, 1964).Genotyping of mutant and transgenic mice was performed by PCR on genomic DNA isolated from tail biopsies using the following primers: Zfp106Δ, 5′-caggaggctgtgctgtgata-3’ and 5′-attctaggactgggaggcaga-3′; Zfp106laczΔ and Zfp106 5′-ccccctgaacctgaaacata-3’ and 5′-gaaagtcccagctgcaagac-3’ for the mutant allele and 5′-tgaatcagctcgtaaacggac-3’ and 5′-atgaccgctcaaatcgatcaa-3’ for the wild type allele; HB9-3×FLAG-2×STREP-Zfp106-IRES-egfp, 5′-aagttcatctgcaccaccg-3’ and 5′-tccttgaagaagatggtgcg-3′.UAS-GFP, UAS-3R-GFP and UAS-30R-GFP transgenicDrosophila melanogaster lines were a generous gift of Peng Jin (Emory University) and have been described previously (Xu et al., 2013). GMR-GAL4 (FBst0008605) and OK371-GAL4 (FBst0026160) lines were obtained from the Bloomington Stock Center. UAS-3×FLAG-2×STREP-Zfp106 (UAS-Zfp106) transgenicD. melanogaster were generated by standard w+ P-element-mediated transgenesis (Brand and Perrimon, 1993) on a w1118 background (BestGene, Inc.). Flies were maintained at 23°C, unless otherwise indicated. For western blot detection of the Zfp106 transgene, flies were shifted to 30°C for 3 days prior to removing heads for protein extraction to induce higher expression of GAL4 from GMR-GAL4.Mouse Neuro-2a (ATCC, CCL-131; RRID:CVCL_0470) and humanHEK293T cells (ATCC, CRL-3216; RRID:CVCL_0063) were obtained directly from ATCC and maintained in Dulbecco’s modified Eagle medium supplemented with 10% fetal bovine serum (FBS, Gibco, Waltham, MA) and penicillin-streptomycin (Gibco). All cell lines were routinely tested for Mycoplasma contamination with the MycoAlert PLUS Mycoplasma Detection Kit (Lonza, Switzerland, LT07-705) and found to be negative.
Biotinylated-RNA pull-down of nuclear proteins
Biotinylated-RNA pull-down of nuclear proteins was performed as previously described with modifications (Marin-Bejar and Huarte, 2015). 100 pmol of ssRNA oligomer [either r(GGGGCC)8 or r(AAAACC)8] biotinylated at the 3’ end (Integrated DNA Technologies, Inc.) were incubated with 50 µl of pre-washed Nucleic Acid Compatible Streptavidin Magnetic Beads (Pierce Magnetic RNA-Protein Pull-Down kit, cat. n. 20164) in RNA capture buffer (20 mM Tris, pH 7.5; 1 M NaCl; 1 mM EDTA) for 30 min on a rotary shaker. The beads were washed twice in 20 mM Tris at 4°C for 5 min each and then incubated with nuclear extract for 4 hr at 4°C. Approximately 1 × 107 Neuro-2a cells were detached from cell culture dishes when they were approximately 80% confluent with 10 mM EDTA in PBS, incubated in Harvest Buffer (10 mM HEPES, pH 7.9; 50 mM NaCl; 0.5 M sucrose; 0.1 mM EDTA; 0.5% NP-40) for 10 min on ice. Nuclei were pelleted by centrifugation at 4500 × g for 10 min at 4°C, washed for 5 min in buffer A (10 mM HEPES, pH 7.9; 10 mM KCl; 0.1 mM EDTA; 0.1 mM EGTA), centrifuged again at 4500 × g for 5 min at 4°C and lysed in IP buffer (50 mM Tris, pH7.4; 150 mM NaCl; 1 mM EDTA) plus 0.5% NP-40. Complete protease inhibitor and PhosSTOP phosphatase inhibitor (Roche) were added to all buffers. After incubation with the nuclear extracts, beads were washed 3× in IP buffer plus 0.05% NP-40, and then 1× in IP buffer without NP-40. Co-precipitated proteins were eluted from bound biotinylated RNAs in 45 µl 50 mM Tris-Cl, pH7.4; 150 mM NaCl; 1 mM EDTA plus 0.05% RapiGest (Waters Corp., Milford, MA). Precipitated proteins were then detected by mass spectrometry or western blot.
RNA EMSA
100 pmol of r(GGGGCC)4 or r(CUG)8 single-stranded RNA (Integrated DNA Technologies, Inc.) were 5′-end labeled with [γ-32P]ATP and T4 Polynucleotide Kinase (New England Biolabs) as previously described (Rio, 2014). Unincorporated radioactivity was removed using Illustra MicroSpin G-25 Columns (GE Healthcare Life Sciences, UK). RNA EMSA was then performed as previously described (Rio, 2014) by incubating the labeled RNA (100,000 cpm) with purified Zfp106 or MBNL1 protein for 30 min at room temperature in 1× binding buffer (40 mM Tris-Cl, pH 8.0; 30 mM KCl; 1 mM MgCl2; 0.01% NP-40; 1 mM DTT; 5% glycerol; 10 µg/ml bovineserum albumin). The RNA-protein mixtures were then electrophoresed in 6% acrylamide-TBE gels. Gels were dried and exposed to X-ray film for analysis. For the competition experiments, the purified proteins were preincubated for 10 min at room temperature with 30-fold molar excess of the following unlabeled single-stranded RNAs: r(GGGGCC)4, r(AAAACC)4, r(CUG)8, or a mutated (mut) GGGGCC repeat sequence, r(GAGGCCGGGACCGAGACCGAGGCC).
