Petter Holland1, Helene Knævelsrud1, Kristiane Søreng1, Benan J Mathai1, Alf Håkon Lystad1, Serhiy Pankiv1, Gunnveig T Bjørndal1, Sebastian W Schultz2, Viola H Lobert2, Robin B Chan3, Bowen Zhou3, Knut Liestøl4, Sven R Carlsson, Thomas J Melia5, Gilbert Di Paolo3, Anne Simonsen1. 1. Department of Molecular Medicine, Institute of Basic Medical Sciences, University of Oslo, PO Box 1112, 0317 Oslo, Norway. 2. Centre for Cancer Biomedicine, Faculty of Medicine and Department of Molecular Cell Biology, Institute for Cancer Research, Oslo University Hospital, 0379 Oslo, Norway. 3. Department of Pathology and Cell Biology, Taub Institute for Research on Alzheimer's Disease and the Aging Brain, Columbia University Medical Center, 630 West 168th Street, New York, New York 10032, USA. 4. Centre for Cancer Biomedicine, Faculty of Medicine, University of Oslo, 0379 Oslo, Norway. 5. Department of Cell Biology, Yale University School of Medicine, PO Box 208002, 333 Cedar Street, New Haven, Connecticut 06520-800210032, USA.
Abstract
A fundamental question is how autophagosome formation is regulated. Here we show that the PX domain protein HS1BP3 is a negative regulator of autophagosome formation. HS1BP3 depletion increased the formation of LC3-positive autophagosomes and degradation of cargo both in human cell culture and in zebrafish. HS1BP3 is localized to ATG16L1- and ATG9-positive autophagosome precursors and we show that HS1BP3 binds phosphatidic acid (PA) through its PX domain. Furthermore, we find the total PA content of cells to be significantly upregulated in the absence of HS1BP3, as a result of increased activity of the PA-producing enzyme phospholipase D (PLD) and increased localization of PLD1 to ATG16L1-positive membranes. We propose that HS1BP3 regulates autophagy by modulating the PA content of the ATG16L1-positive autophagosome precursor membranes through PLD1 activity and localization. Our findings provide key insights into how autophagosome formation is regulated by a novel negative-feedback mechanism on membrane lipids.
A fundamental question is how autophagosome formation is regulated. Here we show that the PX domain protein HS1BP3 is a negative regulator of autophagosome formation. HS1BP3 depletion increased the formation of LC3-positive autophagosomes and degradation of cargo both in human cell culture and in zebrafish. HS1BP3 is localized to ATG16L1- and ATG9-positive autophagosome precursors and we show that HS1BP3 binds phosphatidic acid (PA) through its PX domain. Furthermore, we find the total PA content of cells to be significantly upregulated in the absence of HS1BP3, as a result of increased activity of the PA-producing enzyme phospholipase D (PLD) and increased localization of PLD1 to ATG16L1-positive membranes. We propose that HS1BP3 regulates autophagy by modulating the PA content of the ATG16L1-positive autophagosome precursor membranes through PLD1 activity and localization. Our findings provide key insights into how autophagosome formation is regulated by a novel negative-feedback mechanism on membrane lipids.
Autophagy targets intracellular components for lysosomal degradation to promote cellular and organismal health and homoeostasis, and has been shown to protect against neurodegeneration and cancer, help remove invading pathogens and promote longevity1. Macroautophagy (here referred to as autophagy) is characterized by the formation of double-membrane autophagosomes from an expanding cargo-enwrapping phagophore and the subsequent fusion of autophagosomes with lysosomes. Autophagy is induced by stresses like starvation and also provides cellular quality control under basal conditions2. Autophagy must be tightly controlled at each step of the process; autophagosome formation without proper turnover is linked to neurodegenerative disorders such as Alzheimer's disease3, defective as well as excessive autophagy is detrimental for muscle health4 and uncontrolled autophagy could potentially harm or even kill an otherwise healthy cell.Nucleation of a phagophore and biogenesis of a functional autophagosome is regulated by several multi-subunit complexes, including the ULK1 complex, the integral membrane protein mATG9 and its associated proteins, the class III phosphatidylinositol (PI) 3-kinase (PI3K) complex and two ubiquitin-like conjugation systems, resulting in the conjugation of ATG12 to ATG5 and ATG8/LC3 family members to phosphatidylethanolamine (PE)5. ATG5–ATG12 further associates with ATG16L1 and the resulting complex is recruited to endoplasmatic reticulum-associated PI(3)P-rich sites of phagophore nucleation (called omegasomes)6 by the PI(3)P-binding protein WIPI2 (ref. 7). Further expansion of the phagophore to generate an autophagosome requires input from several membrane sources, including the endoplasmatic reticulum8910, mitochondria911, plasma membrane12 and recycling endosomes13141516. Recycling endosome-derived membranes are positive for ATG9 and ATG16L1, and essential for autophagosome formation13141516.The autophagic pathway involves lipids as signalling molecules, constituents and cargo of autophagosomes. However, the role of different lipids in autophagy is not clear1718. PA was initially found to activate mammalian target of rapamycin (mTOR)19, a well-known inhibitor of autophagy, in a PLD1-specific manner20. Recent studies have also implicated PLD1-generated PA in autophagosome formation2122 and in autophagosome–lysosome fusion23. PI(3)P, the lipid product of the class III PI3K complex, has a central role in autophagy and several PI(3)P-binding proteins in autophagy have been identified1724, including the FYVE domain proteins DFCP1, a marker for omegasomes6, the scaffold protein ALFY that links cargo to the autophagic machinery for selective autophagy2526 and FYCO1, which is involved in trafficking of autophagosomes on microtubuli27. Furthermore, the WD-repeat protein WIPI2 also binds PI(3)P and is found at omegasomes28.Another group of phosphoinositide-binding proteins are the PX domain-containing proteins, but little is known about their involvement in autophagy. Here we show that the PX domain protein HS1BP3 negatively regulates autophagosome formation, PA levels and PLD activity. HS1BP3 binds PA through its PX domain, which leads to the recruitment of HS1BP3 to PLD1- and ATG16L1-positive autophagosome precursor membranes. We propose that HS1BP3, through its binding to PA and inhibition of PLD1 activity, provides a novel negative-feedback mechanism to ensure the proper regulation of autophagosome biogenesis.
Results
HS1BP3 is a negative regulator of autophagy
To identify PX domain proteins involved in autophagy, we recently performed an imaging-based short interfering RNA (siRNA) screen in HEK GFP-LC3 cells13 and one of the candidate proteins was HS1BP3. Using the individual siRNA oligos from the screen, we find that depletion of HS1BP3 results in increased amounts of GFP-LC3 spots (autophagosomes) both in complete (fed) and nutrient-deplete (starved) medium in correlation with knockdown levels (Fig. 1a–c). Depletion of HS1BP3 also increases the total intensity of endogenous LC3 spots in starved cells (Supplementary Fig. 1a).
Figure 1
HS1BP3 is a negative regulator of autophagy.
