Literature DB >> 28003763

Isoorientin induces apoptosis, decreases invasiveness, and downregulates VEGF secretion by activating AMPK signaling in pancreatic cancer cells.

Tingting Ye1, Jiadong Su1, Chaohao Huang1, Dinglai Yu1, Shengjie Dai1, Xince Huang1, Bicheng Chen2, Mengtao Zhou1.   

Abstract

Isoorientin (or homoorientin) is a flavone, which is a chemical flavonoid-like compound, and a 6-C-glucoside of luteolin. Isoorientin has been demonstrated to have anti-cancer activities against various tumors, but its effects on pancreatic cancer (PC) have not been studied in detail. In this study, we aim to investigate whether isoorientin has potential anti-PC effects and its underlying mechanism. In PC, isoorientin strongly inhibited the survival of the cells, induced cell apoptosis, and decreased its malignancy by reversing the expression of epithelial-mesenchymal transition and matrix metalloproteinase and decreased vascular endothelial growth factor expression. Meanwhile, we investigated the activity of the AMP-activated protein kinase (AMPK) signaling pathway after isoorientin treatment, which was forcefully activated by isoorientin, as expected. In addition, in the PC cells that were transfected with lentivirus to interfere with the expression of the gene PRKAA1, there were no differences in the apoptosis rate and the expression of malignancy biomarkers in the tumors of the isoorientin-treated and untreated groups. Thus, we demonstrated that isoorientin has potential antitumor effects via the AMPK signaling pathway, and isoorientin merits further investigation.

Entities:  

Keywords:  AMPK; VEGF; apoptosis; invasiveness; isoorientin; pancreatic cancer

Year:  2016        PMID: 28003763      PMCID: PMC5161403          DOI: 10.2147/OTT.S122653

Source DB:  PubMed          Journal:  Onco Targets Ther        ISSN: 1178-6930            Impact factor:   4.147


Introduction

Pancreatic cancer (PC) is one of the most common malignancies of the digestive system worldwide, and its incidence has increased over the last several decades. It is the fourth leading cause of death by cancer in the world, and its 5-year relative survival is currently 8%.1,2 The high mortality rate is caused by its aggressive biological properties, late symptom onset, and lack of specific treatments.3,4 Therefore, it is necessary to learn more about PC at the molecular level and identify a new potential therapeutic target for anticancer drugs. In recent years, with the universal upsurge in the study of anticancer drugs, herbal medicine has generated much attention. A significant number of studies have indicated that many herbal medicines that have antitumor effects can be separated into several compounds, including isoorientin.5–7 Isoorientin (or homoorientin) is a flavone, which is a chemical flavonoid-like compound, and a 6-C-glucoside of luteolin. Bioassay-directed fractionation techniques led to the isolation of isoorientin as the main hypoglycemic component in Gentiana olivieri.8 Our team confirmed that luteolin has a strong anticancer effect in PC.9 The effects of isoorientin, as a 6-C-glucoside of luteolin, on cancer need to be identified. With many biological activities and therapeutic effects, including anti-inflammatory, antidiabetic, antioxidant, proapoptotic, and autophagy-inducing effects, we believe that isoorientin has the potential to treat inflammatory and neoplastic diseases.10–14 Thus, we investigated whether isoorientin has potential antitumor effects on PC and its underlying mechanism. AMP-activated protein kinase (AMPK) is a sensor of the cellular energy status and can be found in all types of eukaryotes, even in very primitive ones, such as Giardia lamblia.15 AMPK is a heterotrimeric complex, including a catalytic α subunit and regulatory β and γ subunits. Every subunit has 2–3 types (α1, α2, β1, β2, γ1, γ2, and γ3); hence, there are at least 12 types of AMPKs.16 Under specific circumstances, AMPK appears to have different capacities as a tumor suppressor or a tumor promoter.17–24 AMPK activators, such as metformin, phenformin, and 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR), exhibit antineoplastic effects on many cancers (acute myelocytic leukemia, renal cell carcinoma, breast cancer, malignant melanoma, PC, thyroid cancer, glioblastoma, colon cancer, etc.) in vivo or in vitro.25–29 It has been noted that activated AMPK inhibits cell proliferation and kills cancer cells via the induction of apoptosis. Furthermore, AMPK is required for the induction of the epithelial–mesenchymal transition (EMT), which is an important process that contributes to cancer metastasis.30 Moreover, metformin can reverse multidrug resistance in human breast cancer cells by activating AMPK.31 Although several aspects of the mechanisms of AMPK in cancer have been studied, the pathophysiological role of AMPK in PC has not been fully elucidated. In this study, our aim is to explore the medicinal benefits of isoorientin on PC and its relationship with AMPK, and our study focused on its effects on the cell proliferation, apoptosis, cell migration, and invasion of the human PC cell lines PANC-1 and PATU-8988.

