Literature DB >> 28002434

Correction: First Demonstration of Antigen Induced Cytokine Expression by CD4-1+ Lymphocytes in a Poikilotherm: Studies in Zebrafish (Danio rerio).

Sohye Yoon, Suman Mitra, Cathy Wyse, Ayham Alnabulsi, Jun Zou, Eveline M Weerdenburg, Astrid M van der Sar, Difei Wang, Christopher J Secombes, Steve Bird.

Abstract

[This corrects the article DOI: 10.1371/journal.pone.0126378.].

Entities: Gene Species

Year: 2016 PMID： 28002434 PMCID： PMC5176319 DOI： 10.1371/journal.pone.0169149

Source DB: PubMed Journal: PLoS One ISSN： 1932-6203 Impact factor: 3.240

The CD4-1-R primer sequence is listed incorrectly in S2 Table. The correct primer sequence is: 5'CTGGTCGGTCTTAAATGAAACT3'. Please see the correct S2 Table here.

Primers used in real time PCR for gene expression in zebrafish.

(DOCX) Click here for additional data file.

1 in total

1. First Demonstration of Antigen Induced Cytokine Expression by CD4-1+ Lymphocytes in a Poikilotherm: Studies in Zebrafish (Danio rerio).

Authors: Sohye Yoon; Suman Mitra; Cathy Wyse; Ayham Alnabulsi; Jun Zou; Eveline M Weerdenburg; Astrid M van der Sar; Difei Wang; Christopher J Secombes; Steve Bird
Journal: PLoS One Date: 2015-06-17 Impact factor: 3.240

1 in total