(a) HEK GFP-LC3 cells were transfected with four individual siRNA oligonucleotides against HS1BP3. 72 h post transfection the cells were starved or not for 2 h in EBSS, followed by fixation and fluorescence microscopy. Scale bar, 10 μm. (b) The number of GFP-LC3 spots per cell in a was quantified by high-content analysis (mean±s.d. from two independent experiments in triplicates, ∼50,000 cells analysed per condition). (c) Relative expression of HS1BP3 after siRNA knockdown was measured by quantitative PCR with reverse transcription (mean±s.d.). (d) HEK GFP-LC3 cells were transfected with the indicated siRNA oligos and starved or not for 2 h in EBSS in the presence or absence of BafA1. * Indicates an unspecific band in the HS1BP3 immunoblot. (e) The level of LC3-II/actin was quantified from immunoblots and normalized to siControl fed (mean±s.e.m., n=5). (f) HEK GFP-p62 cells were transfected with siRNA against HS1BP3 or ULK1. Expression of GFP-p62 was induced by addition of tetracycline (compare ON versus OFF) for 48 h before expression was shut off and the cells were incubated in EBSS (starved) for 2.5 h to induce autophagic degradation of GFP-p62. GFP-p62 intensity was monitored by flow cytometry and normalized to starved siControl (siCtrl; mean±s.e.m., n=4). (g) The degradation of long-lived proteins in HeLa cells transfected with control siRNA or siRNA against HS1BP3 was quantified as the release of 14C-valine after 4 h starvation in the absence or presence of 3-methyladenine (3MA) and normalized to the degradation in fed control cells (mean±s.e.m., n=3). *P<0.05, **P<0.01, ***P<0.001, by Student's t-test.
Since depletion of HS1BP3 increased the number of autophagosomes, we next investigated whether this is due to the increased formation or inhibited maturation and turnover of autophagosomes. To this end, cells were starved in the presence or absence of the lysosomal proton pump inhibitorBafilomycin A1 (BafA1; which inhibits autophagosome maturation and lysosomal degradation) and autophagic flux monitored by quantification of the level of PE-conjugated LC3 (LC3-II)29. We find that LC3-II levels are significantly increased in HS1BP3-depleted cells both in complete medium and after starvation (Fig. 1d,e), and increase further in the presence of BafA1, indicating that autophagosome formation is increased on HS1BP3 depletion. As expected, LC3lipidation is strongly inhibited in ULK1-depleted cells. We verified that LC3 messenger RNA (mRNA) levels are not significantly affected by HS1BP3 depletion (Supplementary Fig. 1b).To further determine if depletion of HS1BP3 activates autophagy, we studied the degradation of the cargo receptor protein p62 (also known as Sequestosome-1), which is itself an autophagy substrate3031. GFP-p62 expression was shut off in a stable cell line32 and the amount of GFP-p62 remaining after starvation was measured by flow cytometry. Whereas about half of the initial GFP-p62 is degraded in control cells, GFP-p62 strongly accumulates in ULK1-depleted cells, as well as in cells treated with BafA1 (Fig. 1f). Consistent with an increase in GFP-LC3 spots and LC3lipidation, GFP-p62 degradation increases by 20% in cells depleted of HS1BP3 (Fig. 1f), indicating increased autophagic flux. This was further confirmed by assessing the degradation of long-lived proteins, which preferentially happens through autophagy and is inhibited by the PI3K inhibitor3-methyladenine. As shown in Fig. 1g, the release of free 14C-valine from the degradation of previously radiolabelled long-lived proteins is increased in HS1BP3-depleted cells compared with control cells both in fed and starved conditions, further indicating that HS1BP3 is a negative regulator of autophagy.To analyse a possible role of HS1BP3 in regulation of autophagy in vivo, we employed transient silencing of Hs1bp3 in the zebrafish line Tg(CMV:EGFP-map1lc3b)33, using a translational-blocking morpholino targeting the start site of the Hs1bp3 mRNA. The overall homology betweenhuman and zebrafishHs1bp3 is 36%, with the PX domain being highly conserved (67% homology; Supplementary Fig. 1c). At 2 days post fertilization (dpf), abundant GFP-LC3 puncta are present in the trunk region of the morphant compared with the control embryos (Fig. 2a–d) and this difference is even more pronounced after chloroquine treatment, known to block autophagosome degradation in zebrafish3435. On injection of in vitro-transcribed-capped humanHs1bp3 mRNA alongside the Hs1bp3 morpholino, we observe a partial rescue of the phenotype at 2 dpf both with and without chloroquine treatment (Fig. 2a–d; Supplementary Fig. 1d). These results suggest that autophagy is significantly elevated in Hs1bp3 morphant zebrafish at 2 dpf and that Hs1bp3 also regulates autophagy in vivo.
Figure 2
HS1BP3 regulates autophagy in zebrafish.
(a) Representative confocal images of GFP-LC3 puncta (autophagosomes) in the trunk area of GFP-LC3 transgenic zebrafish embryos injected with control morpholino (C), Hs1bp3 translational-blocking morpholino (K), and the human Hs1bp3 mRNA coinjected with the morpholino (R) and imaged at 2 dpf with or without pre-treatment with chloroquine (10 μM) for 6 h. Scale bars, 10 μm. (b) GFP-LC3 puncta were counted in the trunk region (marked in d) of the transgenic zebrafish embryos at 2 dpf (mean±s.e.m., n=3). Total of 7–13 embryos were used for each condition per experiment. *P<0.05, **P<0.01, ***P<0.001, by Student's t-test. (c) Representative immunoblotting of Hs1bp3 and Tubulin in whole lysates of zebrafish embryos at 2 dpf, treated with or without chloroquine for 6 h before harvest. (d) Representative light fluorescent microscopy images of whole embryos at 2 dpf. Scale bars, 300 μm.
HS1BP3 interacts with cortactin
HS1BP3 was originally identified as an interaction partner of the actin cross-linking protein HS1 (ref. 36). HS1 is exclusively expressed in cells of hematopoietic lineage, whereas other cells express the homologous protein cortactin37. We therefore asked whether HS1BP3 also binds to cortactin and whether this interaction is involved in HS1BP3-mediated inhibition of autophagy. We find that endogenous cortactin co-immunoprecipitates with GFP-HS1BP3 (Supplementary Fig. 3a). The interaction is mediated by the SH3 domains of cortactin and HS1 (Supplementary Fig. 3b, lane 9 and 11), and is lost when a critical SH3 domain tryptophan is mutated to tyrosine (Supplementary Fig. 3b, lane 10 and 12). The HS1 and cortactin SH3 domains interact exclusively with the C-terminal part of HS1BP3 (HS1BP3-ΔPX, Supplementary Fig. 3c) containing four proline-rich regions (Fig. 4a). We can however not detect a role for cortactin in basal or starvation-induced autophagy (Supplementary Fig. 3d–e), indicating that binding of HS1BP3 to cortactin is not essential for its inhibitory function in autophagy.
Figure 3
HS1BP3 localizes to ATG16L1- and ATG9-positive vesicles.