Materials and methods

Reagents

Fetal bovine serum (FBS) was purchased from Sigma Chemical (St Louis, MO, USA). Roswell Park Memorial Institute (RPMI)-1640 (11875093), Dulbecco’s Modified Eagle’s Medium (DMEM), and trypsin were purchased from Gibco (Grand Island, NY, USA). The anti-AMPK (64 kDa, ab80039), anti-phospho-AMPK (64 kDa, ab133448), anti-E-cadherin (97 kDa, ab133597), anti-N-cadherin (125 kDa, ab18203), anti-VEGF (42 kDa, ab46154), anti-matrix metalloproteinase (MMP) 2 (75 kDa, ab86607), and anti-MMP9 (92 kDa, ab76003) antibodies were purchased from Abcam (Cambridge, UK). The anti-Bax (20 kDa, 5023s) and anti-Bcl-2 (26 kDa, 4223s) antibodies were purchased from Cell Signaling Technology (Danvers, MA, USA). The anti-GAPDH antibody (36 kDa, MB001) was purchased from Bioworld Technology (St Louis Park, MN, USA). Polyvinylidene difluoride (PVDF) membranes were purchased from Millipore (Billerica, MA, USA). Power SYBR Green PCR Master Mix was purchased from Applied Biosystems (Foster City, CA, USA), and a RevertAid First Strand cDNA Synthesis Kit was purchased from Thermo Fisher Scientific (Manassas, VA, USA). PCR primers were purchased from Generay Biotech (Shanghai, People’s Republic of China). Human VEGF enzyme-linked immunosorbent assay (ELISA) kit was purchased from NeoBioscience (Shenzhen, People’s Republic of China), and isoorientin (E-1060) was purchased from Tauto Biotech (Shanghai, People’s Republic of China).

Cell culture

The human PC cell line PANC-1 cell was obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, People’s Republic of China), and the human PC cell line PATU-8988 was provided by the American Type Culture Collection (Manassas, VA, USA). PANC-1 was cultured with DMEM and PATU-8988 was cultured with RPMI-1640 at 37°C with 5% CO2. Both media contained 100 U/mL penicillin, 10% FBS, and 100 μg/mL streptomycin, and it was changed every 2 days. When cells were ~80% confluent, we detached the cells with 0.25% trypsin–0.02% ethylenediaminetetraacetic acid for subculture or for the following experimental treatments.

Cell treatment

PANC-1 and PATU-8988 cells were plated into 6-cm culture dishes. When the cells reached 70%–90% confluence, isoorientin was added to the FBS-free medium for 24 hours. Then, the cells were prepared for subsequent experiments, such as extracting protein, isolating RNA, and transwell invasion assay.