Histology, immunohistochemistry, and immunofluorescence
Skeletal muscles were isolated from sex- and age-matched mice, mounted on cork discs with 10% tragacanth gum (Sigma) and immediately frozen in liquid nitrogen-cooled isopentane. Frozen muscles were then cryosectioned at a thickness of 10 μm and stained with hematoxylin and eosin as previously described (Verzi et al., 2005). For X-gal staining, cryosections were fixed in ice cold 4% formaldehyde, 0.5% glutaraldehyde in PBS for 2 min and then stained as previously described (Verzi et al., 2005). Spinal cords were dissected from mice perfused with 4% PFA, additionally post-fixed with 4% PFA overnight, equilibrated with 30% sucrose in PBS and embedded in OCT. Immunostaining for choline acetyltransferase (ChAT) was performed on 40 μm free-floating cryostat sections as described previously (Qiu et al., 2014) with goat anti-ChAT antibody (1:300; Millipore, AB144P; RRID:AB_2079751) and biotinylated rabbit anti-goat (1:200; Vector Laboratories, BA-5000; RRID:AB_2336126) as secondary antibody, followed by diaminobenzidine immunoperoxidase development using the Vectastain Elite ABC kit (Vector Laboratories, PK-6105) and the DAB substrate kit for peroxidase (Vector Laboratories, SK-4100).Post-mortem human spinal cord tissue was obtained from the UCSF Neurodegenerative Disease Brain Bank (NDBB). Formalin fixed paraffin-embedded tissue blocks were cut into 10 µm-thick sections. Tissue sections were subjected to antigen retrieval by autoclaving at 120°C for 5 min in 0.1M citrate buffer, pH 6.0. Immunohistochemistry was performed with rabbit anti-Zfp106 (1:500; Bethyl, A301-526A; RRID:AB_999690). Following immunostaining, digital images were captured using a high resolution digital camera (Nikon DS-U2/L2) mounted on a Nikon Eclipse80i microscope using NIS-Elements (Version 3.22, Nikon) imaging software. Mouse spinal cords were dissected and then fixed in 2% paraformaldehyde overnight at 4°C, embedded in paraffin and then sectioned at 20 μm for subsequent immunofluorescence analyses. Neuro-2a cells were grown on coverslips and fixed with 4% PFA for 10 min. Immunofluorescence was performed as described previously (Anderson et al., 2004) with the following antibodies: mouse anti-NeuN (1:500; Millipore, MAB377; RRID:AB_177621), chicken anti-β-gal (1:500; Aves, BGL1040; RRID:AB_2313507), rabbit anti-Zfp106 (1:100; Bethyl, A301-527A; RRID:AB_999691). Alexa Fluor 594goat anti-chicken (1:500; Molecular Probes A11042; RRID:AB_142803), Alexa Fluor 488donkey anti-mouse (1:500; Molecular Probes A21202; RRID:AB_141607), and Alexa Fluor 594donkey anti-rabbit (1:500; Molecular Probes A21207 RRID:AB_141637) were used as secondary antibodies. The slides were counterstained and mounted with SlowFade Gold antifade reagent with DAPI (Life Technologies, Waltham, MA). Confocal images were acquired with a Leica TCS SPE laser scanning confocal system.
Coimmunoprecipitation and western blot
For coimmunoprecipitation, Neuro-2a cells were transfected with 7 µg of 3×FLAG-2×STREP-Zfp106 or 3×FLAG-2×STREP parental vector per 55 cm2 plate by using GenJet in vitro DNA Transfection Reagent for Neuro-2A Cells, according to the manufacturer’s recommendations (Signagen, Rockville, MD). Cells were lysed in Benzonase Lysis Buffer [20 mM Tris-HCl (pH 7.5), 40 mM NaCl, 2 mM MgCl2, 0.5% NP-40 and Complete EDTA-free protease inhibitor (Roche, Switzerland)] with the addition of 100 U/ml benzonase (Novagen, Germany) to digest nucleic acids. After incubation for 30 min on ice, NaCl concentration was increased to 150 mM and the lysates were further incubated with agitation for 30 min at 4°C. After clearing, the lysates were incubated with pre-washed anti-FLAG(M2)-conjugated magnetic beads (Sigma, St. Louis, MO, M8823) for 4 hr at 4°C. The beads were then washed five times with IP Buffer with 0.05% NP40, before incubation at 70°C for 10 min in 2× NuPAGE Sample Buffer (ThermoFisher Scientific, Waltham, MA, NP0007) supplemented with NuPAGE Sample Reducing Agent (ThermoFisher Scientific, NP0004) to release coimmunprecipitated proteins. Samples were then subjected to SDS-PAGE and western blot using standard procedures.For western blot to detect Zfp106 in transgenicD. melanogaster, heads from 40 Gmr-Gal4, UAS-3×FLAG-2×STREP-Zfp106, and Gmr-Gal4;UAS-3×FLAG-2×STREP-Zfp106 flies were removed and homogenized in RIPA buffer (50 mM Tris-Cl, pH 7.4; 150 mM NaCl; 2 mM EDTA; 1% NP-40; 0.2% SDS) with a Dounce homogenizer (Wheaton, Millville, NJ). Homogenates were cleared by centrifugation, and total protein content was quantified with the Bio-Rad Protein Assay kit (Bio-Rad, 5000002). An equivalent amount of total protein for each sample was subjected to SDS-PAGE and western blot using standard procedures. The following antibodies were used for western blot: rabbit anti-Zfp106 (1:1000; Bethyl, A301-527A; RRID:AB_999691); mouse anti-FLAG (1:1,000; Sigma, F3165 (clone M2); RRID:AB_439685), mouse anti-actin (1:500; Developmental Studies Hybridoma Bank, JLA20; RRID:AB_528068), rabbit anti-TDP-43 (1:1000; Proteintech, 12892–1-AP; RRID:AB_2200505) and rabbit anti-Nup107 (1:1000; Proteintech, 19217–1-AP; RRID:AB_10597702).
RT-qPCR
For RT-qPCR, total RNA was extracted from lumbar spinal cord from mice or from 20 flies per genotype using Trizol (Invitrogen). RNA was treated for 1 hr at 37°C with DNaseI, followed by cDNA synthesis using the Omniscript RT kit (Qiagen). qPCR was performed using the MAXIMA SYBR Green kit (Thermo Scientific) and a 7900HT Fast Real Time PCR System (Applied Biosystems). The SDS 2.4 software package was used to extract raw qPCR data. Data were normalized to housekeeping genes by the 2−ΔΔCt method. The following primers were used for qPCR in mice: primers 5′-atttggcgttgtggatcact-3’ and 5′-gcgttcaatatgtcctgcaa-3’ for amplification of Zfp106 exon 21–22 and 5′-accacagtccatgccatcac-3’ and 5′-tccaccaccctgttgctgta-3’ for amplification of gapdh. The following primers were used for qPCR in flies: 5′-gcgcggttactctttcacca-3’ and 5′- atgtcacggacgatttcacg-3’ for actin, and 5′-gcacgacttcttcaagtccgccatgcc-3’ and 5′-gcggatcttgaagttcaccttgatgcc-3’ for egfp.
