Literature DB >> 27991585

Hephaestin and ceruloplasmin facilitate iron metabolism in the mouse kidney.

Bo Jiang1, Guohao Liu1, Jiashuo Zheng1, Mengxia Chen1, Zaitunamu Maimaitiming1, Min Chen1, Shunli Liu1, Ruiwei Jiang1, Brie K Fuqua2, Joshua L Dunaief3, Chris D Vulpe2, Gregory J Anderson4, Hongwei Wang1, Huijun Chen1.   

Abstract

Multicopper ferroxidases (MCFs) play an important role in cellular iron homeostasis. However, the role of MCFs in renal metabolism remains unclear. We used Hephaestin (Heph) and Ceruloplasmin (Cp) single or double (Heph/Cp) knockout (KO) mice to study the roles of MCFs in the kidney. Renal iron levels and the expression of iron metabolism genes were examined. The non-heme iron content both in the renal cortex and medulla of Heph/Cp KO mice was significantly increased. Perls' Prussian blue staining showed iron accumulation on the apical side of renal tubular cells in Heph/Cp KO mice. A significant increase in ferritin protein expression was also observed in the renal medulla and cortex of Heph/Cp KO mice. Both DMT1 and TfR1 protein expression were significantly decreased in the renal medulla of Heph/Cp KO mice, while the expression of DMT1 protein was significantly increased in the renal cortex of these animals. Significant increase in proteinuria and total urinary iron was observed in the double knockout mice, and this was associated with compromised structural integrity. These results suggest that KO of both the HEPH and CP genes leads to kidney iron deposition and toxicity, MCFs could protect kidney against a damage from iron excess.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27991585      PMCID: PMC5171654          DOI: 10.1038/srep39470

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Multicopper ferroxidases (MCFs) are known to play a central role in iron nutrition and homeostasis in organisms ranging from yeast to humans1. The vertebrate MCFs, Ceruloplasmin (CP), Hephaestin (HEPH), and Zyklopen (ZP), are hypothesized to facilitate iron transport in diverse tissues by oxidizing ferrous iron to the ferric form so that it can bind to the circulating ferric iron carrier transferrin (TF). In these reactions, electrons are transferred from ferrous iron to the type I copper sites of MCFs. The electrons are then transferred to the MCF type II/type III copper site, where molecular oxygen is reduced to water2. Our previous work demonstrated that HEPH is located in a supra-nuclear compartment and on the basolateral membrane of intestinal enterocytes3. Apical iron administration can lead to the mobilization of HEPH from intracellular sites to the basolateral membrane4. HEPH is most strongly expressed in the small intestine, but it has also been found to be expressed in the kidney5. CP is mainly found as a soluble serum protein originating from the liver, but it is also found as a glycosylphosphatidylinositol (GPI)-linked protein in astrocytes and the kidney6. Mutations in the Cp gene lead to iron accumulation in multiple tissues in humans7 and mice8. The role of MCFs and a range of other proteins involved in iron metabolism in iron transport in the kidney remains poorly understood91011. In general, over 99% of the iron filtered by the glomeruli is reabsorbed9. Wareing et al. suggested that iron was reabsorbed by late proximal tubule segments and early distal tubule segments12. Plasma TF (Mr 78,000) can pass through the glomerulus filter1314 and be reabsorbed in the proximal tubule via transferrin receptor 1 (TFR1). TFR1 is highly expressed in the proximal tubules of the renal cortex, and is also found on the apical membrane of collecting tubules and distal tubules in the medulla10. The TF-TFR1 complex is internalized into endosomes via cubilin-mediated endocytosis, and can be targeted to lysosomes for degradation15. Divalent metal-ion transporter 1 (DMT1) is localized to the endosomes and lysosomes within proximal tubule cells, organelles associated with the processing of apically sequestered TF16. It is predicted that iron is released from TF at these sites and exported into the cytosol by DMT116. These findings suggest that some TF normally enters the glomerular filtrate, but it is retrieved by specific receptor-mediated uptake in the kidney tubular system. Iron released into the cytoplasm of renal tubular cells is subsequently exported across the basolateral membrane via ferroportin1 (FPN1)17. We hypothesize that this is the step which is likely to involve the MCFs as HEPH in the gut and CP in other tissues have been shown to increase the efficiency of FPN1-mediated iron transport81819. DMT1 is also found on the apical membrane of distal tubules, where it can resorb iron from the tubular fluid. Iron accumulation in the kidney is found in a number of diseases, including Fanconi syndrome, Dent’s disease and chronic renal disease142021. High kidney iron is generally considered to be deleterious to renal function202122 due to its propensity to catalyze the formation of reactive oxygen species23, which have the capacity to cause cellular injury. Recent clinical studies indicate that chelation of iron in the kidney has beneficial effects on the course of chronic kidney disease24. In this study we have used Cp and Heph single, and Cp/Heph double knockout mice to examine the role of these MCFs in the kidney. These studies showed that knockout of both the Heph and Cp genes, but not either alone, leads to kidney iron deposition and toxicity. These findings suggest that MCFs may play an important role of protecting kidney against damage from iron excess and that either oxidase is able to compensate for the loss of the other.

