Literature DB >> 27994995

Identification of differentially methylated regions (DMRs) of neuronatin in mice.

Yuxin Xu1, Zhiquan Liu1, Tiedong Wang1, Xianju Chen1, Jichao Deng1, Mao Chen1, Zhanjun Li1.   

Abstract

BACKGROUND: Neuronatin (NNAT) is a paternal-inherited imprinted gene, first discovered in the rat neonatal brain, where it plays vital roles for neuronal growth, brain development, and metabolic regulation. The maternal imprint of NNAT has been identified in mice; however, the differentially methylated regions (DMRs) involved in the monoallelic expression of NNAT have not yet been investigated.
RESULTS: In this study, we confirmed expression of two isoforms of the NNAT (α and β) in the mice brain via quantitative RT-PCR. Additionally, the methylation profile of the CpG island located in the NNAT gene locus was determined in the mice liver, brain, sperm, and the MII oocyte via bisulfite sequencing PCR.
CONCLUSION: In summary, we provide the first evidence for tissue- and gamete-specific methylation patterns of CpG3 that are located on exon 1, to be putative DMR of NNAT in mice.

Entities:  

Keywords:  DMR; Isoform; Mice; NNAT

Year:  2016        PMID: 27994995      PMCID: PMC5125312          DOI: 10.1186/s40064-016-3721-0

Source DB:  PubMed          Journal:  Springerplus        ISSN: 2193-1801


Background

Genomic imprinting leads to unequal expression of paternal and maternal alleles in offspring, which is essential for normal embryogenesis, fetal growth, and functional postnatal behavior (Surani 1998; Li et al. 1999; Das et al. 2013). The differentially methylated regions (DMRs) are established during gametogenesis and regulate the parent-specific expression of imprinted genes. DMRs with allele specific methylation have also been used in cancer diagnosis (Ushijima 2005; Bonin et al. 2016). Although 125 imprinted genes have been identified in mice to date (according to the Gene imprint database; http://www.geneimprint.com/), very little has been published about the DMRs of those imprinted genes (Gu et al. 2014). NNAT is a highly conserved imprinted gene among humans, mice, cattle, and pigs, containing two alternatively spliced transcripts (α and β) (Cheng et al. 2007; Schulz et al. 2009). Previous studies have revealed the parental-specific expression of NNAT to be associated with the methylation status of the CpG island located in the NNAT promoter sequence of pigs (Chen et al. 2014; Gu et al. 2014) and rabbits (Duan et al. 2015). A second intronic DNA sequence within the mouse NNAT with a length of 250 bp was defined as putative DMR and was revealed to act as a transcriptional activator in Drosophila (Sowpati et al. 2008). In addition, the hyper methylation of human NNAT frequently occurs in pediatric acute leukemia and Wilms Tumors (Kuerbitz et al. 2002; Hubertus et al. 2013). All of these previously published findings suggest that there is no definite DMR of NNAT in mice. With this background, we sought to identify the DMRs of mice NNAT via quantitative real-time PCR (q-PCR) and bisulfite sequencing PCR (BSP) analyses.

Results and discussion

In this study, we proposed a model of two NNAT isoforms (α and β) using GenBank and Ensembl databases. Furthermore, putative DMRs of NNAT (CpG 1 and CpG 2, CpG 3, CpG I2) were identified via comparative sequencing analysis and methyprimer (Fig. 1a). The results of q-PCR and RT-PCR demonstrated high expression of both of the transcripts (α and β) in the brain of mice, but not in their liver, which is consistent with the UniGene database (Fig. 1b, c). Previous studies have found two transcripts of NNAT that are widely expressed in most of tissues, including in livers and kidneys of cattle (both fetal and adult) and in 2-month-old pigs (Zaitoun and Khatib 2006; Cheng et al. 2007), suggesting different NNAT expression profiles between species.
Fig. 1