HEK293 and U2OS cells expressing the indicated proteins were starved for 2 h before fixation and immunostaining with the indicated antibodies. Confocal micrographs show: (a) HEK cells expressing mCherry-HS1BP3 stained for endogenous ATG16L1 and WIPI2. Yellow arrows mark HS1BP3- and ATG16L1-positive structures. White arrow marks HS1BP3-, ATG16L1- and WIPI2-positive structure. (b) Co-localization of GFP-HS1BP3 with endogenous ATG9 and TfR (white arrows show triple co-localization) in U2OS cells. (c) Co-localization of endogenous HS1BP3 with endogenous ATG9 in HEK cells. (d) Control or HS1BP3-depleted U2OS cells expressing GFP-ATG16L1 stained for endogenous HS1BP3. Yellow arrows indicate ATG16L1-positive structures that are positive for HS1PB3, while white arrow heads indicate ATG16L1-positive structures that are not positive for HS1BP3. Note that in addition to the specific staining (co-localization with ATG16L1), the HS1BP3 antibody also recognizes other proteins non-specifically both on immunofluorescence and western blotting (Fig. 1d). (e) HEK cells expressing GFP-HS1BP3 stained for endogenous LC3. Scale bars, 10 μm.
Figure 4
HS1BP3 binds PA through its PX domain.
(a) Domain structure of HS1BP3: an N-terminal PX domain followed by an unstructured C terminus. The positions of five proline-rich regions (PRRs) are indicated. HS1BP3 truncations lacking the C-terminal (HS1BP3-PX) or the PX domain (HS1BP3-ΔPX) are shown. (b) Membranes spotted with the indicated lipids were incubated with 1 μg ml-1 of the indicated recombinant MBP-tagged proteins in a lipid protein overlay assay and bound proteins were detected with anti-MBP immunoblotting. (c,d) Liposomes with the indicated molar ratios of dioleyoyl-phosphatidic acid (DOPA) (c) or the indicated phosphoinositides (d) were incubated with GST or GST-tagged HS1BP3 protein constructs. Protein binding to liposomes was analysed by a lipid floatation assay. Representative coomassie-stained gels are shown and quantified from three independent experiments (mean±s.e.m.). Significance is calculated as compared with GST control. If significance is calculated as compared to GST-HS1BP3-ΔPX, then GST-HS1BP3-PX shows significantly increased binding to PI(3)P, PI(3,4)P2, PI(4,5)P2, PI(3,5)P2 and PI(3,4,5)P3. *P<0.05, **P<0.01, by Student's t-test.
HS1BP3 localizes to ATG9–ATG16L1-positive membranes
To identify the mechanisms underlying the role of HS1BP3 as a negative regulator of autophagy, the localization of HS1BP3 to autophagy-related membranes in HEK293 and U2OS cells was investigated. Cells were transfected with GFP- or mCherry-tagged HS1BP3 and their co-localization with WIPI2, ATG9, ATG16L1 or LC3 analysed by confocal imaging. While HS1BP3 is only occasionally detected on WIPI2-positive structures (Fig. 3a, white arrows), it co-localizes well with ATG9 and ATG16L1-positive membranes (Fig. 3a,b). Endogenous HS1BP3 also clearly co-localizes with endogenous ATG9 (Fig. 3c) and with GFP-ATG16L1-positive vesicles (Fig. 3d), and the co-localization is lost after HS1BP3 depletion (Fig. 3d, white arrowheads), demonstrating the specificity of the HS1BP3 antibody. In contrast, HS1BP3 does not show much co-localization with LC3-positive structures (Fig. 3e; Supplementary Fig. 2a) and does not interact with LC3 or GABARAP proteins (Supplementary Fig. 2b). Moreover, no co-localization of endogenous HS1BP3 with GFP-p62, -DFCP1 or -ATG14 is detected (Supplementary Fig. 2a).Trafficking of ATG16L1 and ATG9 through recycling endosomes is important for autophagosome biogenesis13141516. Using confocal and live cell imaging, we find that the HS1BP3-, ATG9- and ATG16L1-positive membranes contain transferrin and transferrin receptor (TfR; Fig. 3b; Supplementary Fig. 5c) and seem to fuse with LC3-positive structures (Supplementary Movies 1–3), indicating they are recycling endosome-derived membranes. Depletion of HS1BP3 does not cause any quantitative changes in the early phagophore/omegasome markers GFP-DFCP1, WIPI2 and ATG16L1. Neither the total intensity of GFP-DFCP1 spots (Supplementary Fig. 2c) nor the number of endogenous WIPI2 or ATG16L1 spots (Supplementary Fig. 2d–e) are affected by HS1BP3 depletion. Taken together, we find that HS1BP3 localizes to ATG9 and ATG16L1-positive recycling endosome-derived membranes that contribute membrane to the forming autophagosome at a stage after omegasome formation, indicating that HS1BP3 regulates autophagy downstream or in parallel of the initial phagophore nucleation step.
HS1BP3 binds PA and regulates cellular PA levels
To investigate a possible role for HS1BP3 in regulation of membrane trafficking and/or biogenesis at the expanding phagophore, we first set out to characterize the lipid-binding specificity of the HS1BP3 N-terminal PX domain (Fig. 4a). PX domain proteins are known to mainly bind PI3P, but also other phosphoinositide-binding preferences have been described3839. Using lipid-coated membrane strips, we find the HS1BP3 PX domain to bind strongly to PA, whereas full-length HS1BP3 binds PA, as well as monophosphorylated phosphoinositides (Fig. 4b; Supplementary Fig. 4a). The lipid specificities of purified HS1BP3 proteins (full length or PX domain) was further explored using liposome floatation experiments. We find that the binding of both HS1BP3 and the PX domain to PA increase with increasing concentrations of liposome PA (Fig. 4c).Using liposomes containing various phosphoinositide species, we could confirm that the PX domain of HS1BP3 also has increased affinity for PI(3)P, PI(3,4)P2 and PI(3,5)P2 as compared with the GST control (Fig. 4d). The full-length HS1BP3 protein also shows affinity for phosphoinositides and if compared with GST-HS1BP3-ΔPX it binds several of the same phosphoinositides as the PX domain alone, most notably PI(3)P and PI(3,5)P2 (Fig. 4d). The discrepancy between the data obtained using lipid strips and liposomes is most likely due to differences in the context that the lipids are presented, where the liposomes more closely resemble the context proteins bind to membranes in cells. We conclude that HS1BP3 binds to PA and several phosphoinositides and we speculate that HS1BP3 has phosphoinositide affinity in vivo for PI(3,5)P2 and PI(3)P. Interestingly, the HS1BP3 PX domain co-localizes with ATG16L1 (Supplementary Fig. 4b), suggesting that the lipid affinity of the PX domain contributes to its specific recruitment to ATG16L1-positive membranes.To get an unbiased quantification of a wide range of lipids in HS1BP3-depleted cells compared with control cells under starvation conditions, the total cellular lipid content was measured by lipidomics (Fig. 5a). Interestingly, whereas the quantities of several lipids are significantly altered (Fig. 5a; Supplementary Fig. 4c); the quantitatively biggest effect is on PA levels, as depletion of HS1BP3 causes a twofold increase in the total abundance of the lipid (Fig. 5a). In total, the levels of 9 out of 12 PA species are increased by HS1BP3 depletion (Fig. 5b). Interestingly, many of these PA species have been shown to be products of PLD activity4041.
