| Literature DB >> 28004788 |
Kuan Sun1, Yi Ye1, Tao Luo2, Yiping Hou1.
Abstract
Ancestry inference is of great interest in diverse areas of scientific researches, including the forensic biology, medical genetics and anthropology. Various methods have been published for distinguishing populations. However, few reports refer to sub-populations (like ethnic groups) within Asian populations for the limitation of markers. Several InDel loci located very tightly in physical positions were treated as one marker by us, which is multi-InDel. The multi-InDel shows potential as Ancestry Inference Marker (AIM). In this study, we performed a genome-wide scan for multi-InDels as AIM. After examining the FST distributions in the 1000 Genomes Database, 12 candidates were selected and validated for eastern Asian populations. A multiplexed assay was developed as a panel to genotype 12 multi-InDel markers simultaneously. Ancestry component analysis with STRUCTURE and principal component analysis (PCA) were employed to estimate its capability for ancestry inference. Furthermore, ancestry assignments of trial individuals were conducted. It proved to be very effective when 210 samples from Han and Tibetan individuals in China were tested. The panel consisting of multi-InDel markers exhibited considerable potency in ancestry inference, and was suggested to be applied in forensic practices and genetic population studies.Entities:
Mesh:
Year: 2016 PMID: 28004788 PMCID: PMC5177877 DOI: 10.1038/srep39797
Source DB: PubMed Journal: Sci Rep ISSN: 2045-2322 Impact factor: 4.379
General Information of the 12 Multi-InDels Chosen for the Test.
| ID | Loci | Chromosome | Position | Allele |
|---|---|---|---|---|
| 5 | rs568000255 | 12 | 111390389 | -/T |
| rs148177611 | 111390454 | AGAA/- | ||
| 7 | rs587641570 | 14 | 106091681 | -/TGGGCACGG |
| rs35171885 | 106091743 | A/- | ||
| 9 | rs587619205 | 14 | 106132379 | AGG/- |
| rs72033070 | 106132423 | TG/- | ||
| rs587723906 | 106132479 | AGG/- | ||
| 13 | rs576201582 | 14 | 106267547 | AA/- |
| rs571755931 | 106267673 | -/GAACCACGGACAGC | ||
| 17 | rs367879758 | 6 | 29893482 | T/- |
| rs145760005 | 29893549 | AAAC/- | ||
| 24 | rs9281938 | 6 | 32576282 | -/A |
| rs66715534 | 32576384 | AAG/- | ||
| 29 | rs71848820 | 6 | 29906220 | TACC/- |
| rs535382238 | 29906247 | -/AC | ||
| rs372209280 | 29906267 | AA/- | ||
| rs551483768 | 29906274 | AATT/- | ||
| rs113403777 | 29906356 | AT/- | ||
| 30 | rs113251661 | 6 | 29920335 | -/T |
| rs28993377 | 29920400 | CT/- | ||
| rs139015681 | 29920487 | AAAG/- | ||
| 31 | rs535742949 | 6 | 29921529 | -/G |
| rs111867975 | 29921542 | C/- | ||
| rs139686584 | 29921679 | GAA/- | ||
| 38 | rs573698459 | 11 | 101349079 | T/- |
| rs113869189 | 101349205 | -/TTCCCCTCCTCTTG | ||
| rs572328951 | 101349248 | AAAT/- | ||
| 46 | rs58621233 | 14 | 106175037 | -/ATGCCATG |
| rs59809572 | 106175040 | -/CCAGGAGGACAG | ||
| rs587739978 | 106175045 | -/G | ||
| 52 | rs9279904 | 6 | 32608168 | AT/- |
| rs139765606 | 32608178 | A/- | ||
| rs146682150 | 32608282 | -/A | ||
| rs531139227 | 32608334 | AAA/- | ||
| rs140779686 | 32608357 | -/A | ||
| rs148817405 | 32608392 | -/T | ||
| rs67106675 | 32608459 | A/- |
Figure 1Haplotype frequency distributions of Multi-Indel No.5 in Han and Tibetan populations in China.
Blue bars denote allele122, red and green bars alleles 126 and 127, respectively.