Gene structure and expression analysis of NNAT in mice. a Structure of the mice NNAT locus. NNAT features two alternatively spliced transcripts (α- and β-form). Protein coding regions are shown as black, filled boxes. Circles indicate CpG islands located in NNAT and analyzed via BSP. Q: Primers for q-PCR; RT: Primers for RT-PCR; b RT-PCR was used to detect the expression of two alternatively spliced isoforms in both brain and liver. c Gene expression of NNAT in brain and liver determined via q-PCR. Data are shown as Mean ± SEM (n = 6), *p < 0.05, **p < 0.01, ***p < 0.001

Gene structure and expression analysis of NNAT in mice. a Structure of the mice NNAT locus. NNAT features two alternatively spliced transcripts (α- and β-form). Protein coding regions are shown as black, filled boxes. Circles indicate CpG islands located in NNAT and analyzed via BSP. Q: Primers for q-PCR; RT: Primers for RT-PCR; b RT-PCR was used to detect the expression of two alternatively spliced isoforms in both brain and liver. c Gene expression of NNAT in brain and liver determined via q-PCR. Data are shown as Mean ± SEM (n = 6), *p < 0.05, **p < 0.01, ***p < 0.001 To identify the DMR of mice NNAT, methylation profiles of CpG 1, CpG 2, CpG 3, and CpG I2 were determined in both the brain and the liver using BSP. The results revealed hypermethylation of CpG1 (Fig. 2a vs. e), CpG2 (Fig. 2b vs. f), and CpG I2 (Fig. 2d vs. h) in both brain and liver. However, we found tissue-specific methylation patterns of CpG3 in the brain (29.33%) and liver (66%) (Fig. 2c vs. g). These results point towards the methylation status of CpG3 accounting for the expression difference of NNAT in liver vs. brain. In addition, tissue-specific methylation patterns revealed CpG3 (located on exon 1) to be a putative DMR of the NNAT in mice (Fig. 2c).
Fig. 2

DMR identification of NNAT in mice. The methylation status was analyzed via BSP: The results are depicted for CpG 1 in brain a and liver e, for CpG 2 in brain b and liver f, for CpG 3 brain (c) and liver (g), and for CpG 3 in brain (d) and liver (h). Open and closed circles indicate unmethylated and methylated CpG sites, respectively. Numbers in parentheses represent the methylated CpG sites relative to all counted CpG sites

DMR identification of NNAT in mice. The methylation status was analyzed via BSP: The results are depicted for CpG 1 in brain a and liver e, for CpG 2 in brain b and liver f, for CpG 3 brain (c) and liver (g), and for CpG 3 in brain (d) and liver (h). Open and closed circles indicate unmethylated and methylated CpG sites, respectively. Numbers in parentheses represent the methylated CpG sites relative to all counted CpG sites Generally, DNA methylation patterns of imprinted genes were established in both sperm and oocyte, which were reprogrammed subsequent after fertilization (Seisenberger et al. 2013). To identify the gamete-specific methylation pattern of CpG3 in mice NNAT, the DNA methylation profile of CpG3 in sperm and oocyte was determined via BSP. The results reveal hypomethylation in sperm (10%) and hypermethylation in MII oocytes (90%) (Fig. 3). In summary, the gamete-specific methylation patterns suggest that the imprinting marks of NNAT are established by a sex-specific mechanism, confirming CpG3 as the DMR of NNAT.
Fig. 3

Gamete-specific methylation status of CpG 3. The methylation status of CpG 3 was analyzed via BSP for MII oocyte (a) and sperm (b). Open and closed circles indicate unmethylated and methylated CpG sites, respectively. Numbers in parentheses represent the methylated CpG sites relative to all counted CpG sites

Gamete-specific methylation status of CpG 3. The methylation status of CpG 3 was analyzed via BSP for MII oocyte (a) and sperm (b). Open and closed circles indicate unmethylated and methylated CpG sites, respectively. Numbers in parentheses represent the methylated CpG sites relative to all counted CpG sites

Conclusions

Here, we studied the expression patterns of two isoforms of mice NNAT (α and β), and identified the CpG3 of mice NNAT (located on exon 1) as putative DMR.The data revealed hypermethylation of exon 1 to be associated with the silencing of mice NNAT, suggesting the NNAT gene transcriptional status to be correlated with the methylation status of exon 1, while being independent of both intron and 5′ UTR.