Protein purification, mass spectrometry, and analysis of Zfp106-interacting proteins
HEK293T cells were transfected with 20 µg of 3×FLAG-2×STREP-Zfp106 or 5 µg of 3×FLAG-2×STREP-MBNL1 plasmid per 150 cm2 plate by using PolyJet DNA In Vitro Transfection Reagent, according to the manufacturer’s recommendations (Signagen). For RNA EMSA, Zfp106 and MBNL1 were purified from HEK293T total cellular lysates using the Strep-Tag system (Schmidt and Skerra, 2007), with Strep-Tactin Sepharose (IBA, catalog #2-1201-010), according to the manufacturer’s protocol. 0.1% Triton X-100 was added to all buffers for cell lysis and chromatography to enrich for purified proteins. Eluted fractions were analyzed by SDS-PAGE stained with Coomassie brilliant blue. Comparable amounts of Zfp106 and MBNL1 were used in RNA EMSA. A parallel purification from HEK293T cells transfected with the 3×FLAG-2×STREP parental vector was performed and the corresponding fractions in which Zfp106 and MBNL1 were eluted were used in RNA EMSA as a negative control.Affinity purification of Zfp106 for identification of interacting proteins by mass spectrometry was performed as previously described (Jager et al., 2012). Briefly, cleared nuclear extracts from HEK293T cells were prepared as described above (Biotinylated-RNA pull-down section) with the introduction of a benzonase digestion step to digest nucleic acids (100 U/ml for 30 min in the presence of 1 mM MgCl2) and incubated with pre-washed anti-FLAG(M2)-conjugated magnetic beads (Sigma, M8823) for 2 hr at 4°C. Following purification, complexes bound to beads were washed and then eluted in IP buffer containing 100 µg/ml 3×FLAG peptide (Elim Biopharm) and 0.05% RapiGest (Waters Corp.). To analyze proteins by liquid chromatography-mass spectrometry (LC-MS/MS), the eluates were digested with trypsin, and the peptides were analyzed on a Velos Pro mass spectrometry system (Thermo Scientific). Peptides were matched to protein sequences by the Protein Prospector Algorithm (RRID:SCR_014558), and data were searched against a database containing SwissProt human protein sequences (UniProt Consortium, 2015; UniProtKB, RRID:SCR_004426; http://www.uniprot.org). Parallel FLAG-affinity purifications were performed on untransfected HEK293T cells and HEK293T cells transfected with 3xFLAG-2xSTREP tag only, GFP-3xFLAG-2xSTREP or the following 3xFLAG-2xSTREP-tagged proteins: Vif, Tat, MEF2C, Myocardin, and Etv2. The bait-prey datasets were analyzed with the APMS scoring algorithm MiST (Jager et al., 2012), and an in-house curated APMS dataset used for determining machine background noise. The MiST algorithm compares peak intensities from the mass spectrum to determine abundance, reproducibility across multiple replicated experiments (n = 5 for each condition), and specificity based on the uniqueness of each interaction, and then these three metrics are used to determine a composite score by the algorithm (Jager et al., 2012). The Zfp106 interactome was compiled by selecting bait-prey pairs with a top 5% MiST score. Enrichment analysis for GO biological process terms overrepresented in the interactome was performed on the Gene Ontology Consortium website (Gene Ontology Consortium, 2015; RRID:SCR_002811; http://www.geneontology.org). The top 5% MiST hits were visualized as network representation using Cytoscape (Cline et al., 2007; RRID:SCR_003032). Protein complex analysis was performed using the manually curated CORUM protein complex database (Ruepp et al., 2008; RRID:SCR_002254; http://mips.helmholtz-muenchen.de/corum/).
Drosophila larval immunofluorescence and quantification of active zones
For analysis of neuromuscular junction (NMJ) phenotypes in Drosophila, wandering third instar larvae were dissected as previously described (Smith and Taylor, 2011). Dissected larvae were fixed in 3.7% formaldehyde in PBS for 20 min, washed in PBT (PBS with 0.4% Triton X-100) and blocked with 10% normal goat serum for 1 hr at room temperature. The larvae were then incubated overnight at 4°C with mouse anti-Brp antibody (1:50; Developmental Studies Hybridoma Bank, nc82; RRID:AB_2314865) to label the active zones and Cy3 goat anti-HRP (1:200; Jackson ImmunoResearch, 123-165-021; RRID:AB_2338959) to label the NMJ membrane and axons. Next, samples were washed in PBT and incubated with Alexa Fluor 488goat anti-mouse (1:200; Molecular Probes, A11001; RRID:AB_2534069) in PBT + 10% normal goat serum at room temperature for 2 hr. Multiple confocal stacks were acquired using a point scanning confocal microscope (Leica TCS SPE) and then processed using the DeadEasy Synapse ImageJ plugin (Sutcliffe et al., 2013), which provides total voxel occupancy by Brp signal at each nerve terminal. Brp signal was quantified at muscle 6/7 NMJs from abdominal segment A3.
Rapid iterative negative geotaxis (RING) assay
Locomotor activity in 28-day post-eclosion flies was assayed by the Rapid Iterative Negative Geotaxis (RING) assay, as previously described (Gargano et al., 2005; Nichols et al., 2012). Briefly, 25 flies for each genotype were transferred without anesthetizing in polystyrene vials assembled in a RING apparatus. The RING apparatus was sharply tapped down three times and negative geotaxis was recorded on video for six trials for each genotype. The average height climbed at 3 s after completion of the third tap was scored for each genotype.