Silencing the expression of the gene PRKAA1

Lentivirus vectors containing the short hairpin RNA (shRNA) of PRKAA1 (protein kinase AMP-activated catalytic subunit alpha 1, sequence: GCTTGATGCACACATGAAT) and their negative control were designed and produced by GeneChem (Shanghai, People’s Republic of China). First, PANC-1 and PATU-8988 cells were seeded in six-well plates (5×104 cells) and allowed to grow until nearly 30%–40% confluent. After the culture medium was discarded, the six-well plates were washed with phosphate-buffered saline (PBS) three times. Then, each of the plates was filled with a transfection-enhancing solution with lentivirus (2 multiplicity of infection for PANC-1 and 10 multiplicity of infection for PATU-8988) and 10 μg/mL polybrene. After 8–12 hours of incubation and transfection at 37°C with 5% CO2, we replaced the transfection medium with the common culture medium. When the cells reached 80% of the plate, the cells were harvested for passage or experiments. In all of the operations we mentioned above, the cells were processed using the proper biohazard safety equipment.

Cell viability detection using a Cell Counting Kit 8 assay

PANC-1 and PATU-8988 cells were plated onto 96-well plates. Each well contained ~5,000 cells and 200 μL of the medium with 10% FBS. When the cells of each well reached 70% confluency, the medium was changed, and FBS-free medium with different concentrations of isoorientin was added. After 24 hours, the cells were washed with PBS once, the medium containing isoorientin was discarded, and 100 μL of FBS-free medium with 10 μL of the Cell Counting Kit 8 (CCK8; Dojindo, Kumamoto, Japan) reagent were added. The cells were incubated for another 1–2 hours at 37°C, and the absorbance of each well was detected using an ELISA reader (BioTek, Winooski, VT, USA) at 490 nm based on the manufacturer’s instructions. Cell viability was expressed as the fold change of absorbance.

Apoptosis assay

Cells were plated in 6-cm culture dishes (5×105 cells per dish) and treated with isoorientin (0, 20, 40, 80, and 160 μM) for 24 hours. The cell apoptosis rate was measured using the Annexin V-FITC/PI Apoptosis Detection Kit (BD, Franklin Lakes, NJ, USA), according to the manufacturer’s instructions. After the treatments, the fluorescence intensity was measured using a BD Accuri C6 (BD).

RNA extraction and quantitative real-time PCR analysis

After the cells were treated as described earlier, the total RNA was isolated by adding TRIzol (Ambion, Carlsbad, CA, USA) in accordance with the manufacturer’s instructions. Then, the RevertAid First Strand cDNA Synthesis Kit was used to obtain cDNA from the RNA. Next, the quantitative real-time (qRT)-PCR was performed using the SYBR Green Master Mix in a 7500 Real-Time PCR System (Applied Biosystems). β-Actin was amplified as an internal standard. An analysis of the qRT-PCR data was performed using the ΔCt values. All the primer sequences are listed in Table 1.
Table 1

The primers used for real-time PCR

GeneSense (5′–3′)Antisense (5′–3′)
CDH1TCACGCTGTGTCATCCAACGGTAGGTGTTCACATCATCGTCCGC
CDH2CATCATCATCCTGCTTATCCTTGTGGTCTTCTTCTCCTCCACCTTCTT
MMP2GGGGGAAGATGCTGCTGTTAGCGGTCCTGGCAGAAATAG
MMP7AGTGAGCTACAGTGGGAACAGGCCATTATTTCTATGACGCGGGAGT
MMP9CAGTCCACCCTTGTGCTCTTCCCATCTCTGCCACCCGAGTGTAAC
VEGFGGAGGCAGAGAAAAGAGAAAGTGTAAGAGAGCAAGAGAGAGCAAAAGAT
β-ActinGGGAAATCGTGCGTGACATTACAGGAAGGAAGGCTGGAAGAGTG

Abbreviations: MMP, matrix metalloproteinases; VEGF, vascular endothelial growth factor.

Western blot analysis

After treatments, cells were lysed in radioimmunoprecipitation assay buffer (Beyotime, Shanghai, People’s Republic of China) containing 10% phosphatase inhibitor (Roche Diagnostics GmbH, Mannheim, Germany) and 1% phenylmethylsulfonyl fluoride (Beyotime) for 30 minutes. Then, the cell lysate was centrifuged at 12,000×g, and the supernatant was collected. The protein concentration of each group was measured using a BCA Protein Assay Kit (Beyotime). After denaturation, 50 μg of protein for each group was then subjected to sodium dodecyl sulfatepolyacrylamide gel electrophoresis, transferred to PVDF membranes and incubated with specific antibodies overnight at 4°C. Protein detection was performed using the enhanced chemiluminescence reagent obtained from Thermo Fisher Scientific, and the immunocomplexes were visualized using the Alpha-EaseFC software.