Primer Information of the 12 Multi-InDels Multiplex.
| ID | Loci | Allele | Primer-F | Tm-F | Primer-R | Tm-R | Amplicon Size | Primer Concentration (μM) |
|---|---|---|---|---|---|---|---|---|
| 5 | rs568000255 | -/T | TCTGATCAAAGATCCCAGA-HEX | 62.9 | GTGTTAGTTCTCCAACTTTATTAT | 59.7 | 128 | 5 |
| rs148177611 | AGAA/- | |||||||
| 7 | rs587641570 | -/TGGGCACGG | TGGATGCAGGCTACTCTA | 61.6 | CTCCCTCAGCTCAGACAC-HEX | 63.1 | 176 | 0.8 |
| rs35171885 | A/- | |||||||
| 9 | rs587619205 | AGG/- | AGTGTCAGGGACAGGAGG | 64.9 | CTACACTGTCTTCTCGTCTCC-HEX | 63.1 | 147 | 0.8 |
| rs72033070 | TG/- | |||||||
| rs587723906 | AGG/- | |||||||
| 13 | rs576201582 | AA/- | ATAGAGAGGCGCTGGGTAT | 65.4 | CACTGTTCCACATTTGTCTT-HEX | 62.4 | 251 | 4 |
| rs571755931 | -/GAACCACGGACAGC | |||||||
| 17 | rs367879758 | T/- | TATGTATCAAGGGGCCAAAG | 66.5 | TGGAGGCGTAGAGACAGG-HEX | 66.4 | 192 | 8 |
| rs145760005 | AAAC/- | |||||||
| 24 | rs9281938 | -/A | TGAAAAGAAAATTGCTGTAATG-TAMRA | 63.8 | TCTTTTCCATCATTGTCC | 60.4 | 160 | 6 |
| rs66715534 | AAG/- | |||||||
| 29 | rs71848820 | TACC/ | AGGTGCAGCAAACCAAC-FAM | 64.5 | CACCTCTAGAAAGGAACAGTATC | 62.9 | 228 | 1.5 |
| rs535382238 | -/AC | |||||||
| rs372209280 | AA/- | |||||||
| rs551483768 | AATT/- | |||||||
| rs113403777 | AT/- | |||||||
| 30 | rs113251661 | -/T | CGTGTTCCTAGATTGGAGTTAA | 65 | CGTATAATAATGCCTTTACAATCA-FAM | 64.2 | 247 | 3 |
| rs28993377 | CT/- | |||||||
| rs139015681 | AAAG/- | |||||||
| rs535742949 | -/G | |||||||
| 31 | rs111867975 | C/- | GGTGACAGGGTGAGACTCT | 63.9 | ATATCCCACGTGGCTGT-ROX | 63.5 | 250 | 4 |
| rs139686584 | GAA/- | |||||||
| rs573698459 | T/- | |||||||
| 38 | rs113869189 | -/TTCCCCTCCTCTTG | GGGATCAAATTTGTAACAG | 59.3 | ATCATTTGTGCCAAGAATT-TAMRA | 61.9 | 244 | 8 |
| rs572328951 | AAAT/- | |||||||
| rs58621233 | -/ATGCCATG | |||||||
| 46 | rs59809572 | -/CCAGGAGGACAG | GATGCTGGAACACAGAATG | 63.9 | GCTGGGTTCCTCCAGTAT-FAM | 63.9 | 101 | 1 |
| rs587739978 | -/G | |||||||
| rs9279904 | AT/- | |||||||
| rs139765606 | A/- | |||||||
| rs146682150 | -/A | |||||||
| 52 | rs531139227 | AAA/- | GGAAAGATACGATGGTAAAAG | 62.1 | AGTTTTTGGATTTCTGTCAT-HEX | 60.2 | 239 | 4 |
| rs140779686 | -/A | |||||||
| rs148817405 | -/T | |||||||
| rs67106675 | A/- |
Figure 2Ancestry component analysis result for 210 Chinese samples from Han and Tibetan individuals with the 12 selected multi-InDel markers.
(a) Bar plot of STRUCTURE runs for K = 2–4. Chinese samples from Tibetan and Han individuals are marked by Arabic numerals 1 and 2, respectively. The bars with different colors represent different ancestry origins from the analyses. Structure Harvester estimated the optimum K value to be K = 2 (marked by blue arrows in the Ln estimated probabilities plots). (b) Triangle plot of STRUCTURE runs for K = 2. (c). 2-dimensional plot of PCA analysis. The first two principal components (PC1 vs. PC2) demonstrate the population stratification in the tested samples. PC1 is represented by the X axis, and PC2 is represented by the Y axis.