Statistical analyses
Statistical analyses were performed using GraphPad Prism 5.0 (GraphPad Software; RRID:SCR_002798). Data were analyzed by one-way or two-way ANOVA followed by Bonferroni’s Multiple Comparison Test or by t-test.In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.[Editors’ note: this article was originally rejected after discussions between the reviewers, but the authors were invited to resubmit after an appeal against the decision.]Thank you for submitting your work entitled "Suppression of C9orf72 RNA repeat-induced neurotoxicity by the ALS-associated zinc finger protein Zfp106" for consideration by eLife. Your article has been favorably evaluated by Marianne Bronner as the Senior Editor and three reviewers, one of whom is a member of our Board of Reviewing Editors. The reviewers have opted to remain anonymous.Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in eLife.Reviewer #1:In this concise and well written paper, Celona et al. present extensive evidence that the zinc finger protein Zfp106 is a major player in C9orf72 RNA repeat-induced neurotoxicity (expanded GGGGCC repeats in the first intron of the C9orf72 gene represent the most common cause of familial amyotrophic lateral sclerosis (ALS)). Starting with a biotinylated RNA pulldown of neural nuclear proteins, the authors identify Zfp106. They go on to show that Zfp106 loss-of-function causes an ALS-like phenotype in mice, and that it can be suppressed by transgenic restoration of Zfp106 specifically in motor neurons. They also show that Zfp106 can suppress neurotoxicity in a fly model of C9orf72ALS, and that Zfp106 interacts with multiple other RNA binding proteins including the ALS factors TDP-43 and FUS. The data appear convincing and highly significant.Reviewer #2:C9orf72 has attracted a lot of attention recently because of its strong association with familial ALS. Two major models by which the repeats can cause disease have already been proposed, and this manuscript provides some new evidence for one of those models – the RNA binding protein sequestration model.This manuscript opens with the observation that the zinc finger protein Zfp106 binds the repeats in C9orf72 in an in vitro pull down assay. Loss of Zfp106 was already known from knockout mice to cause a nondevelopmental neuromuscular degeneration, but on the basis of this biochemical interaction the authors now propose that this is an ALS-like degeneration caused by motor neuron degeneration. They show evidence for loss of motor neurons in the knockout mice and consistent with Zfp106 functioning in motor neurons, they show some phenotypic rescue of weight and grip strength with rescue of Zfp106 expression in motor neurons. In order to link Zfp106 more specifically to an ALS model of neuromuscular disease they employ a well-established Drosophila model of C9orf72 repeat overexpression in motor neurons and show phenotypic rescue with Zfp106 overexpression. Finally, to suggest a mechanism for Zfp106 function they do mass spec of Zfp106 co-associated proteins in heterologous HEK293 cells and find lots of RNA binding and processing factors.Although Zfp106 knockout mice had already been extensively studied for their neuromuscular phenotype, the link revealed in this study between Zfp106 and C9orf72 is novel and adds a key new dimension to that observation. However that being said, the investigation of this association in this manuscript is somewhat superficial weakening the impact of the finding.1) The RNA assays in Figure 1 are convincing that Zfp106 can bind the repeats but with just a single control shown it is not clear how specific this interaction might be. Do other RNA binding proteins also bind these repeats in this assay? Can Zfp106 be shown not to bind some other RNA sequence that is the target of a different RNA binding protein?2) The effect of Zpf106 loss on motor neuron degeneration is insufficiently characterized. The number of ChAT neurons in Figure 2 should be quantified across a set of mice, and histological validation of their degeneration should be shown. In addition, there is no data in the paper to show that the phenotypic rescue with the H89 transgene does actually result in rescue of this motor neuron phenotype and that must be shown.3) The mass spec experiments in Figure 3 add little to the model because they fail to test whether the interactions seen are specific to Zfp106. The control is simply the empty vector, whereas a more meaningful control would be another RNA binding protein that does not show the same specificity. The authors do not validate any of the proposed interactions discovered by mass spec using pulldowns and immunoblotting, which would help to determine whether they are direct or perhaps indirect and mediated by multiple proteins binding a single RNA.4) Although the fly model has already been established as motor neuron specific, the authors should still show that when they rescue the phenotypes with Zfp106 overexpression that this results in improved motor neuron survival.Reviewer #3:Celona et al. reported the identification of Zfp106, a Zinc-finger-containing protein, as an interactor of G4C2 HRE. Loss of Zfp causes motor deficits and neurodegeneration that mimics ALS in mice that can be rescued by restoring the expression in motor neurons. Protein interactome analysis suggested that Zfp is associated with RNA binding proteins that has been implicated in ALS. In addition, Zfp overexpression rescues G4C2-mediated motor neuron toxicity in a fly model of C9-ALS. The finding is important, the story is clean, and the interpretation is clear.However – one major caveat – none of the mouse studies are novel as the same mouse was recently published: http://www.pnas.org/content/early/2016/07/13/1608423113.long. The authors will need cite this new preceding mouse work and provide information on what new data their study offers (and detail the lessor contribution of the fly studies).We have several suggestions to improve the manuscript.1) Please label the age of mice on the sections/stainings.2) Please briefly introduce the method used to express Zfp in motor neurons in the main text, which Cre line used etc.3) Please verify some of the interactions between Zfp and RNA binding proteins, e.g. TDP-43 and FUS. Please stain and blot TDP-43 and FUS in Zfp lof mice to show whether they are mislocalized and/or changed in proteins levels.4) The real relevance to human disease would be more convincing by an examination of far more than just two human cases. The author must show reproducibility of this pathology by and examination of at least 8-15 C9 cases to be sure of the rigor of the observation and need to include disease control such as: sporadic ALS, and even mutant SOD1ALS spiral cord. Is this just an exceptionally rare neuropathological observation – how common is it? Is it seen in glia? Which glia? Is it found in unaffected brain regions? Finally, they need to provide more details the human cases (e.g. age, length of disease, sex, post mortem interval, etc.).5) Please show G4C2 mRNA is unchanged when co-expressing Zfp in G4C2 flies to make sure the rescue is not due to a GAL4-UAS dilution effect. Also, fly doesn't have a gene named Zfp106, please indicate which gene (CG number) is referred to. If they are referring to the mouse/humanZfp106, please specify which is the fly homolog and the authors need to express the fly homolog to show the same rescue. Otherwise, it's unknown what a foreign protein is doing in fly. Once this homolog is identified, please express its RNAi in G4C2 flies to see if it enhances phenotypes.