Figure 5
Autophagy is dependent on PA synthesis and HS1BP3 affects PLD activity.
(a) HEK cells were treated with non-targeting or HS1BP3 siRNA and starved for 2 h. The total lipid content was extracted and analysed by mass spectrometry. Only lipid species that were present in all experimental runs were included. The measured lipid concentrations were first normalized to total lipid per sample to determine molar percentages for each lipid subclass and species, before normalizing to the average molar percentage of controls (mean±s.e.m., n=6). For a full list of all lipids with abbreviations, see Supplementary Table 1. The lipidomics data sets have been deposited in the Dryad Digital Repository (doi:10.5061/dryad.gq3fk). (b) The relative molar abundance of all 12 PA species is shown. (mean±s.e.m., n=6). (c) Schematic overview of the enzymes (blue) governing the generation and turnover of PA from other lipid species (black) and the drugs (red) used to inhibit these pathways. (d) Degradation of long-lived proteins in HEK cells was quantified as the release of 14C-valine after 4 h starvation in the presence of the indicated inhibitors (mean±s.e.m., n=3). (e) The relative difference in long-lived protein degradation between HEK cells with siCtrl and siHS1BP3 was measured for the indicated inhibitors (mean±s.e.m., n=3). (f) PLD activity was measured in HEK lysates of cells transfected with non-targeting or HS1BP3 siRNA (mean±s.e.m., n=3). *P<0.05, **P<0.01, by Student's t-test.
PA is a cone-shaped lipid that has been found to stimulate both autophagosome biogenesis2122 and autophagosome–lysosome fusion23. On the other hand, PA has been shown to activate mTOR signalling19, which inhibits autophagy. We therefore asked whether depletion of HS1BP3 might stimulate autophagy through changes in mTOR activity. Phosphorylation of the mTORC1 substrate S6 Kinase (pS6K) is however not affected by HS1BP3 depletion (Supplementary Fig. 4d), indicating that the increased PA levels seen on HS1BP3 depletion is not inducing autophagy through decreased mTORC1 signalling.
HS1BP3 regulates PA levels and autophagy through PLD1
Several metabolic pathways lead to PA formation (Fig. 5c)42. To first determine which of these contribute to increased autophagic flux, cells were treated with inhibitors specific for each pathway followed by quantification of autophagic degradation of long-lived proteins (Fig. 5d). We find that inhibitors of PLD activity (Cay10594, inhibits both PLD1 and PLD2) and lysophosphatidic acid acyltransferases (LPAATs; CI-976) inhibit autophagic flux, whereas an inhibitor of diacylglycerol kinase (R50922) has no significant effect (Fig. 5d). These observations taken together with the increased levels of PA and autophagy on HS1BP3 depletion suggested that HS1BP3 may be inhibiting autophagy as a negative regulator of one of these PA-generating pathways. We reasoned that if HS1BP3 depletion increased the activity of one of the pathways, then chemical inhibition of this pathway should abolish the increased autophagy seen in HS1BP3-depleted cells. Indeed, the relative inhibition of autophagy by the PLD inhibitorCay10594 is significantly larger in cells depleted of HS1BP3, compared with control cells and cells treated with inhibitors of LPAATs or diacylglycerol kinase (Fig. 5e), suggesting that HS1BP3 may regulate PA levels through PLDs. In line with this, we find that the total activity of PLD enzymes is increased in cell lysates of HS1BP3-depleted cells compared with control cells (Fig. 5f), in line with our data showing that HS1BP3 depletion leads to increased PA levels (Fig. 5a).To determine which of the PLD enzymes are contributing to the HS1BP3 phenotype, we analysed the localization of GFP-PLD1 and -PLD2 in relation to the autophagy markers LC3 and ATG16L1. GFP-PLD2 staining is concentrated at the plasma membrane with no co-localization with either ATG16L1 (Fig. 6a) or LC3 (Supplementary Fig. 5a). In contrast, GFP-PLD1 shows extensive co-localization with ATG16L1-positive puncta (Fig. 6a), and is often seen in close proximity to LC3-positive puncta (Supplementary Fig. 5a,c). The majority of the vesicles stained by GFP-PLD1 and ATG16L1 contain transferrin and TfR (Fig. 6b), and seem to fuse with Cherry-LC3B-positive structures (Supplementary Fig. 5c; Supplementary Movies 1 and 2), indicating that they are recycling endosome-derived vesicles destined for autophagosome biogenesis. HS1BP3 is also detected at the TfR- and PLD1-positive structures (Supplementary Fig. 5b). Because PLD1, and not PLD2, localize to ATG16L1-positive membranes (Fig. 6a), we conclude that the effect of HS1BP3 on PLD activity is most likely through the regulation of PLD1 on recycling endosomes or vesicles derived thereof.
Figure 6
PLD1 co-localization with ATG16L1 is affected by HS1BP3.
(a) HEK cells were transfected with GFP-tagged PLD1 or PLD2. After starvation and fixation the cells were immunostained for ATG16L1 and analysed by confocal microscopy. (b) HEK cells were transfected with GFP-PLD1, starved, fixed and immunostained for ATG16L1 and TfR. (c) HEK cells were first treated with non-targeting or HS1BP3 siRNA, then transfected to express GFP-PLD1, starved, fixed and immunostained for ATG16L1. Yellow arrows indicate ATG16L1 vesicles positive for PLD1 and white arrow heads indicate ATG16L1 vesicles negative for PLD1. Co-localization of GFP-PLD1 to ATG16L1 vesicles was quantified in transfected cells using the ImageJ plugin Squassh, using 10 pictures of each condition from three independent experiments (mean±s.e.m., n=3). (d) HEK cells were transfected with HA-PLD1 together with GFP, GFP-HS1BP3 full-length, -PX or ΔPX constructs, starved and stained for endogenous ATG16L1. Arrows indicate co-localization between ATG16L1 and HA-PLD1. (e) Co-localization of HA-PLD1 with endogenous ATG16L1 vesicles was quantified in transfected cells in d with the Zen software (Zeiss) using 10 pictures of each condition from three independent experiments (mean±s.e.m., n=3). Scale bars, 10 μm. *P<0.05, by Student's t-test.