Results

Iron status at 6 months of age

To evaluate the iron status of the Heph/Cp KO mice, hematological data were obtained from mice at six months of age. Heph/Cp KO and Heph KO mice, but not Cp KO, were anemic based on reductions in hemoglobin (Hb), mean cell volume (MCV), red cell number and hematocrit (Table 1). Heph/Cp KO mice were significantly more anemic than Heph KO animals. Iron levels were significantly lower in the plasma of Heph/Cp KO, Cp KO, and Heph KO mice compared to WT control mice, while the hepatic iron concentration was significantly higher in Heph/Cp KO and Cp KO mice compared to WT control and Heph KO mice (Table 2). In the kidney, the iron concentration was only significantly increased in Heph/Cp KO mice compared to the other groups, and not in either of the single gene KOs (Table 2). We then examined the non-heme iron content in the renal cortex and medulla, and found that non-heme iron levels were significantly higher in both the renal cortex and medulla of Heph/Cp KO mice compared to the other genotypes examined (Table 2).
Table 1

Hematological parameters of MCF knockout and wild-type mice at 6 months of age.

ParameterWTHeph/Cp KOCp KOHeph KO
RBC, X10127.44 ± 0.18[a]2.92 ± 0.11[b]7.56 ± 0.14[a]5.71 ± 0.14[c]
Hb, g/L108.8 ± 2.26[a]45.2 ± 1.27[b]103.2 ± 1.33[a]79.6 ± 2.98[c]
Hct, %34.7 ± 0.78[a]10.8 ± 0.42[b]33.7 ± 0.25[ac]29.1 ± 0.47[c]
MCV, fL46.7 ± 0.20[ac]36.9 ± 0.15[b]45.0 ± 1.07[a]51.3 ± 0.68[c]
MCH, pg14.5 ± 0.07[a]15.7 ± 0.39[a]13.7 ± 0.15[a]13.8 ± 0.37[a]
MCHC, g/L311 ± 1.02[a]425 ± 14.7[b]306 ± 4.74[a]270 ± 8.97[a]
RDW, %24.1 ± 0.25[a]32.8 ± 0.31[b]33.4 ± 0.33[b]25.3 ± 0.98[a]

Mean ± SEM, n = 5–9. Results that do not share a letter are significantly different, P < 0.05. RBC, red blood cells; Hb, hemoglobin; Hct, hematocrit; MCV, mean corpuscular volume; MCH, mean corpuscular hemoglobin; MCHC, mean corpuscular hemoglobin concentration; RDW, red cell distribution width.

Table 2

Total iron and non-heme iron concentrations at 6 month of age.

ParameterWTHeph/Cp KOCp KOHeph KO
Total iron
 Plasma, μmol/L72.1 ± 0.30[a]37.4 ± 0.35[b]34.3 ± 1.00[b]62.6 ± 1.45[c]
 Liver, μmol/g dry weight4.65 ± 0.11[a]28.4 ± 1.44[b]21.3 ± 0.49[b]2.85 ± 0.06[a]
 Kidney, μmol/g dry weight3.85 ± 0.13[a]12.1 ± 0.41[b]3.41 ± 0.10[a]2.79 ± 0.05[a]
Non-heme iron
 Kidney, μmol/g dry weight3.32 ± 0.06[a]11.7 ± 0.22[b]3.21 ± 0.11[a]2.68 ± 0.11[a]
 Medulla, μmol/g dry weight3.14 ± 0.13[a]12.4 ± 0.27[b]3.33 ± 0.13[a]3.25 ± 0.02[a]
 Cortex, μmol/g dry weight3.35 ± 0.26[a]11.1 ± 0.18[b]3.29 ± 0.10[a]2.81 ± 0.20[a]

Mean ± SEM, n = 7–10. Results that do not share a letter are significantly different, P < 0.05.