Enzyme-linked immunosorbent assay

After the cells were treated properly, the culture medium was collected. VEGF protein involved in the culture media was directly measured by ELISA kit according to the manufacturer’s instructions (NeoBioscience). The absorbance was measured at 450 nm. The concentration of VEGF was calibrated with the VEGF standard curve.

Transwell migration and invasion assay

According to the manufacturer’s protocol, transwell inserts (Corning, Franklin Lakes, NJ, USA) with 8-μm pore membrane filters were used for the migration and invasion assay. Briefly, Matrigel Basement Membrane Matrix (Corning) was laid in the upper chambers to test for invasion, but not for migration. A volume of 500–600 μL RPMI-1640 (for PATU-8988) or DMEM (for PANC-1) with 10% FBS as a chemoattractant was added to the lower compartment. After the cells were starved in FBS-free medium overnight, the cells (migration: 5×103, invasion: 5×104) were placed in the upper compartment (FBS-free medium) and incubated for 24 hours. Then, we gently scrubbed off the cells on the upper surface with a cotton swab, washed the filters with PBS three times, and then fixed the cells with 4% paraformaldehyde for 20 minutes. Subsequently, the cells were stained with a 0.05% crystal violet solution, followed by three washes with PBS. Then, the inserts were allowed to dry at room temperature, and the membranes were photographed under an inverted microscope.

Statistical analysis

The data were analyzed using the SPSS 19.0 software (IBM, Armonk, New York,USA). The results are expressed as the mean ± SEM of at least three independent experiments. When P<0.05, differences were considered to be statistically significant.

Results

Isoorientin inhibits cell proliferation

At the beginning of our study, we performed a CCK8 assay to assess whether isoorientin affects the cell viability of PANC-1 and PATU-8988 cells. Both cell lines were grown for 24 hours in the presence of isoorientin (0, 20, 40, 80, and 160 μM), and a CCK8 solution was added. We found that the cell viability decreased significantly at the concentrations of 20, 40, 80, and 160 μM (Figure 1A). Then, we performed a CCK8 assay in the shRNA-interfering group. The cell proliferation in the isoorientin-treated group was not significantly different from that in the untreated group in both the PANC-1 and PATU-8988 cell lines (Figure 1B).
Figure 1

Isoorientin inhibits cell proliferation.

Notes: Two cell lines were treated with isoorientin at the concentrations of 0, 20, 40, 80, and 160 μM for 24 hours. (A) The fold change in cell viability of PATU-8988 and PANC-1 cells. (B) The fold change in cell viability of shRNA–PATU-8988 and shRNA–PANC-1 cells. The data represent the mean ± SEM (n=3, *P<0.05 vs 0 μM group).

AMPK is constitutively activated by isoorientin

After the cells were cultured with isoorientin (0, 20, 40, 80, and 160 μM for PANC-1; 0, 20, 40, 80, 160, and 320 μM for PATU-8988) for 24 hours, we assessed the expression of p-AMPK and AMPK by Western blotting. After the isoorientin treatment, the p-AMPK expression was increased (Figure 2A). Then, in the shRNA group, we choose the concentration of 80 μM to detect the effects of isoorientin. As shown in Figure 2B, the expression levels of AMPK and p-AMPK were much lower in the shRNA group than in the wild-type PC cells (WT) and the group that was transfected with a negative control lentivirus (NC). In the shRNA group, with or without isoorientin treatment, the expression of AMPK and p-AMPK was not different (Figure 2B).
Figure 2

AMPK is constitutively activated by isoorientin.