To get some mechanistic insight into how HS1BP3 regulates PLD1 activity at the Atg16L1-positive membranes, we investigated the localization of PLD1 to ATG16L1-positive structures in the absence or presence of HS1BP3. Interestingly, there is a significant increase in the amount of ATG16L1-positive vesicles with GFP-PLD1 staining in HS1BP3-depleted cells compared with control cells (Fig. 6c), indicating that HS1BP3 may regulate PLD1's access to these vesicles.As both HS1BP3 and PLD1 have a PX domain with similar lipid-binding specificities (Fig. 4; ref. 43), we hypothesized that they might compete for binding to lipids in ATG16L1-positive membranes. In line with this notion, the co-localization between HA-PLD1 and endogenous ATG16L1 is significantly decreased in cells expressing the full length or PX domain of GFP-HS1BP3 compared with control cells expressing GFP only, but not in cells expressing HS1BP3 lacking the PX domain (GFP-HS1BP3 ΔPX; Fig. 6d,e).We further looked for protein–protein interactions between these proteins that could explain their apparent co-localization and functional relationship, but were unable to detect any interactions between over-expressed or endogenous PLD1, HS1BP3 and ATG16L1 under the conditions tested (Supplementary Fig. 6a). Taken together, our data indicate that HS1BP3 prevents access of PLD1 to ATG16L1-positive vesicles and we speculate that the two proteins compete for binding to lipids in the ATG16L1-positive membranes.To further map the functional relationship betweenHS1BP3 and PLD1 in regulation of autophagy, endogenous LC3 puncta were quantified in cells depleted of HS1BP3 and/or PLD1, and at the same time transfected with GFP, GFP-HS1BP3 or GFP-PLD1 (Fig. 7a). While depletion of HS1BP3 increases the number of LC3 spots and LC3-II levels (in line with data in Fig. 1), this effect is reversed in cells co-depleted of PLD1 (Fig. 7a; Supplementary Fig. 6b), indicating that the increase in autophagy seen with HS1BP3 depletion is dependent on PLD1, in line with our previous observation of the HS1BP3-mediated increase in autophagy being reverted by the use of PLD inhibitors (Fig. 5e). Moreover, overexpression of GFP-PLD1 causes a significant increase in the amount of LC3-positive spots (Fig. 7a), with no further increase on concurrent depletion of HS1BP3, further supporting that HS1BP3 and PLD1 are part of a common mechanism, where HS1BP3 acts on autophagy through regulation of PLD1.
Figure 7
HS1BP3 regulates autophagy through PLD1.
(a) HEK cells were first treated with the indicated siRNA and then transfected with the indicated GFP-tagged construct. Cells were starved and fixed before immunostaining for endogenous LC3. LC3 spots were counted only in transfected cells, minimum 200 transfected cells per condition in three independent experiments (mean±s.e.m., n=3). *P<0.05, by Student's t-test. (b) Model for the role of HS1BP3 in autophagy. PLD1 generates PA on ATG16L1-positive autophagosome precursor membranes. HS1BP3 is recruited to these membranes by the generated PA, inhibiting PLD1 activity and displacing it from the ATG16L1 vesicles. HS1BP3 thus provides a negative feedback on PA generation on these vesicles. If HS1BP3 is depleted from the cells, this negative feedback is lost, causing the PA concentrations of these membranes to increase and thereby drive increased autophagosome formation.
Taken together, our observation that HS1BP3 inhibits the localization of PLD1 to ATG16L1-positive vesicles suggests that the effect of HS1BP3 on autophagy is through the regulation of PLD1-generated PA on ATG16L1-positive autophagosome precursors (Fig. 7b). In light of the binding of HS1BP3 to PA, we propose a mechanism by which HS1BP3 regulates PLD1 by providing negative feedback on PA production through regulating the access of PLD1 to target membranes.
Discussion
Autophagosome formation must be properly regulated to balance the need to ensure cellular quality control and nutrient availability during starvation, with the necessity to prevent excessive autophagosome formation and detrimental degradation of crucial cellular components. We here identify the PX domain protein HS1BP3, as an inhibitor of the autophagosome formation and autophagic degradation through a negative-feedback mechanism, involving the regulation of PLD1 activity, and hence PA levels, in ATG16L1-positive membranes. Depletion of HS1BP3 affects both PLD activity in lysates and PLD1 localization to ATG16L1-positive vesicles, suggesting that HS1BP3 acts as a sensor and regulator of local PA levels. On its recruitment, HS1BP3 will inhibit PLD1 activity on ATG16L1-positive autophagosome precursors, thereby reducing their PA content and autophagosome formation (Fig. 7b).Many PX domains bind PI(3)P, but there are also other demonstrated lipid-binding specificities3839. We found that both the full-length protein and the PX domain of HS1BP3 bind to PA and phosphoinositides. PA binding by PX domains has previously been reported. A study of the PX domain of PLD1 demonstrated binding to PI(3,4,5)P3, PI(3)P, as well as other PI species and a moderate affinity for PA in a separate binding pocket on the PX domain43. Interestingly, the simultaneous binding of both sites was shown to increase the membrane affinity of the PX domain43. Similarly, the PX domain of the p47 subunit of NADPH oxidase was found to simultaneously bind PI(3,4)P2 and PA in separate binding pockets, increasing its membrane affinity44. Strikingly, we observed a competition betweenHS1BP3 and PLD1 for binding to ATG16L1-positive precursors. Having a similar lipid-binding specificity may be the basis of this competition betweenHS1BP3 and PLD1 for membrane binding, and this is something that will be interesting to explore further in future studies.We also found that the LPAAT pathway of PA generation contributes to autophagy, demonstrating that the involvement of PA in autophagy is not limited to PLD1. The exact mechanism(s) underlying the role of PA in stimulation of autophagosome biogenesis is not clear and might be related to its role as a second messenger, but could also be associated with PA having a direct structural role in membrane curvature and/or fusion due to the unique characteristics of PA in a lipid bilayer. PA is the only anionic phospholipid that induces negative membrane curvature due to its cone shape under physiological conditions45. Cone-shaped lipids such as PA also facilitate penetration of proteins into the membrane, since the lipid head groups are more loosely packed46, as shown to be important for insertion of ATG3 in the forming phagophore and subsequent lipidation of LC3/GABARAP47.Another relevant characteristic of PA is the demonstrated fusogenic properties of this lipid. PLD activity has been demonstrated as essential for various vesicle fusion events, such as sporulation in yeast48, mitochondrial fusion49 and exocytosis50. We speculate that the increased autophagy seen in HS1BP3-depleted cells might be facilitated by PA-mediated changes in the fusogenic properties of the ATG16L1-positive autophagosome precursors. Homotypic fusion of ATG16L1-positive vesicles has previously been found to facilitate their contribution to autophagosome formation and this was demonstrated to be dependent on the SNARE protein VAMP-7 (ref. 51). Intriguingly, VAMP-7 was recently described as an effector of PLD1 in neurite outgrowth52, suggesting a possible mechanism by which PLD1-generated PA could affect autophagy. HS1BP3 is detected on ATG16L1 vesicles that also contain ATG9 and TfR, suggesting they are of recycling endosome origin. We recently identified the PX-BAR protein SNX18 as a positive regulator of autophagosome biogenesis by tubulation of recycling endosome membrane for the delivery to phagophore nucleation sites13. The RAB11-binding protein TBC1D14 is another negative regulator of autophagy found to regulate the recycling endosome membrane remodelling15. It will be interesting to explore how these membrane-associated proteins regulate the recycling endosome dynamics and how potential qualitative changes in these vesicles affect autophagy through homotypic and possibly heterotypic fusion processes.In conclusion, we have identified HS1BP3 as a novel negative regulator of autophagy and cellular PA levels. We propose that PLD1 generates PA on ATG16L1-positive autophagosome precursor membranes and that HS1BP3 is recruited to these membranes by binding to PA (Fig. 7b). HS1BP3 affects the ability of PLD1 to generate PA, as well as regulating the access of PLD1 to ATG16L1-positive vesicles, changing the properties of these membranes and thereby providing a homoeostatic regulation of autophagy. HS1BP3 thus functions as a negative-feedback mediator of PA levels to regulate autophagosome formation.