Iron distribution and ferritin expression in the renal medulla and cortex

Iron accumulation was observed by Perls’ Prussian blue staining in the renal medulla of Heph/Cp KO mice, but no iron was observed in the corresponding region in the kidneys of WT, Cp KO or Heph KO mice (Fig. 1A). Some iron accumulation was also observed in the renal cortex of Heph/Cp KO mice, but not in mice with other genotypes (Fig. 1B). At higher magnification (1000X, Fig. 1A,B right hand panels), iron was observed intracellularly, but on the apical side of renal tubular cells and the Loop of Henle in Heph/Cp KO mice. Consistent with this elevated iron, western blotting showed that ferritin protein expression was increased in the renal medulla (Fig. 1C,E) and cortex (Fig. 1D,F) of Heph/Cp KO mice, but not in mice of any of the other genotypes All levels were normalized to tubulin and then normalized to ferritin expression in WT mice.
Figure 1

Iron staining and ferritin protein expression in the renal medulla and cortex.

Iron levels and distribution were determined by Perls’ Prussian blue staining of kidney sections. Representative photomicrographs of the medulla (A) and cortex (B) are shown. Strongest iron deposition was observed in the medulla of Heph/Cp KO mice. Ferritin protein expression was assessed by Western blotting in the renal medulla (C) and renal cortex (D) of WT, Heph/Cp KO, Cp KO, and Heph KO mice. Tubulin served as a loading control. Levels of ferritin protein were quantified by densitometry and these results are shown in parts E (medulla) and F (cortex). Ferritin expression was normalized to tubulin, and then presented as a ratio of ferritin expression in WT mice. Values are presented as the mean ± SEM, n = 4–5 mice per genotype. Within each panel, bars without common letters are significantly different, P < 0.05.

Expression of iron transport proteins in the renal medulla and cortex

Both HEPH and CP protein were detected in the renal medulla and cortex of WT mice (Fig. 2A,B). As expected, no CP protein expression was detected in the kidneys of Heph/Cp KO or Cp KO mice, and no HEPH protein expression in Heph/Cp KO or Heph KO mouse kidneys. Interestingly, CP protein expression was lower in the renal medulla of Heph KO mice than WT, but no difference was detected in the cortex (Fig. 2E,F). FPN1 protein expression was similar for all genotypes in both the cortex and medulla (Fig. 2C,D,I,J). Both DMT1 And TFR1 protein expression were significantly decreased in the renal medulla of Heph/Cp KO mice compared to the other groups (Fig. 3A,C,E). While DMT1 protein expression was no significantly difference in the renal cortex of genotype mice (Fig. 3B,D). TFR1 protein expression in the renal cortex was similar in mice of all genotypes (Fig. 3B,F).
Figure 2

CP, HEPH, and FPN1 protein expression in the renal medulla and cortex.

Western blotting was used to investigate CP (A,B,E,F), HEPH (A,B,G,H) and FPN1 (C,D,I,J) expression in the renal medulla (left hand panels) and cortex (right hand panels) of WT, Heph/Cp KO, Cp KO and Heph KO mice. Tubulin served as a loading control. For the blots of FPN1, the samples were not heated prior to loading onto the gels. Levels of Cp (E,F), Heph (G,H) and FPN1 (I,J) protein were quantified by densitometry. All levels were normalized to tubulin. Values are presented as the mean ± SEM, n = 4–5 mice per group. Within each panel, bars without common letters are significantly different, P < 0.05.

Figure 3

DMT1 (IRE) and TFR1 protein expression in the renal medulla and cortex.

Western blotting was used to assess the levels of DMT1 (A–D) and TFR1 (A,B,E,F) protein expression in the renal medulla (left hand panels) and cortex (right hand panels) of WT, Heph/Cp KO, Cp KO, and Heph KO mice. Tubulin served as a loading control. For DMT1 blots, 150 μg of protein was loaded per well for renal medulla and 40 μg of protein was loaded per well for renal cortex. Densitometric analysis of the western blots is shown for DMT1 (C,D) and TFR1 (E,F) protein. All levels were normalized to tubulin. Values are presented as mean ± SEM, n = 4–5 mice per group. Within each panel, bars without common letters are significantly different, P < 0.05.