Notes: The effect of isoorientin on the expression of the protein 5-AMP-activated protein kinase (AMPK). (A) The expression levels of AMPK and phosphorylated AMPK were evaluated in PATU-8988 and PANC-1 cell lines in the absence (−) or presence (+) of isoorientin (20, 40, 80, and 160 μM) for 24 hours. GAPDH was used as a loading control. (B) The expression of AMPK and p-AMPK in the shRNA–PATU-8988 and shRNA–PANC-1 PC groups. The immunoblots shown are representative of three independent experiments. NC, transfected with negative control lentivirus PC cell group. shRNA, shRNA-interfering PC group. WT, wild-type PC cell.

Abbreviations: AMPK, AMP-activated protein kinase; PC, pancreatic cancer.

PC cells are susceptible to isoorientin-induced apoptosis

Because AMPK is interrelated with the regulation of cell apoptosis in a large variety of cancer cells, the effect of isoorientin treatment was analyzed for up to 24 hours on the cell apoptosis rate of PANC-1 and PATU-8988 cells. Except for the cells that were cultured with or without isoorientin, all cells were treated the same way. The isoorientin-induced apoptotic response was increased in the normal PC group (Figure 3A–C). In contrast, apoptosis was not significantly different in the shRNA groups with or without isoorientin treatment (Figure 3D–F). Thus, we can conclude that the proapoptotic response of isoorientin was increased via the activation of the AMPK signaling pathway.
Figure 3

Pancreatic cancer cells are susceptible to isoorientin-induced apoptosis.

Notes: The effect of isoorientin on apoptotic cell death. Cells were treated in the absence or presence of isoorientin (20, 40, 80, and 160 μM) for 24 hours. Apoptosis was evaluated by Annexin V staining (A, B, D, E). The expression of BCL-2 and BAX was evaluated by Western blotting(C and F). GAPDH was used as a loading control. The immunoblots shown are representative of three independent experiments. The apoptosis data are presented as the mean ± SEM from three independent experiments (*P<0.05 vs 0 μM).

Isoorientin downregulates the expression of VEGF, MMPs, and the proteins involved in the EMT

Since VEGF, MMPs, and EMT are associated with changes in the survival, motility, migration, and invasion of tumors and, thus their malignancy, we evaluated whether isoorientin is able to regulate the expression of VEGF, MMPs, and EMT. The cells were treated with isoorientin (0, 20, 40, 80, and 160 μM) for 24 hours, and the expression of VEGF, EMT hallmarks (N-cadherin and E-cadherin), and MMP hallmarks (MMP2 and MMP9) was evaluated by real-time PCR assay and Western blotting. We also test the releasing VEGF level in medium by ELISA. We found that PC cells treated with isoorientin (20, 40, 80, and 160 μM) had significantly reduced expression levels of VEGF, N-cadherin, MMP2, and MMP9 and increased expression levels of E-cadherin both at the mRNA and the protein levels (Figure 4). Meanwhile, in the shRNA group, these changes were not observed (Figure 4C–E).
Figure 4

Isoorientin downregulates the expression of VEGF, MMPs, and proteins involved in the epithelial–mesenchymal transition.

Notes: PATU-8988 and PANC-1 cells were treated with isoorientin at the concentrations of 0, 20, 40, 80, and 160 μM for 24 hours. (A) The fold change in the mRNA expression of CDH1 (E-cadherin), CDH2 (N-cadherin), MMP2, MMP9, and VEGF of the two cell lines. (B) A Western blotting assay was performed to determine the protein levels of E-cadherin, N-cadherin, MMP2, MMP9, and VEGF. GAPDH was used as an internal control. (E) The releasing VEGF level in medium test by ELISA. (C–E) The fold change in the expression of CDH1 (E-cadherin), CDH2 (N-cadherin), MMP2, MMP9, and VEGF in shRNA–PATU-8988 and shRNA–PANC-1 cells with (+) or without (−) isoorientin treatment was quantified by qRT-PCR, Western blotting, and ELISA. The data represent the mean ± SEM (n=3, *P<0.05 vs 0 μM group).