[Editors’ note: what now follows is the decision letter after the authors submitted for further consideration.]Thank you for resubmitting your work entitled "Suppression of C9orf72 RNA repeat-induced neurotoxicity by the ALS-associated RNA-binding protein Zfp106" for further consideration at eLife. Your revised article has been favorably evaluated by Marianne Bronner as the Senior Editor, a Reviewing Editor, and two reviewers.The manuscript has been improved but there are some remaining issues, and one serious reservation (#7), that need to be addressed before a final decision may be reached.Remaining revisions needed:In this revision the authors have added significant new data to strengthen their story. However, there are still parts of the manuscript that need further textual modifications for the sake of clarification, and the revision of the mass spec section of the paper did not fully resolve the concerns I had raised about the interpretation of these data. Further, as stated in #7 below, you may need further experimental evidence to support your claim of functionally related fly and mouse Zfp othologs.1) The text frequently overstates the relationship between the model organism phenotypes and ALS. For example in the Abstract it says "Zpf106 knockout mice develop ALS". The mice develop motor neuron degeneration and an ALS-like motor phenotype, but it is going too far to call it ALS. There are numerous instances of this usage throughout the text, not enumerated here, and all should be corrected.2) With respect to the molecular validation of the CRISPR mutant mouse, I appreciate that PCR has been added to Figure 2—figure supplement 3A. However, it remains unclear from the descriptions provided in the paper exactly what mutations were made to the Zpf106 gene and what this figure really shows. The description of the CRISPR mutation suggests this was two point mutations in exon 1 generated in separate lines, that were then crossed to each other to make a KO? It sounds from the methods as if the primers were against exons 21-22 far away from the mutation itself. If this is a point mutation mouse then why would the RNA be reduced? And if these are both null lines, why is the RNA expression for both the KO and the CRISPRmouse not completely gone (since these are not cell type specific)? I'm guessing that the answer to both of these questions is nonsense-mediated decay, but I thought that was uncommon with the CRISPR point mutations and anyway if this is the case then better to explain in the text than to have the reader fill in the gaps. Finally, given that the authors have an antibody against Zpf106 (Figure 1C) the authors should show loss of protein to validate that these actually are null alleles.3) In Figure 2 and the associated supplementary figures it is not always clear which Zpf106 strain is being used. Is the "knockout" the CRISPRmouse, and only the cases where the strain is annotated for "lacZ" the KOMP mouse? This naming scheme should be more explicitly spelled out at least in the Methods if not in the Results text since they are both presumably "knockouts" or "nulls".4) With respect to m the mass spec experiments, it is now mentioned in the sixth paragraph of the Results and Discussion section that "several controls were included in the mass spectrometry experiments, including the DNA-binding factors Etv2 and MEF2C and the RNA-binding proteins Vif and Tat", and the Methods section describes that these proteins were expressed and pulled down. Yet the manuscript never says how these were used as controls. Were these negative controls meaning that the authors subtracted from their list of pulldown proteins anything that came down with any other protein? Were they specificity controls meaning that a comparative analysis of binding proteins was carried out? Were they positive controls, meaning the authors knew what proteins were supposed to interact with these and found them in the pulldown? It is not enough to say "controls were run" and then never show the data or never explain how those data were used.5) The direct IP experiments provide important support for the results of the mass spec. However, this is exactly where it would be helpful to see some of those positive and negative controls used.6) The authors should not call their Zfp mice "ALS" in the Abstract as they're simply describing a motor neuron-like disease. They did not show in their mice upper motor neuron involvement (by definition required to call a disease ALS) and their muscle pathology is not seen in typical ALS. To compensate for it, they should examine human tissue to see if real C9 ALS has changes in Zfp106- otherwise this is simply a mouse model of interesting biology – but no definite link to true human disease. Because of the failure of mouse models to truly predict human disease- or therapies- a direct comparison to actual humanALS tissue is required for all studies if trying to make such association.7) The authors did not answer the questions whether there is a fly orthologue of Zfp and, if yes, what is its CG number. (This is not trivial, as FlyBase curators may ask you even after you publish your paper.) If there is one such orthologue and if this orthologue does not rescue neurodegeneration in C9 flies, then the rescue effect of mouse Zfp showed by the authors is not through Zfp evolutionarily conserved functions, but possibly an artifact, which raises a critical concern about the study's translatability. Without any evidence that the mouse Zfp is functional in flies (e.g. is it properly localized, post-translationally modified, or regulating the same genes as it normally does in mice?), the data that this protein rescues neuronal defects in C9-ALS flies may not be biologically meaningful at all. The authors in this case need to test whether mouse Zfp rescues neurodegeneration in C9-ALSmice. Otherwise, they need to identify downstream genes through which the mouse Zfp suppresses C9 defects in flies and then validate in mammals that the orthologues of these genes are indeed downstream targets of Zfp. In addition, the rebuttal is confusing because it claims that the authors did not argue a "rescue", but rather a "suppression" of C9-phenotypes (although I did not see a profound difference between them), whereas in the legend of Figure 4A, the authors said "this defect was completed rescued by co-expression of Zfp106".[Editors’ note: the author responses to the first round of peer review follow.]Reviewer #2: […] Although Zfp106 knockout mice had already been extensively studied for their neuromuscular phenotype, the link revealed in this study between Zfp106 and C9orf72 is novel and adds a key new dimension to that observation. However that being said, the investigation of this association in this manuscript is somewhat superficial weakening the impact of the finding.1) The RNA assays inThese are reasonable suggestions for additional controls related to the specificity of Zfp106-RNA interaction. Accordingly, we performed two additional EMSA experiments. The first of these new EMSA experiments shows that Zfp106 binding to GGGGCC repeats is efficiently competed by unlabeled self probe but not by a mutant RNA probes or by CUG repeats (muscleblind/MBLN1 binding sequence) even when those unlabeled control probes are added at 30-fold molar excess. That experiment (new Figure 1—figure supplement 1A) also shows that MBLN1 protein does not bind to GGGGCC repeats under the same conditions in which Zfp106 efficiently binds. In a complementary experiment (new Figure 1—figure supplement 1B), a second new EMSA shows clearly that MBLN1 binds specifically and efficiently to CUG repeats and that under those same conditions, Zfp106 shows no discernable binding.2) The effect of Zpf106 loss on motor neuron degeneration is insufficiently characterized. The number of ChAT neurons inThese are good suggestions. Accordingly, we have quantified the number of ChAT+ motor neurons from wild type and Zfp106 knockout