Expression of iron transporter genes in the renal medulla and cortex

Cp, Heph, Fpn1, Dmt1 and Tfrc mRNA expression was examined by quantitative RT-PCR in the renal cortex and medulla of Heph KO, Cp KO, Heph/Cp KO and WT mice at 6 months of age (Fig. 4). There was no detectable Cp mRNA expression in Heph/Cp KO or Cp KO mice (Fig. 4A,C), and no Heph mRNA expression in Heph/Cp KO or Heph KO mouse kidneys (Fig. 4B,D). Fpn1 and Dmt1-IRE mRNA expression levels were not significantly different between any of the mouse groups examined (Fig. 4E,G,I,K). Dmt1 + IRE mRNA expression in the renal medulla, however, was significantly lower in Heph/Cp KO mice compared to WT mice (Fig. 4F), and Dmt1 + IRE mRNA expression in the renal cortex was significantly higher in Heph/Cp KO mice compared to all other groups (Fig. 4H). Tfrc mRNA expression in the renal medulla was significantly lower in Heph/Cp KO and WT mice compared to Heph KO and Cp KO mice, and its expression in Heph/Cp KO medulla was significantly lower than that of WT mice (Fig. 4J). In contrast, Tfrc mRNA expression in the renal cortex was significantly higher in Heph/Cp KO mice compared to the other groups (Fig. 4L).
Figure 4

Expression of iron transport-related genes in the renal medulla and cortex.

The mRNAs encoding Cp (A,C), Heph (B,D), Fpn1 (E,G), Dmt1 + IRE (F,H), Dmt1-IRE (I,K), and Tfrc (J,L) were measured in the renal medulla and cortex of WT, Heph/Cp KO, Cp KO, and Heph KO mice at 6 months of age by quantitative reverse-transcription polymerase chain reaction. GAPDH was used as a reference gene. Values are presented as mean ± SEM, n = 5 mice per group. Within each panel, bars without common letters are significantly different, P < 0.05.

Urinary iron, protein content and HE, PAS staining in the renal medulla and cortex

Renal function was assessed by testing total urine iron and protein concentrations. Total iron content was measured in the urine of four group mice. Data were normalized to urine CR and expressed as microgram iron per milligram CR. The urinary iron and creatinine (CR) ratios were significantly increased in Heph/Cp KO mice compared to the other groups, and were significantly decreased in Heph KO mice compared to the other groups (Fig. 5A). The urinary protein and CR ratios were significantly increased in Heph/Cp KO mice compared to the other groups (Fig. 5B). The main renal injury location was in renal tubules in Heph/Cp KO mice. Morphological examination was performed by HE and PAS staining of renal medulla and cortex in four group mice, the results showed that renal tubular cells of medulla were dilated and nucleus shedding was obvious, and there was structural injury to the renal medulla in Heph/Cp KO mice. The number of renal tubular cells of medulla was lower in Heph/Cp KO mice compared to other three groups (Fig. 5C,E), but Morphological examination showed that there are no significant histological changes in the renal cortex of four group mice (Fig. 5D,F).
Figure 5

Urinary iron, protein content and H&E, PAS staining in the renal medulla and cortex.

Total iron content in the urine of WT, Heph/Cp KO, Cp KO, and Heph KO mice was measured and total urine iron content was normalized to urine CR (A). Total protein concentration of WT, Heph/Cp KO, Cp KO, and Heph KO mice was measured and normalized to the urinary CR (B). Values are means ± SEM, n = 10 mice per group. Within each panel, bars without common letters are significantly different, P < 0.05. Representative photomicrographs of H&E and PAS staining for the tissues of renal medulla (C,E) and renal cortex (D,F) in WT, Heph/Cp KO, Cp KO, and Heph KO mice. The images were taken at high power (400×) and oil (1000×) lens.