Abbreviation: ELISA, enzyme-linked immunosorbent assay; MMP, matrix metalloproteinases; qRT-PCR, quantitative real-time PCR; VEGF, vascular endothelial growth factor.

Isoorientin inhibits the migration and invasion of PC cells

To further evaluate the effects of isoorientin on PC cell migration and invasion, we utilized transwell migration/invasion assays. The cells were plated onto the upper chamber of the transwell system in the presence or absence of isoorientin (20, 40, 80, and 160 μM) for 24 hours. After the cells were stained with crystal violet nuclear dye, micrographs of the cells migrating onto the lower surface of the transwell membrane were obtained. Compared with the respective untreated control, the density of the migrated cells, which were stained purple, was clearly decreased in the groups treated with isoorientin (20, 40, 80, and 160 μM; Figure 5A). In the shRNA group, no significant difference was found between the isoorientin-treated and untreated groups (Figure 5B).
Figure 5

Isoorientin inhibits the migration and invasion of pancreatic cancer cells.

Notes: Two cell lines were treated with luteolin at the concentrations of 0, 20, 40, 80, and 160 μM for 24 hours. (A) Isoorientin inhibited the invasive and migration capacity of PATU-8988 and PANC-1 cells. 200× magnification. (B) In the shRNA–PATU-8988 and shRNA–PANC-1 cell lines, isoorientin had little effect on their invasive and migration capacity. The data represent the mean ± SEM (n=3, *P<0.05 vs 0 μM group). 200× magnification.

Discussion

PC is considered one of the most invasive tumor diseases, and it has a very poor prognosis. The mortality rate will not decrease significantly unless new chemotherapy, radiotherapy, and biotherapy treatments emerge. It has been reported that AMPK is a potential therapeutic target for tumor treatment. AMPK is a ubiquitous and highly conserved sensor of the cellular energy status, and it regulates cellular energy homeostasis by phosphorylating various enzymes that are involved in glucose, protein, and lipid metabolism.32 It has been reported that increasing the activation of AMPK in papillary thyroid cancer cell lines leads to a conspicuous antitumor response, as measured by the inhibition of cell proliferation and migration, the induction of cell death, and the reversal of the EMT.33 Furthermore, the exposure of cancer cells to OSU-53, a novel AMPK activator, was sufficient to reverse the EMT in those cells.34 Several other AMPK activators, such as metformin, phenformin, and AICAR, have been shown to regulate cell survival and metastasis in a variety of cancer types.25–31,35 Herbal medicine has become a hot topic in the search of antitumor agents. Many studies have noted that various herbal medicines that have antitumor effects can be separated into several compounds, including isoorientin.5–7 Flavonoids, such as baicalin, quercetin, luteolin, and epigallocatechin, have been shown to activate the AMPK signaling pathway.36,37 Here, we hypothesized that, as a flavone, isoorientin could induce cancer cell death and lower tumor malignancy via the AMPK signaling pathway. In this study, we choose the PANC-1 and PATU-8988 cell lines to test the antitumor capacity of isoorientin. We found that isoorientin can lower the malignancy of PC cells, at least partly, by activating the AMPK signaling pathway, further demonstrating isoorientin’s potential as a new therapeutic agent for PC. Apoptosis plays a vital role in the progress of cell proliferation, differentiation, senescence, and death. Previous studies have concluded that BCL-2 and BAX control programmed cell death (apoptosis).38–41 Therefore, we determined the levels of BCL-2 and BAX after isoorientin treatment and found that isoorientin effectively inhibited the expression of BCL-2, whereas a contrary trend was observed in the expression of BAX. To further examine the apoptotic effect of isoorientin, we examined the apoptosis rates by flow cytometry. To some extent, the biological behaviors of cancer cell malignancy are invasiveness and high vascularization. EMT is a biological process in which epithelial cells transform into special cells with mesenchymal phenotypes, and these cells can be isolated during cancer metastasis. Previous studies have found that changes in the EMT are often followed with increased expression of MMPs.42,43 Thus, we determined the levels of E-cadherin, N-cadherin, MMP2, and MMP9 after isoorientin treatment and found that isoorientin efficaciously inhibited the expression of N-cadherin, MMP2, and MMP9, while the level of E-cadherin was increased. The EMT and the degradation of the extracellular matrix make cancer cell migration possible.44,45 We performed a transwell invasion and migration assay to further validate the inhibitory effect of isoorientin on cancer cell invasiveness in vitro. VEGF is one of the most effective proangiogenic growth factors. The inhibition of VEGF can suppress tumor growth in vivo.46 Moreover, VEGF can promote the migration and invasion capacity of tumor cells, resulting in an increase in the degree of the tumor cell malignancy.47,48 In our experiments, VEGF was significantly reduced by isoorientin treatment in PC cell lines, both at the mRNA and protein levels. All the data demonstrated that isoorientin can decrease the malignancy of PC. More importantly, in this study, we observed that the phosphorylation of AMPK was accompanied by the upregulation of E-cadherin and the downregulation of VEGF, N-cadherin, and MMPs, similar to apoptosis. This suggested that isoorientin lowers malignancy and induces the apoptosis of PC cell through the activation of the AMPK signaling pathway. Although the antitumor effects of AMPK were tested in our experiments, the specific mechanism by which AMPK regulates cell apoptosis, migration, and invasion was not fully demonstrated in this article. In many reports, it has been confirmed that mTOR, which is negatively regulated by AMPK, is involved in cancer cell death.49,50 Similarly, the tumor suppressors TSC251–54 and p5354–57 are downstream targets of AMPK activity. Intriguingly, a survey of the literature available shows that the activation of AMPK is a necessary but not sufficient condition for the induction of the EMT.30 Altogether, it is certain that the relationship of isoorientin with the antitumor effect of AMPK and their relationship with other signaling pathways are very complex and need to be further investigated. In conclusion, our study shows that isoorientin can inhibit the expression of VEGF, VEGF, N-cadherin, MMP2, MMP9, and BAX and promote the expression of E-cadherin and BCL-2 via the AMPK signaling pathway. It provides a new role for isoorientin, a flavone, as an anticancer drug. We expect that isoorientin will be a new therapeutic strategy that targets apoptosis, migration, invasion, and angiogenesis.
  57 in total