mice. These new data, which are shown in Figure 2I in the revised manuscript, demonstrate a statistically significant reduction in ChAT+ motor neurons in Zfp106 knockout mice. We also examined motor neuron survival by ChAT staining in HB9-Zfp106transgenic rescue mice compared to wild type and Zfp106 knockout mice without the transgene, and we quantified the number of ChAT+ motor neurons in mice of each of these genotypes. These new data, which show significant rescue of ChAT+ motor neurons upon restoration of Zfp106, are shown in Figure 2M and Figure 2—figure supplement 4 of the revised manuscript.3) The mass spec experiments inWe appreciate the reviewer’s concern regarding the specificity of the mass spectrometry experiments and the need to analyze other RNA binding proteins as a measure of specificity. Indeed, this was done in the original study, although we did not draw enough attention to this key point in the original version of the paper. In the Materials and methods section of the original version of the paper, we indicated that we used several negative controls in the mass spectrometry experiments, including DNA-binding factors Etv2 and MEF2C and the RNA-binding proteins Vif and tat. Importantly, the MIST algorithm, which was used to determine the specificity of the Zfp106 protein-protein interactions, considered the Vif and Tat interactomes, essentially subtracting non-specific and background interactors with those two proteins from the Zfp106 interactome. In the revised manuscript, we have added an additional statement to the Results and Discussion section (sixth paragraph) to draw additional attention to that fact. In addition, as suggested by the reviewer (and reviewer 3), we validated the interaction of Zfp106 with the ALS-associated RNA-binding proteins TDP-43 and Nup107, as examples of interacting proteins, by co-immunoprecipitation. These new data are now shown as Figure 3—figure supplement 1 and are discussed in the seventh paragraph of the Results and Discussion section.4) Although the fly model has already been established as motor neuron specific, the authors should still show that when they rescue the phenotypes with Zfp106 overexpression that this results in improved motor neuron survival.This is a good suggestion to provide additional depth to these studies. In the revised manuscript, we show that expression of mammalianZfp106 in the fly suppresses the loss of motor neurons caused by expression of 30 copies of C9orf72GGGGCC repeats. Specifically, using established approaches (Smith and Taylor, 2011; Zhang et al., 2015), we now show that 30x GGGGCC expression reduces active zones as measured by anti-Brp staining and importantly that co-expression of Zfp106 restores Brp expression at active zones. These new data are shown as Figures 4C-F in the revised manuscript.Reviewer #3:Celona et al. reported the identification of Zfp106, a Zinc-finger-containing protein, as an interactor of G4C2 HRE. Loss of Zfp causes motor deficits and neurodegeneration that mimics ALS in mice that can be rescued by restoring the expression in motor neurons. Protein interactome analysis suggested that Zfp is associated with RNA binding proteins that has been implicated in ALS. In addition, Zfp overexpression rescues G4C2-mediated motor neuron toxicity in a fly model of C9-ALS. The finding is important, the story is clean, and the interpretation is clear.However – one major caveat – none of the mouse studies are novel as the same mouse was recently published:We greatly appreciate the reviewer’s recognition of the significance of our work and the positive comments about the findings and interpretations. With regard to the major caveat that “none of the mouse studies are novel,” please note that the very first appearance of the Advance Online version of the cited Olson PNAS manuscript was on July 14, 2016. Our eLife submission date was June 17 – nearly a month earlier. From a discussion with Dr. Olson at a recent meeting, we were aware of his pending manuscript and specifically chose to submit to eLife based on eLife’s editorial policy that submitted papers cannot be “scooped” by articles published after review at eLife has commenced.Thus, I do not believe that this single major caveat should be held against our manuscript as a valid reason for rejection. Moreover, the criticism is not quite accurate. In our manuscript, unlike the Olson paper, we show transgenic rescue of the mouse phenotype via restoration of Zfp106 specifically to motor neurons. This is an important and novel finding not made in the other manuscript. Additionally, unlike in the other work, we identify the Zfp106 protein-protein interactome and, very importantly, we show suppression of C9orf72 repeat-mediated neurotoxicity by Zfp106 in an established Drosophila model of C9orf72ALS. We disagree that this work in the fly is a lessor contribution.Of course, it would have been impossible for us to cite the Olson manuscript in the original manuscript since our paper was submitted nearly a month prior to any appearance of the Olson paper, even online. However, as requested by the reviewer, in the revised manuscript, we have cited the Olson PNAS paper and its contribution to our understanding of Zfp106 genetic function in mice. In addition, we have addressed all of the reviewer’s other concerns, as described below.We have several suggestions to improve the manuscript.1) Please label the age of mice on the sections/stainings.We have labeled the ages of the mice on all sections in the revised manuscript.2) Please briefly introduce the method used to express Zfp in motor neurons in the main text, which Cre line used etc.Although this was done in the Methods section in the original version of the manuscript, we have taken the reviewer’s suggestion and added these details in brief to the Results and Discussion section. To clarify, this was a transgenic rescue, in which Zfp106 expression was under direct control of the motor neuron-restricted HB9 promoter; no Cre lines were used for this rescue.3) Please verify some of the interactions between Zfp and RNA binding proteins, e.g. TDP-43 and FUS. Please stain and blot TDP-43 and FUS in Zfp lof mice to show whether they are mislocalized and/or changed in proteins levels.As suggested by the reviewer (and by reviewer 2), we validated the interaction of Zfp106 with two ALS-associated RNA-binding proteins, TDP-43 and Nup107, by co-immunoprecipitation. These new data are now shown as Figure 3—figure supplement 1 and are discussed in the sixth paragraph of the Results and Discussion section. We believe that further histological analyses of TDP-4, Fus, and other Zfp106-interacting protein localization in knockout mice deal primarily with details of the ALS phenotype and are beyond the focus of this Short Report, which highlights the genetic function of Zfp106, it’s protein-protein interactome, and the key finding that gain-of-function expression of mammalianZfp106 was sufficient to suppress neurotoxicity in an established Drosophila model of C9orf72ALS.4) The real relevance to human disease would be more convincing by an examination of far more than just two human cases. The author must show reproducibility of this pathology by and examination of at least 8-15 C9 cases to be sure of the rigor of the observation and need to include disease control such as: sporadic ALS, and even mutant SOD1ALS spiral cord. Is this just an exceptionally rare neuropathological observation – how common is it? Is it seen in glia? Which glia? Is it found in unaffected brain regions? Finally, they need to provide more details the human cases (e.g. age, length of disease, sex, post mortem interval, etc.).I believe the reviewer may have misinterpreted the data presented in Figure 1D, D’ – no “cases” are shown in our manuscript. In