Methods
Cell lines and inhibitors
HeLa, HEK and U2OS cells were from American Type Culture Collection and were maintained in Dulbecco's modified Eagle's medium (Gibco) supplemented with 10% fetal bovine serum (FBS), 5 U ml−1 penicillin and 50 μg ml−1 streptomycin. The HEK 293A GFP-LC3 cell line53 was a kind gift from S. Tooze, Cancer Research UK, London, UK. The HEK GFP-DFCP1 cell line6 was a kind gift from N. Ktistakis, Babraham Institute, Cambridge, UK. The HEK GFP-p62 cell line was a kind gift from G. Bjørkøy, HiST, Trondheim, Norway. All cell lines have been tested negative for mycoplasma. Bafilomycin A1 (Enzo Lifesciences) was used at 100 nM. CI 976 (Tocris Bioscience), Cay10594 (Cayman Chemical) and R59022 (Tocris Bioscience) were used at 20 μM. Glass support was coated by 20 μg ml−1 fibronectin (Sigma) before plating HEK cell lines to avoid the cells from detaching from the surface. For starvation in nutrient-deplete medium, the cells were incubated in Earls Balanced Salt Solution (EBSS; Invitrogen), with the exception of the HEK GFP-DFCP1 cells that were starved as described previously6 in 140 mM NaCl, 1 mM CaCl2, 1 mM MgCl2, 5 mM glucose and 20 mM Hepes, pH 7.4.
Antibodies and dyes
The following primary antibodies were used: mouse anti-cortactin (Upstate, 05-180, 1:1,000), mouse anti-GFP (Clontech, 632381, 1:1,000), mouse anti-Flag (Sigma, F1804, 1:500), mouse anti-MBP (NEB, e8032S, 1:10,000), rabbit anti-ULK1 (Santa Cruz, sc-33182, 1:250), rabbit anti-HS1BP3 (GeneTex, GTX107715, 1:10,000 for WB and 1:500 for IF), rabbit anti-LC3 (Cell Signaling, 27755, 1:1,000 for WB), mouse anti-β-actin (Sigma, SAB1305567 1:20,000), mouse anti-myc (DSHB, 9E10, 1:20), mouse anti-alpha tubulin (Sigma, T5168, 1:20,000), rabbit anti-LC3 (MBL, PM036, 1:500 for IF), mouse anti-p62 (BD biosciences, 610833, 1:1,000 for WB), goathorseradishperoxidase (HRP)-conjugated anti-GST (Abcam, ab58626, 1:10,000 for phosphatidylinositol phosphate (PIP) strips), rabbit anti-phospho-AKT Ser473 (Cell Signaling, 4060, 1:2,000), rabbit anti-phospho-p70-S6K Thr389 (Cell Signaling, 9202, 1:1,000), rabbit anti-p70-S6K (Cell Signaling, 9205, 1:1,000), rabbit anti-ATG16L1 (MBL, PM040, 1:200), mouse anti-TfR CD71 (Santa Cruz, sc-65877, 1:200), mouse anti-WIPI2 (kind gift from Sharon Tooze, 1:2,000), rabbit anti-PLD1 (Cell Signaling, 3832S, 1:200), mouse anti-HA (Abcam, ab18181, 1:200), hamster anti-mAtg9 (kind gift from Sharon Tooze, 1:1,000). HRP- and Cy2/3/5-conjugated secondary antibodies were obtained from Jackson Immunolabs. Far-red fluorophore-conjugated secondary antibodies were from LI-COR. Transferrin–Alexa 647 was from Invitrogen.
Transfection of siRNA oligonucleotides and western blotting
siRNA oligonucleotides were Dharmacon ON-TARGET plus; HS1BP3-1J-013029-09 AAGAAGGAGUGACCGGUAU, HS1BP3-2J-013029-10 UGAAGAGGCUUUCGACUUU, HS1BP3-3J-013029-11 GAGCCUGAAGGGCGAGGAU, HS1BP3-4J-013029-12 UCCCAAAGUGGCCGUGAAA, ULK1 J-005049-06 CCACGCAGGUGCAGAACUA, cortactin CCCAGAAAGACUAUGUGAAAGGG54 and PLD1 SmartPool consisting of four oligonucleotides pooled together. An amount of 20–100 nM siRNA was delivered to the cells by Lipofectamine RNAi max (Invitrogen). To demonstrate specific protein knockdown and monitorLC3 levels, the cells were lysed in 25 mM Hepes pH 7.5, 125 mM K-acetate, 2.5 mM Mg-acetate, 5 mM EGTA, 1 mM DTT and 0.5% NP-40 supplemented with Complete protease inhibitor (Roche). Protein concentration was measured by Biorad Protein Assay to run equal amounts of cell lysate on SDS–polyacrylamide gel electrophoresis (PAGE), followed by western blotting using specified primary antibodies and secondary antibodies for enhanced chemiluminescent (ECL) detection or far-red fluorescence. For ECL detection: membranes were incubated with HRP-conjugated secondary antibodies detected by the Supersignal West Dura Extended Duration Substrate kit (Pierce). Imaging and quantification of protein levels were performed using the Syngene gel documentation unit, Genesnap acquisition software and GeneTools analysis software. For far-red fluorophores: membranes were incubated with far-red fluorophore-conjugated secondary antibodies, and detection and analysis was performed by LI-COR Odyssey imaging. Uncropped scans of western blots are found in Supplementary Fig. 7.
Plasmids and transfection for ectopic expression
HS1BP3 complementary DNA (cDNA) was amplified by PCR using primers 5′-ATAGTCGACATGCAGTCCCCGGCGGTGCTC-3′ and 5′-ATAGCGGCCGCTCAGAAGAGACTGGGGGCGG-3′ from a cDNA library made by reverse transcription (Biorad iScript) from mRNA isolated from HEK cells, TA cloned into pCR2.1-TOPO (Invitrogen) and subcloned into pENTR1A (Invitrogen) using SalI and NotI restriction sites. From there, sequences coding for HS1BP3-PX and HS1BP3-ΔPX were amplified by PCR using primers 5′-ATAGTCGACATGCAGTCCCCGGCGGTGCTC-3′and 5′-ATAGCGGCCGCTCAGGATCTGGTACCTAAGAACTC-3′ or 5′-ATAGTCGACGCTGCAGGGCTCACCAGCAG-3′ and 5′-ATAGCGGCCGCTCAGAAGAGACTGGGGGCGG-3′, respectively, and cloned into pENTR1A (Invitrogen). Tagged variants were made by Gateway LR cloning (Invitrogen) into respective pDEST vectors (Invitrogen). See Supplementary Table 2 for a full list of plasmids used in this study. To transfect cells with plasmids encoding GFP- or mCherry-tagged HS1BP3 variants, the plasmids were delivered to the cells by forward transfection with FuGene (Roche) or Lipofectamine 2000 (Invitrogen) before further treatment as described.