Methods

Tissue samples

The brain and liver were collected from two-month old ICR mice and immediately stored in liquid nitrogen until further use. Spermatozoa and MII oocytes were harvested using previously published protocols (Chen et al. 2014).

RT-PCR and quantitative real-time PCR (q-PCR)

Total RNA from liver and brain (n = 5) was isolated with TRNzol-A+ reagent (TIANGEN, Beijing, China) according to manufacturer’s instructions. The cDNA was synthesized with DNAse I (Fermentas, Shanghai, China) treated total RNA via the BioRTcDNA First Stand Synthesis Kit (Bioer Technology, Hangzhou, China). The BioEasy SYBR Green I Real Time PCR Kit (Bioer Technology, Hangzhou, China) was used to perform q-PCR, using the BIO-RAD Iq5 Multicolor Real-Time PCR Detection System. The reaction conditions were as follows: 95 °C for 3 min, followed by 40 cycles of 95 °C for 10 s for DNA denaturation, 60 °C for 15 s for primer annealing, and 72 °C for 30 s for extension. Relative gene expression normalized to β-actin was determined via the 2−ΔΔCT formula. All experiments on gene expression were performed in triplicate. The gene expression data was presented as mean ± SEM. Primers used for q-PCR and RT-PCR are listed in Table 1.
Table 1

Primers for q-PCR and RT-PCR

GenePrimer sequence (5′ → 3′)Tann (°C)Length (bp)
NNAT–RTF:GCTCATCATCGGCTGGTACA60343
R:CTTGGCAAGTGCTCCTCTGA262
β-actin-RTF:ATATCGCTGCGCTGGTCGTC60517
R:AGGATGGCGTGAGGGAGAGC
NNAT-qF:GTCCCCTGTGTTCCCTCGTC6081
R:TGTCGGTGCTGCTTTTCTGG
Actin-qF:GGCACCACACYTTCTACAATG60133
R:GGGGTGTTGAAGGTCTCAAAC

T the annealing temperature, RT the primers for RT-PCR, Q the primers for q-PCR

Primers for q-PCR and RT-PCR T the annealing temperature, RT the primers for RT-PCR, Q the primers for q-PCR

Bisulfite sequencing PCR

Bisulfite sequencing PCR (BSP) was performed to determine methylation of NNAT CpG islands. The CpGenome TM Turbo Bisulfite Modification Kit (Millipore, Jaffrey, NH, USA) was used for bisulfate treatment of genomic DNA of both liver and brain according to the manufacturer’s instructions. Bisulfite-treatment of the DNA of sperms (n = 1 × 103) and matured oocytes (n = 100) was done according to the instructions of the EZ DNA Methylation-Direct™ Kit (Zymo Research,CA). Nested PCR was used to amplify CpG islands, followed by T-vector cloning (positive clones, n = 10) and subsequent sequencing analysis. The BSP primers are listed in Table 2.
Table 2

Primers for BSP

GenePrimer sequence (5′ → 3′)Tann (°C)Length (bp)
CpG1-BSPO-F:TTTTGTGTTTTAGTTGTATAGCGAA55504
O-R:AATACAAACCTCTTAATTCGACACA
I-F: TAGAGGTTCGTATTTGTTTCGTAG55275
I-R:TTTTTCTACATTCCTACTAATCCGT
CpG2-BSPO-F:GAGCGGGAATTAATAGTTAGAAAAG55526
O-R:ACTAATCTCGAAATCCGCTACTAAA
I-F:GTATGTAGAATTTGTAGGTTTGGG54282
I-R:CTCTTACCACCTAAATACGCATAC
CpG3-BSPO-F:GGTAGAGTAGAATTTTTTGGA58590
O-R:CACCCCTAAATCTTTATTCCC
I-F:TTTAGGTGGTAAGAGGGTATTTAAGGTA60211
I-R:AATACATACTCACCTACAACA
I2-BSPO-F:TTTGGAATGTTGTATTTATTGGGTAGGA55558
O-R:CCCCTCACTAACCTTAACAAATACTCCTC
I-F:TAGTTGTTTTGATTGGTGGATAAGT56266
I-R:AACTCGCTACCTACGCTCCC