that figure, we present images that show expression of ZNF106 in human tissue, and the two major patterns of subcellular distribution are observed. Based on the reviewer’s comment, I believe that the reviewer may have misinterpreted those data to be C9orf72 and control patient samples showing pathology. However, only control/non-ALShuman post-mortem tissues are shown. The point was not to show pathology but to examine the pattern of expression of the human ortholog. Importantly, the pattern of expression is consistent with a possible role in ALS, but an examination of C9orf72patient pathology is beyond the scope of this Short Report.5) Please show G4C2 mRNA is unchanged when co-expressing Zfp in G4C2 flies to make sure the rescue is not due to a GAL4-UAS dilution effect. Also, fly doesn't have a gene named Zfp106, please indicate which gene (CG number) is referred to. If they are referring to the mouse/humanZfp106, please specify which is the fly homolog and the authors need to express the fly homolog to show the same rescue. Otherwise, it's unknown what a foreign protein is doing in fly. Once this homolog is identified, please express its RNAi in G4C2 flies to see if it enhances phenotypes.The reviewer’s concern about the somewhat remote possibility that co-expression of Zfp106 in the same cells as 30x GGGGCC could cause a GAL4 dilution effect is a valid one. Accordingly, we performed qPCR analysis of UAS-transgene-encoded gfp expression in the presence and absence of the additional UAS-Zfp106 transgene. These new data clearly show the same level of 30R-GFP mRNA in progeny with Zfp106 co-expression as in those without Zfp106 co-expression. These important new control data are included in the revised manuscript as Figure 4—figure supplement 1Band are discussed in the eighth paragraph of the Results and Discussion section. With regard to the reviewer’s concern about whether the Zfp106 expression experiments in the fly were using the fly ortholog (if one even exists) or the mouse cDNA, we have clarified in the revised manuscript that indeed this was an experiment using the mouse cDNA. We disagree strongly with the reviewer’s belief that expression of a fly ortholog is essential for the interpretation of these experiments – the expression of mouseZfp106 in the fly is not a rescue of the fly ortholog (if one even exists) and was not purported to be a rescue in our manuscript. This experiment was used solely to examine the interaction of mammalianZfp106 with the C9orf72 repeats in an established neurodegeneration model in the fly. By design, this was used in much the same way that gain-of-function experiments in cell culture are used. Importantly, in this well-established model, we show profound suppression of the C9orf72 repeat-induced phenotype. This is a key result, which we believe stands on its own as presented.[Editors’ note: the author responses to the re-review follow.]The manuscript has been improved but there are some remaining issues, and one serious reservation (#7), that need to be addressed before a final decision may be reached. Given that the manuscript has already been revised twice, we must insist that this represents the last opportunity you will have to address the remaining concerns.Remaining revisions needed:In this revision the authors have added significant new data to strengthen their story. However, there are still parts of the manuscript that need further textual modifications for the sake of clarification, and the revision of the mass spec section of the paper did not fully resolve the concerns I had raised about the interpretation of these data. Further, as stated in #7 below, you may need further experimental evidence to support your claim of functionally related fly and mouse Zfp othologs.1) The text frequently overstates the relationship between the model organism phenotypes and ALS. For example in the Abstract it says "Zpf106 knockout mice develop ALS". The mice develop motor neuron degeneration and an ALS-like motor phenotype, but it is going too far to call it ALS. There are numerous instances of this usage throughout the text, not enumerated here, and all should be corrected.We edited the description of the Zfp106 knockout phenotype exactly as suggested by the reviewer. We no longer refer to it as ALS in the Abstract or elsewhere in the manuscript. Instead, we refer to the phenotype more generally as neurodegeneration or neurodegeneration and an ALS-like motor phenotype.2) With respect to the molecular validation of the CRISPR mutant mouse, I appreciate that PCR has been added toWe apologize for the confusion. As suggested by the reviewer, we have clarified exactly which Zfp106 knockout allele was used in the manuscript. Simply put, all data shown in the paper use the KOMP allele, and this is now clearly indicated in the third paragraph of the Results and Discussion section. The CRISPR- generated allele was used as an independent validation, exhibiting the same phenotype but not shown in the manuscript. This is now clearly and plainly discussed in the fourth paragraph of the Results and Discussion section. This does not affect any of the data in the manuscript nor does it affect any of the manuscript’s conclusions. Our CRISPR strategy produced frameshift deletion mutations in exon1 causing premature stop codons, likely resulting in nonsense-mediated decay. Our qPCR data show that Zfp106 mRNA is significantly and profoundly reduced in knockout animals; adding additional validation by western blot adds little to the manuscript and will not affect the conclusions of the manuscript or the validity of the experiment. The mice show a profound phenotype, and the mRNA is drastically reduced in knockout animals. Additionally, the ~80% reduction in Zfp106 expression is consistent with previous studies (Anderson et al., 2016; Joyce et al., 2016); the ~20% residual expression in Zfp106-null tissue is likely due to transcripts generated from an alternative promoter and TSS described for the Zfp106 gene (Grasberger and Bell, 2005).3) InAs noted above (response to point 2), all Zfp106 knockout data shown in the manuscript were obtained with the KOMP allele. This is now clearly stated in the third paragraph of the Results and Discussion section.4) With respect to m the mass spec experiments, it is now mentioned in the sixth paragraph of the Results and Discussion section that "several controls were included in the mass spectrometry experiments, including the DNA-binding factors Etv2 and MEF2C and the RNA-binding proteins Vif and Tat", and the Methods section describes that these proteins were expressed and pulled down. Yet the manuscript never says how these were used as controls. Were these negative controls meaning that the authors subtracted from their list of pulldown proteins anything that came down with any other protein? Were they specificity controls meaning that a comparative analysis of binding proteins was carried out? Were they positive controls, meaning the authors knew what proteins were supposed to interact with these and found them in the pulldown? It is not enough to say "controls were run" and then never show the data or never explain how those data were used.The controls used in the mass spectrometry experiments included both DNA and RNA binding proteins and were essentially negative controls relative to the Zfp106 interactome, but the statistical algorithm used is somewhat more nuanced than simply defining controls as negative or positive. The MiST algorithm (Jager et al., 2012) compares peak intensities from the mass spectrum to determine abundance, reproducibility across multiple replicated experiments, and specificity based on the uniqueness of each interaction, and then these three metrics are used to determine a composite score by the