Microscopy
siRNA-treated HEK GFP-LC3 cells grown on glass support, were starved or not for 2 h, pre-permeabilized on ice with 0.05% saponin in 80 mM K-Pipes pH 6.8, 5 mM EGTA and 1 mM MgCl2 before fixation in 3% paraformaldehyde (PFA) or fixed directly in methanol for 10 min at −20 °C. The nuclei were counterstained with 1 μg ml−1 Hoechst in phosphate-buffered saline or mowiol. The number of GFP-LC3 spots was quantified using the automated Olympus ScanR microscope equipped with a ULSAPO 40 × objective and the corresponding analysis program or by an automated Zeiss CellObserver equipped with a 40 × EC Plan Neofluar objective, and using the physiology module of the Zeiss Assaybuilder software. For immunostaining and confocal analysis, cells were grown on glass cover slips and after the described treatments, fixed in 3% PFA for 15 min on ice or in methanol for 10 min at −20 °C and mounted in mowiol containing 1 μg ml−1 Hoechst or 4,6-diamidino-2-phenylindole to stain the nuclei. Confocal images were taken on an Olympus confocal microscope equipped with a UPlanSApo 60 × objective. Co-localization of stainings of interest from confocal images was quantified using the ImageJ-based Squassh plugin55. The plugin subtracts background, segments the image into vesicles in each channel and co-localization is quantified as degree of signal intensity overlap in the segmented regions. Cell mask thresholding was used to include vesicles only in transfected cells.For live cell imaging, HEK293A cells were plated in complete media in wells of Lab-Tek II chambered coverglass (2 × 104 cells per well), precoated with poly-D-lysine and transfected with indicated constructs. Complete media was removed 24 h after transfection, cells were washed 2 × in phosphate-buffered saline, then starved for 1 h in EBSS containing 5 μg ml−1 of transferrin–Alexa Fluor 647 conjugate and imaged live with Zeiss LSM710 confocal microscope (63 × 1.4 plan-apochromat objective, single plane).
Quantitative PCR
siRNA-transfected cells were frozen dry at −80 °C, RNA isolated by RNeasy plus kit (Qiagen), cDNA synthesized by reverse transcription (Biorad iScript) and quantitative real-time PCR performed using SYBRGreen (Qiagen), and pre-designed Quantitect (Qiagen) primer sets for the described targets relative to SDHA or TBP as housekeeping genes on a Lightcycler 480 (Roche Applied Science) or on a CFX96 (Bio-Rad).
GFP-p62 measured by flow cytometry
The GFP-p62 flow cytometry assay was described previously32. Briefly, HEK GFP-p62 cells in 24-well plates were transfected with siRNA and 24 h later induced with 1 ng ml−1 doxicyclin to express GFP-p62 for 48 h. GFP-p62 expression was shut off and the cells were starved in EBSS for 2.5 h or treated as indicated. The cells were then trypsinized and passed through cell strainer caps (BD Biosciences) to obtain single-cell suspensions. Cells were analysed on a FACSAria cell sorter running FACSDiva software version 5.0 (BD Biosciences) using the blue laser for excitation of GFP. GFP fluorescence was collected through a 530/30 nm band-pass filter in the E detector. Data were collected from a minimum of 10,000 singlet events per tube, and the median GFP-p62 value was used for quantification.
Long-lived protein degradation
To measure the degradation of long-lived proteins by autophagy, proteins were first labelled with 0.25 μCi ml−1 L-14C-valine (Perkin Elmer) for 24 h in GIBCO-RPMI 1640 medium (Invitrogen) containing 10% FBS. The cells were washed and then chased for 3 h in nonradioactive Dulbecco's modified Eagle's medium (Invitrogen) containing 10% FBS and 10 mM valine (Sigma), to allow degradation of short-lived proteins. The cells were washed twice with EBSS (Invitrogen), and starved or not for 4 h in the presence or absence of 10 mM 3-methyladenine (Sigma). 10% Trichloroacetic acid was added to the cells before incubation at 4 °C to precipitate radioactive proteins. Ultima Gold LSC cocktail (Perkin Elmer) was added to the samples and protein degradation was determined by measuring the ratio of trichloroacetic acid-soluble radioactivity relative to the total radioactivity detected by a liquid scintillation analyser (Tri-Carb 3100TR, Perkin Elmer), counting 3 min per sample.
In vitro interaction pull-down assays and immunoprecipitation
Recombinant GST- or MBP-tagged proteins were expressed and purified from Escherichia coli. 1 μg of proteins of interest were incubated together in NETN buffer (50 mM Tris pH 8, 100 mM NaCl, 6 mM EDTA, 6 mM EGTA, 0.5% NP-40, 1 mM DTT, Roche Complete protease inhibitor) followed by GST pulldown by glutathionesepharose (GE Healthcare). For GST pulldown from cell lysate, cells were lysed in 10 mM TrisHCl pH 7.5, 150 mM NaCl, 0,5 mM EDTA, 0,5% NP-40, protease inhibitor (Roche) and phosphatase inhibitor (Sigma), and the cell lysate incubated with recombinant glutathionesepharose-bound GST proteins. The resulting pulldowns were analysed by immunoblotting. For in vitro translation, indicated GFP fusion proteins were in vitro translated in TNT T7-coupled reticulocyte lysate (Promega L4610) in the presence of 35S-methionine (PerkinElmer) and precleared on glutathione–sepharose before incubation in NETN buffer together with glutathione–sepharose-bound recombinant GST-tagged LC3B or GABARAP proteins expressed in and purified from E. coli according to manufacturer's instructions. The resulting pulldowns were separated by SDS–PAGE. The gels were Coomassie blue stained and the in vitro-translated co-purified proteins were detected by autoradiography on a Typhoon phosphorimaging scanner (GE Healthcare). For immunoprecipitation from lysates, GFP, GFP-HS1BP3 or GFP-PLD1 were immunoprecipitated by GFP trap (Chromotek) following the manufacturer's protocol. The resulting immunoprecipitates or pulldowns were separated by SDS–PAGE and analysed by western blotting.
Lipid-binding assays
PIP strips or membrane lipid strips (Echelon biosciences) were blocked in 3% fatty acid-free bovine serum albumin (Sigma) in TBS-T (50 mM Tris pH 7.4, 150 mM NaCl, 0.1% Tween) before incubation with 1 μg ml−1 recombinant MBP proteins in TBS-T. After repeated washing in TBS-T, bound protein was immunodetected with chemiluminescence. Liposomes were prepared by mixing different molar ratios of palmitoyl-oleyl-phosphatidylcholine, dioleyoyl-phosphatidic acid, dioleyoyl-PE–rhodamine and the PIPs in chloroform and drying the lipids to a thin film. Lipids were reconstituted in a buffer containing 20 mM Hepes, pH 7.4, 150 mM NaCl and 1 mM MgCl2 and exposed to seven cycles of flash-freezing in liquid nitrogen and thawing in a 37 °C water bath, before extruding the lipid mixtures through two polycarbonate filters with 200 nm pores a total of 21 times. Lipid binding to liposomes was analysed by a floatation assay, where 5 μM of GST-tagged protein was incubated with 2 mM total lipid and 1 mM DTT in a buffer composed of 20 mM Hepes pH 7.4, 150 mM NaCl and 1 mM MgCl2 for 20 min at 25 °C. To separate liposomes and bound protein from free protein, this mixture was subjected to a Nycodenz liposome flotation assay as described in ref. 47. Gradients were centrifuged at 48,000 r.p.m. (280,000g) in a SW55Ti rotor (Beckman) for 4 h at 4 °C, and the liposomes and bound protein were recovered from the top 80 μl of the gradient. The lipid recovery from the gradient was determined by measuring dioleyoyl-PE–rhodamine fluorescence using a SpectraMax fluorescence spectrometer. Floatation reactions were analysed on a 12% bis-Tris gel (Novex) by SDS–PAGE, where 10% of the total lipid from each floatation reaction was run together with a protein control containing 0.5% of the total protein. The proteins were visualized with Coomassie Blue stain per the manufacturer's instruction (Imperial Protein Stain, Thermo Scientific).