T the annealing temperature, O outside primers of the BSP, I inside primers of the BSP

Primers for BSP T the annealing temperature, O outside primers of the BSP, I inside primers of the BSP

Statistical analysis

Data were analyzed using student’s t-tests via SPSS 22.0 software (SPSS Inc., Chicago, IL, USA) and a p < 0.05 was considered as statistically significant. DNAman and online software tools Methprimer (http://www.urogene.org/methprimer/) and Bio Analyzer (http://biq-analyzer.bioinf.mpi-inf.mpg.de/tools/MethlationDiagrams/index.php) were used for the methylation analysis.
  15 in total

Review 1.  Detection and interpretation of altered methylation patterns in cancer cells.

Authors:  Toshikazu Ushijima
Journal:  Nat Rev Cancer       Date:  2005-03       Impact factor: 60.716

2.  An intronic DNA sequence within the mouse Neuronatin gene exhibits biochemical characteristics of an ICR and acts as a transcriptional activator in Drosophila.

Authors:  Divya Tej Sowpati; Devi Thiagarajan; Sudhish Sharma; Hina Sultana; Rosalind John; Azim Surani; Rakesh Kumar Mishra; Sanjeev Khosla
Journal:  Mech Dev       Date:  2008-08-28       Impact factor: 1.882

Review 3.  Imprinting and the initiation of gene silencing in the germ line.

Authors:  M A Surani
Journal:  Cell       Date:  1998-05-01       Impact factor: 41.582

4.  Identification of differentially methylated regions in new genes associated with knee osteoarthritis.

Authors:  Carolina A Bonin; Eric A Lewallen; Saurabh Baheti; Elizabeth W Bradley; Michael J Stuart; Daniel J Berry; Andre J van Wijnen; Jennifer J Westendorf
Journal:  Gene       Date:  2015-10-17       Impact factor: 3.688

5.  Hypermethylation of the imprinted NNAT locus occurs frequently in pediatric acute leukemia.

Authors:  Steven J Kuerbitz; Joshua Pahys; Alison Wilson; Nicole Compitello; Todd A Gray
Journal:  Carcinogenesis       Date:  2002-04       Impact factor: 4.944

6.  NNAT and DIRAS3 genes are paternally expressed in pigs.

Authors:  Huan-Chen Cheng; Feng-Wei Zhang; Chang-Yan Deng; Cao-De Jiang; Yuan-Zhu Xiong; Feng-E Li; Ming-Gang Lei
Journal:  Genet Sel Evol       Date:  2007-09-27       Impact factor: 4.297

7.  Methylation differences of the neuronatin gene promoter region in liver between normal and cloned pigs.

Authors:  Ting Gu; Xi Su; Shuhong Zhao; Changchun Li
Journal:  Anim Genet       Date:  2013-07-22       Impact factor: 3.169

8.  DNA methylation-mediated silencing of neuronatin (NNAT) in pig parthenogenetic fetuses.

Authors:  Xianju Chen; Tiedong Wang; Qingyan Lv; Anfeng Wang; Hongsheng Ouyang; Zhanjun Li
Journal:  Gene       Date:  2014-09-19       Impact factor: 3.688

9.  Assessment of genomic imprinting of SLC38A4, NNAT, NAP1L5, and H19 in cattle.

Authors:  Ismail Zaitoun; Hasan Khatib
Journal:  BMC Genet       Date:  2006-10-25       Impact factor: 2.797

10.  Transcript- and tissue-specific imprinting of a tumour suppressor gene.

Authors:  Reiner Schulz; Ruth B McCole; Kathryn Woodfine; Andrew J Wood; Mandeep Chahal; David Monk; Gudrun E Moore; Rebecca J Oakey
Journal:  Hum Mol Genet       Date:  2008-10-04       Impact factor: 6.150

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.