algorithm. This is a widely used and well-validated approach for evaluating mass spectrometry data with more than 30 publications citing the effectiveness of the MiST algorithm. We have cited the original publication in the revised manuscript where the details of MiST are discussed. We have also added additional detail the revised manuscript in the Results and Discussion section (sixth paragraph) and to the Methods section (subsection “Protein purification, mass spectrometry, and analysis of Zfp106-interacting proteins”, last paragraph) to clarify how the controls were used.5) The direct IP experiments provide important support for the results of the mass spec. However, this is exactly where it would be helpful to see some of those positive and negative controls used.We appreciate the reviewer’s recognition that the co-immunoprecipitation experiments, added in response to the prior reviews, provide important support for the mass spectrometry results. These new co-IP experiments include negative control immunoprecipitations using lysates from cells transfected with 3×FLAG-2×STREP tag only, showing the specificity of the co-IP of Nup107 and TDP-43 by 3×FLAG-2×STREP-Zfp106.6) The authors should not call their Zfp mice "ALS" in the Abstract as they're simply describing a motor neuron-like disease. They did not show in their mice upper motor neuron involvement (by definition required to call a disease ALS) and their muscle pathology is not seen in typical ALS. To compensate for it, they should examine human tissue to see if real C9 ALS has changes in Zfp106- otherwise this is simply a mouse model of interesting biology – but no definite link to true human disease. Because of the failure of mouse models to truly predict human disease- or therapies- a direct comparison to actual humanALS tissue is required for all studies if trying to make such association.As suggested by the reviewer, we no longer refer to the phenotype in Zfp106 knockout mice as having ALS. We now discuss the phenotype as neurodegeneration or neurodegeneration with an ALS-like motor phenotype. This has been edited throughout the manuscript.7) The authors did not answer the questions whether there is a fly orthologue of Zfp and, if yes, what is its CG number. (This is not trivial, as FlyBase curators may ask you even after you publish your paper.) If there is one such orthologue and if this orthologue does not rescue neurodegeneration in C9 flies, then the rescue effect of mouse Zfp showed by the authors is not through Zfp evolutionarily conserved functions, but possibly an artifact, which raises a critical concern about the study's translatability. Without any evidence that the mouse Zfp is functional in flies (e.g. is it properly localized, post-translationally modified, or regulating the same genes as it normally does in mice?) the data that this protein rescues neuronal defects in C9-ALS flies may not be biologically meaningful at all. The authors in this case need to test whether mouse Zfp rescues neurodegeneration in C9-ALSmice. Otherwise, they need to identify downstream genes through which the mouse Zfp suppresses C9 defects in flies and then validate in mammals that the orthologues of these genes are indeed downstream targets of Zfp. In addition, the rebuttal is confusing because it claims that the authors did not argue a "rescue", but rather a "suppression" of C9-phenotypes (although I did not see a profound difference between them), whereas in the legend ofThere is no established ortholog of Zfp106 in Drosophila and, despite the reviewer’s assertion, we have never claimed that there is a functionally-related ortholog of Zfp106 in the fly or that we are using Zfp106 to rescue a fly gene. To clarify, we are using Drosophila in these experiments solely as a gain-of-function model – there is no clear ortholog of C9orf72 or the expanded hexanucleotide repeat sequence from C9orf72 in the fly, yet the overexpression model used here and elsewhere is accepted as a gain-of-function model for C9orf72-mediated neurodegeneration/neurotoxicity. Similarly, we use a purely gain-of-function approach with mammalianZfp106 expression in the fly to examine whether the interaction of Zfp106 with GGGGCC repeats is a functional interaction. We have further clarified the gain-of-function design of our approach in eighth paragraph of the Results and Discussion section, and have emphasized that Zfp106 suppresses rather than rescues repeat-mediated neurotoxicity.Generation of multiple new Drosophilatransgenic lines with a yet to be identified and validated Drosophila ortholog or the identification of genes affected by Zfp106 in both flies and mammals is clearly beyond the scope of this Short Report and cannot be completed in a reasonable time frame. Moreover, these extensive new experiments would not change the key conclusion that Zfp106 functionally interacts with the hexanucleotide repeats to suppress neurotoxicity in the fly. This key result, taken together with RNA EMSA and other experiments, which show a biochemical interaction between Zfp106 and the hexanucleotide repeats, clearly establish the physical and functional interaction of Zfp106 with GGGGCC repeats.
Authors: Melissa S Cline; Michael Smoot; Ethan Cerami; Allan Kuchinsky; Nerius Landys; Chris Workman; Rowan Christmas; Iliana Avila-Campilo; Michael Creech; Benjamin Gross; Kristina Hanspers; Ruth Isserlin; Ryan Kelley; Sarah Killcoyne; Samad Lotia; Steven Maere; John Morris; Keiichiro Ono; Vuk Pavlovic; Alexander R Pico; Aditya Vailaya; Peng-Liang Wang; Annette Adler; Bruce R Conklin; Leroy Hood; Martin Kuiper; Chris Sander; Ilya Schmulevich; Benno Schwikowski; Guy J Warner; Trey Ideker; Gary D Bader Journal: Nat Protoc Date: 2007 Impact factor: 13.491
Authors: Kaalak Reddy; Bita Zamiri; Sabrina Y R Stanley; Robert B Macgregor; Christopher E Pearson Journal: J Biol Chem Date: 2013-02-19 Impact factor: 5.157
Authors: Haiyan Qiu; Sebum Lee; Yulei Shang; Wen-Yuan Wang; Kin Fai Au; Sherry Kamiya; Sami J Barmada; Steven Finkbeiner; Hansen Lui; Caitlin E Carlton; Amy A Tang; Michael C Oldham; Hejia Wang; James Shorter; Anthony J Filiano; Erik D Roberson; Warren G Tourtellotte; Bin Chen; Li-Huei Tsai; Eric J Huang Journal: J Clin Invest Date: 2014-02-10 Impact factor: 14.808
Authors: J W Miller; C R Urbinati; P Teng-Umnuay; M G Stenberg; B J Byrne; C A Thornton; M S Swanson Journal: EMBO J Date: 2000-09-01 Impact factor: 11.598
Authors: Alfredo Castello; Bernd Fischer; Katrin Eichelbaum; Rastislav Horos; Benedikt M Beckmann; Claudia Strein; Norman E Davey; David T Humphreys; Thomas Preiss; Lars M Steinmetz; Jeroen Krijgsveld; Matthias W Hentze Journal: Cell Date: 2012-05-31 Impact factor: 41.582
Authors: Zihui Xu; Mickael Poidevin; Xuekun Li; Yujing Li; Liqi Shu; David L Nelson; He Li; Chadwick M Hales; Marla Gearing; Thomas S Wingo; Peng Jin Journal: Proc Natl Acad Sci U S A Date: 2013-04-03 Impact factor: 11.205
Authors: Brian O Orr; Anna G Hauswirth; Barbara Celona; Richard D Fetter; Giulia Zunino; Evgeny Z Kvon; Yiwen Zhu; Len A Pennacchio; Brian L Black; Graeme W Davis Journal: Neuron Date: 2020-05-06 Impact factor: 17.173
Authors: Amanda M Gleixner; Brandie Morris Verdone; Charlton G Otte; Eric N Anderson; Nandini Ramesh; Olivia R Shapiro; Jenna R Gale; Jocelyn C Mauna; Jacob R Mann; Katie E Copley; Elizabeth L Daley; Juan A Ortega; Maria Elena Cicardi; Evangelos Kiskinis; Julia Kofler; Udai B Pandey; Davide Trotti; Christopher J Donnelly Journal: Nat Commun Date: 2022-06-13 Impact factor: 17.694
Authors: Xuan Jiang; Amit Prabhakar; Stephanie M Van der Voorn; Prajakta Ghatpande; Barbara Celona; Srivats Venkataramanan; Lorenzo Calviello; Chuwen Lin; Wanpeng Wang; Brian L Black; Stephen N Floor; Giorgio Lagna; Akiko Hata Journal: Sci Signal Date: 2021-02-23 Impact factor: 8.192