Review 1.  Ras, PI(3)K and mTOR signalling controls tumour cell growth.

Authors:  Reuben J Shaw; Lewis C Cantley
Journal:  Nature       Date:  2006-05-25       Impact factor: 49.962

Review 2.  Bcl-2 gene family and the regulation of programmed cell death.

Authors:  X M Yin; Z N Oltvai; D J Veis-Novack; G P Linette; S J Korsmeyer
Journal:  Cold Spring Harb Symp Quant Biol       Date:  1994

3.  AMP-activated protein kinase induces a p53-dependent metabolic checkpoint.

Authors:  Russell G Jones; David R Plas; Sara Kubek; Monica Buzzai; James Mu; Yang Xu; Morris J Birnbaum; Craig B Thompson
Journal:  Mol Cell       Date:  2005-04-29       Impact factor: 17.970

4.  Quercetin, luteolin and epigallocatechin gallate alleviate TXNIP and NLRP3-mediated inflammation and apoptosis with regulation of AMPK in endothelial cells.

Authors:  Jianjun Wu; Xiaoshan Xu; Yi Li; Junping Kou; Fang Huang; Baolin Liu; Kang Liu
Journal:  Eur J Pharmacol       Date:  2014-10-14       Impact factor: 4.432

5.  Hypoglycaemic activity of Gentiana olivieri and isolation of the active constituent through bioassay-directed fractionation techniques.

Authors:  Ekrem Sezik; Mustafa Aslan; Erdem Yesilada; Shigeru Ito
Journal:  Life Sci       Date:  2004-12-01       Impact factor: 5.037

Review 6.  Vascular permeability changes involved in tumor metastasis.