Lipid extracts were prepared from total cell lysates (after 2 h starvation) using a modified Bligh/Dyer extraction procedure as previously described56. Samples were analysed using an Agilent Technologies 6490 Ion Funnel LC/MS Triple Quadrupole system with front end 1260 Infinity HPLC. Phospholipids and sphingolipids were separated by normal-phase high-performance liquid chromatography (HPLC), while neutral lipids were separated using reverse-phase HPLC. For normal-phase analysis, lipids were separated on an Agilent Rx-Sil column (i.d. 2.1 × 100 mm) using a gradient consisting of A: chloroform/methanol/ammonium hydroxide (89.9:10:0.1) and B: chloroform/methanol/water/ammonium hydroxide (55:39:5.9:0.1), starting at 5% B and ramping to 70% B over a 20 min period before returning back to 5% B. Neutral lipids were separated on an Agilent Zorbax XDB-C18 column (i.d. 4.6 × 100 mm), using an isocratic mobile phase chloroform:methanol:0.1 M ammonium acetate (100:100:4) at a flow rate of 300 μl min−1. Multiple reaction monitoring transitions were set up for quantitative analysis of different lipid species and their corresponding internal standards as described previously56. Lipid levels for each sample were calculated relative to the spiked internal standards and then normalized to the total amount of all lipid species measured and presented as relative mol %. Data are presented as mean mol % for three samples of each condition.
PLD activity assay
PLD activity was measured using the Amplex Red Phospholipase D Assay Kit (Invitrogen) according to the manufacturer's instructions. Cell lysates were made of six-well plates using the assay reaction buffer with 1% Triton X-100. For each replicate, 20 μg of lysate was diluted to 50 μl of lysis buffer and added to 50 μl of reaction mixture. Four technical replicates per sample were distributed in a black half-area 96-well plate (Corning). The plate was covered and the reaction proceeded for 30 min at 37 °C before fluorescence was measured.
Zebrafish work
Experimental procedures followed the recommendations of the Norwegian Regulation on Animal Experimentation. All experiments were conducted on GFP-LC3 transgenic larvae57 under 5 dpf. Translation-blocking antisense morpholino oligonucleotides for Hs1bp3 (5′-TTcTaATACcTCCcTCTcACATTGT-3′) or a scrambled-sequence morpholino (5′-TTGTTATACGTCCGTCTGACATTGT-3′) were designed according to the manufacturer's recommendations (Gene Tools, Philomath, OR, USA) and 16.86 ng of either was injected into embryos at the one-cell stage. Capped full-length human wild-typeHs1bp3 mRNA was transcribed from linearized pSP64 Poly (A) Vector (Promega; Supplementary Table 2) using mMessage mMachine (Ambion) and 50–150 pg was coinjected with the Hs1bp3 morpholino as described58. Microscopic visualization, screening and imaging of the fish were performed on a stereomicroscope Leica DFC365FX with a 1.0 × planapo lens. Control morpholino, Hs1bp3 morpholino and humanHs1bp3 mRNA injected live embryos were anaesthetized with tricaine at 2 dpf and mounted in low-melting point agarose for imaging with Olympus FV1000 scanning confocal microscope (under a 60 × /1.00 numerical aperture water immersion objective). Injected embryos were treated or not with 10 μM chloroquine at 28 °C for 6 h and then followed by immunoblot analysis and imaging. Embryos at 2 dpf were deyolked and then homogenized in lysis buffer (50 mM Tris-HCl (pH 8), 150 mM NaCl, 5 mM EDTA, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, protease inhibitor cocktail (Roche)). All experiments were replicated at least three times with 7–13 embryos per condition. Embryos were randomly distributed to receive the described treatments. No blinding was used and no animals were excluded from the analysis.
Statistics
The P values were derived from two-tailed t-test from Excel (Microsoft) for paired samples, and considered statistically significant at P≤0.05. In some cases, values were log-transformed to obtain a normal distribution.
Data availability
The lipidomics datasets have been deposited in the Dryad Digital Respository (DOI: doi:10.5061/dryad.gq3fk).
Additional information
How to cite this article: Holland, P. et al. HS1BP3 negatively regulates autophagy by modulation of phosphatidic acid levels. Nat. Commun.
7, 13889 doi: 10.1038/ncomms13889 (2016).Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Authors: Claudia Dall'Armi; Andrés Hurtado-Lorenzo; Huasong Tian; Etienne Morel; Akiko Nezu; Robin B Chan; W Haung Yu; Kimberly S Robinson; Oladapo Yeku; Scott A Small; Karen Duff; Michael A Frohman; Markus R Wenk; Akitsugu Yamamoto; Gilbert Di Paolo Journal: Nat Commun Date: 2010 Impact factor: 14.919
Authors: Agnes G S H van Rossum; Ellen Schuuring-Scholtes; Vera van Buuren-van Seggelen; Philip M Kluin; Ed Schuuring Journal: BMC Genomics Date: 2005-02-14 Impact factor: 3.969
Authors: Hannah C Dooley; Minoo Razi; Hannah E J Polson; Stephen E Girardin; Michael I Wilson; Sharon A Tooze Journal: Mol Cell Date: 2014-06-19 Impact factor: 17.970
Authors: Agnieszka H Ludwig-Słomczyńska; Michał T Seweryn; Przemysław Kapusta; Ewelina Pitera; Samuel K Handelman; Urszula Mantaj; Katarzyna Cyganek; Paweł Gutaj; Łucja Dobrucka; Ewa Wender-Ożegowska; Maciej T Małecki; Paweł P Wołkow Journal: BMC Med Genomics Date: 2020-07-07 Impact factor: 3.063
Authors: Dale Bryant; Yang Liu; Sanchari Datta; Hanaa Hariri; Marian Seda; Glenn Anderson; Emma Peskett; Charalambos Demetriou; Sergio Sousa; Dagan Jenkins; Peter Clayton; Maria Bitner-Glindzicz; Gudrun E Moore; W Mike Henne; Philip Stanier Journal: Hum Mol Genet Date: 2018-06-01 Impact factor: 6.150
Authors: Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong Journal: Autophagy Date: 2021-02-08 Impact factor: 13.391