| Literature DB >> 27995024 |
Ning Kong1, Yewen Zuo2, Zhongze Wang2, Hai Yu3, En-Min Zhou4, Tongling Shan3, Guangzhi Tong3.
Abstract
Canine kobuvirus (CaKVs) was a newly described virus detected in dogs in the US and Italy. To learn more about CaKVs, 5 of 106 fecal samples from diarrhea dogs were positive with CaKVs in China, and the full genome of CaKVs strain CH-1 isolated from dog with diarrhea was sequenced. The genome consists of 8186 nucleotides, excluding the 3' poly (A) tail, and an open reading frame that maps between nucleotide positions 601 and 7943 which encodes a 2446 amino acid polyprotein. Based on the complete amino acid sequence of polyprotein, phylogenetic analysis showed that CH-1 was grouped along with other canine kobuvirus strains detected in the USA (US-PC0082, AN211D).Entities:
Keywords: Canine kobuvirus; Molecular characterization; Phylogenetic analysis
Year: 2016 PMID: 27995024 PMCID: PMC5130936 DOI: 10.1186/s40064-016-3738-4
Source DB: PubMed Journal: Springerplus ISSN: 2193-1801
Fig. 1a Genome organization of CaKV. b Phylogenetic tree was constructed by the neighbour-joining method with p-distances and 1000 bootstrap replicates using MEGA4.0 software (www. megasoftware.net) with an alignment of the complete amino acid sequence of polyprotein with known kobuviruses and kobu-like viruses. GenBank accession numbers are indicated. The isolate of CH-1 is marked with a square. Scale bar indicates estimated phylogenetic divergence
List of primers used in this study
| Primer names | Sequence of primers (5′–3′) | Position (nt) |
|---|---|---|
| 5′ race reverse-1 | CAGTAGCAGTGATGTAGGTGAGGC | 640 |
| 5′ race reverse-2 | GCGGTAGAAAGAGTTCACAGTGG | 618 |
| 5′ race reverse-3 | CGCACAGAACGAGATTCCATT | 593 |
| 3′ race forward-1 | CGGGTTCGCTCCAAATTTC | 7821 |
| 3′ race forward-2 | TACCCTACTCCTACCTCCAACTCC | 7841 |
| 3′ race forward-3 | CGCTGGCTCAACCTGCTG | 7864 |
| 1 forward | CCACTCTAATACCCCGAGGAAT | 448 |
| 1 reverse | AGGTACGGTCACCGGAAGGT | 1618 |
| 2 forward | CGAAGGAGCCGGGAAACT | 1371 |
| 2 reverse | GGCAATCAGGACAGAGGTGG | 3256 |
| 3 forward | ACTCTGCCCCCGCCTCTGCCCTCAT | 2798 |
| 3 reverse | AGCCAAGTAAGGAAGGACACAAC | 4328 |
| 4 forward | ACTGTACCCACTTTGTCCAAGGT | 3911 |
| 4 reverse | AGTTCATCAGCGTAAGCTTCAGG | 5609 |
| 5 forward | CCATGAACCCAACGAACGC | 5238 |
| 5 reverse | CGATTTCGACTTGGAGTTCGG | 6916 |
| 6 forward | CCATCAAGAAGGAACCGGC | 6575 |
| 6 reverse | GTGGGTGGTCTTTATATCACCATG | 7982 |