Authors:  Jonathan García-Román; Alejandro Zentella-Dehesa
Journal:  Cancer Lett       Date:  2013-03-14       Impact factor: 8.679

7.  Celastrol suppresses breast cancer MCF-7 cell viability via the AMP-activated protein kinase (AMPK)-induced p53-polo like kinase 2 (PLK-2) pathway.

Authors:  Ji Hae Kim; Jung Ok Lee; Soo Kyung Lee; Nami Kim; Ga Young You; Ji Wook Moon; Jie Sha; Su Jin Kim; Sun Hwa Park; Hyeon Soo Kim
Journal:  Cell Signal       Date:  2012-12-22       Impact factor: 4.315

8.  Antimicrobial activity, growth inhibition of human tumour cell lines, and phytochemical characterization of the hydromethanolic extract obtained from Sapindus saponaria L. aerial parts.

Authors:  Khaled N Rashed; Ana Ćirić; Jasmina Glamočlija; Ricardo C Calhelha; Isabel C F R Ferreira; Marina Soković
Journal:  Biomed Res Int       Date:  2013-12-26       Impact factor: 3.411

9.  Metformin induces apoptosis of human hepatocellular carcinoma HepG2 cells by activating an AMPK/p53/miR-23a/FOXA1 pathway.

Authors:  Yunpeng Sun; Chonglin Tao; Xiaming Huang; Han He; Hongqi Shi; Qiyu Zhang; Huanhuan Wu
Journal:  Onco Targets Ther       Date:  2016-05-12       Impact factor: 4.147

10.  mTOR inhibitors induce apoptosis in colon cancer cells via CHOP-dependent DR5 induction on 4E-BP1 dephosphorylation.

Authors:  K He; X Zheng; M Li; L Zhang; J Yu
Journal:  Oncogene       Date:  2015-04-13       Impact factor: 9.867

View more
  5 in total

1.  Exploration of the System-Level Mechanisms of the Herbal Drug FDY003 for Pancreatic Cancer Treatment: A Network Pharmacological Investigation.

Authors:  Ho-Sung Lee; In-Hee Lee; Kyungrae Kang; Sang-In Park; Minho Jung; Seung Gu Yang; Tae-Wook Kwon; Dae-Yeon Lee
Journal:  Evid Based Complement Alternat Med       Date:  2022-05-10       Impact factor: 2.650

2.  Isoorientin Ameliorates APAP-Induced Hepatotoxicity via Activation Nrf2 Antioxidative Pathway: The Involvement of AMPK/Akt/GSK3β.

Authors:  Xiaoye Fan; Hongming Lv; Lidong Wang; Xuming Deng; Xinxin Ci
Journal:  Front Pharmacol       Date:  2018-11-28       Impact factor: 5.810

3.  PRKAA1 Promotes Proliferation and Inhibits Apoptosis of Gastric Cancer Cells Through Activating JNK1 and Akt Pathways.

Authors:  Yangmei Zhang; Xichang Zhou; Long Cheng; Xiang Wang; Qinglin Zhang; Youwei Zhang; Sanyuan Sun
Journal:  Oncol Res       Date:  2019-09-26       Impact factor: 5.574

4.  Orientin, a Bio-Flavonoid from Trigonella hamosa L., Regulates COX-2/PGE-2 in A549 Cell Lines via miR-26b and miR-146a.

Authors:  Hany Ezzat Khalil; Hairul-Islam Mohamed Ibrahim; Emad A Ahmed; Promise Madu Emeka; Ibrahim A Alhaider
Journal:  Pharmaceuticals (Basel)       Date:  2022-01-27

5.  Changes in Beneficial C-glycosylflavones and Policosanol Content in Wheat and Barley Sprouts Subjected to Differential LED Light Conditions.

Authors:  Muthusamy Muthusamy; Jong Hee Kim; Suk Hee Kim; Joo Yeol Kim; Jeong Wook Heo; HanGyeol Lee; Kwang-Sik Lee; Woo Duck Seo; Soyoung Park; Jin A Kim; Soo In Lee
Journal:  Plants (Basel)       Date:  2020-11-06
  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.