Discussion

Our current study demonstrated that the iron concentration increased in the liver and decreased in the serum in Cp single and Heph/Cp double KO mice, and only increased in the kidney of Heph/Cp double KO mice. In Heph KO mice, however, there was a reduction in iron levels in plasma, liver and kidney (Table 2), as well as decreased urinary iron excretion. These data suggest that Heph KO mice have a systemic iron deficiency. Heph/Cp double KO mice had a low plasma iron content with increased total urinary iron, suggesting decreased renal iron reabsorption, which in turn probably induced renal injury. Previous research showed that mice with a combination of Cp loss and sla mutant Heph had high iron concentrations in the liver, brain, heart and pancreas25. The kidney was not examined. CP is mainly found as a soluble serum protein originating from the liver, but it is also found as a membrane-bound GPI-linked protein. The GIP-Cp first described to be present on the surface of astrocytes26, and current reported on the plasma membrane of spleen and kidney6. Our previous work demonstrated that HEPH is located in a supra-nuclear compartment and on the basolateral membrane of intestinal enterocytes3. Apical iron administration can lead to the mobilization of HEPH from intracellular sites to the basolateral membrane in MDCK cell line4. But the location of CP and HEPH in the kidney is still unclear. Our work shows that the deletion of either CP or HEPH has little impact on the kidney, but deletion of both MCFs leads to kidney iron deposition and this in turn impacts kidney function. These results suggest that there is redundancy in the role played by MCFs in renal iron homeostasis, with either single oxidase being able to sustain normal kidney iron metabolism when the other is lost. CP and HEPH are MCFs that are known to work in concert with FPN1 to increase the efficiency of cellular iron export27. Existing data suggest that HEPH is the major oxidase involved in iron release from intestinal enterocytes18, while CP facilitates iron export from other tissues819. Our current work demonstrates that Cp, Heph, and Fpn1 mRNA and protein are all present in the mouse kidney, consistent with previous studies527, and iron accumulation in the renal tubular cells and those in the Loop of Henle of Heph/Cp KO mice suggests that the oxidases are functional in this organ. Perls’ staining showed iron accumulation in both the renal medulla and cortex, but iron levels were highest in the medulla. The levels of ferritin protein expression in the medulla and cortex were consistent with elevated intracellular iron in these regions, and maximum iron accumulation in the medulla. The greater number of tubular cells (including distal tubular cells and those of the loop of Henle) in the renal medulla than in the renal cortex may explain this difference in iron load. Previous reports have suggested that most iron is reabsorbed by the proximal tubules, but the distal tubules also play a role in this process12. Our current data support the idea that the loop of Henle and the distal tubule also re-absorb iron. Compared with the renal medulla, the renal cortex had more glomerular and proximal tubular cells, the protein level of DMT1 was up-regulated in renal cortex of Heph/Cp KO mice may help to increase the iron transport and re-absorb when iron accumulated in the renal medulla of Heph/Cp KO mice, which may explain why the DMT1 protein was increased in the Cp/Heph KO mice cortex. Consistent with this, the cortex of the Heph/Cp KO mice had increased transferrin receptor and Dmt1 mRNA levels. This region is likely to be particularly important in conceiving iron that is not re-absorbed by the tubular cells of the cortex it induces part of cortex proximal tubular cells to up-regulated DMT1 protein levels to reabsorb urinary iron, which may explain why the DMT1 protein was increased in the Cp/Heph KO mice cortex. Consistent with this, the cortex of the Heph/Cp KO mice had increased transferrin receptor and Dmt1 mRNA levels. A small percentage of TF-bound iron is filtered through the glomeruli of the kidney1415, and this iron is then reabsorbed by the proximal tubules16, Loop of Henle, and distal tubular cells12, likely still bound to TF. If these cells are unable to export iron across their basolateral membrane, intracellular iron accumulation would be expected. The apical supranuclear location of HEPH in MDCK and Caco2 cells, as well as results from colocalization studies in Cos7 cells, suggests that HEPH can localizes to recycling endosomes4. However, in vivo, in polarized mouse intestinal enterocytes, HEPH is present both on the lateral surfaces of enterocytes and also in the apical supranuclear region3, so precisely where it acts is unclear. If similar machinery is present in the kidney to enable vectorial transport of iron, relocalization of HEPH from a supranuclear compartment to the basolateral membrane may play a role in moving iron from the nephron lumen into the circulating blood, likely in conjunction with FPN1. Fpn1 mRNA and protein levels in the kidney did not vary significantly between mice of different genotypes, suggesting that FPN1 protein levels are insensitive to kidney iron accumulation. Nevertheless, the efficiency of export can still be enhanced by MCFs. Double knockout of Heph and Cp resulted in changes in the expression of other genes involved in iron metabolism. In the renal medulla, where ferritin protein expression and iron levels were significantly increased, Dmt1 + IRE and Tfrc mRNA levels, and DMT1 and TFR1 protein expression were significantly reduced. Recent studies suggest that DMT1 is localized to the late endosomal and lysosomal membranes of proximal tubule cells, where it facilitates the uptake of TF-bound iron1628. Dmt1 + IRE and Tfrc mRNA levels can respond to the local iron status of the renal medulla, presumably through IRP-IRE–mediated mechanisms293031. Wareing et al.28 have reported that rats fed an iron deficient diet had significantly increased renal DMT1 expression, while rats fed an iron-enriched diet showed a significant decrease in renal DMT1 expression. Thus renal DMT1 expression is sensitive to dietary iron content. Dmt1 + IRE mRNA contains a single IRE in its 3′-untranslated region, similar to those in the Tfrc mRNA, and this element confers iron-dependent mRNA stabilization30. We hypothesize that lack of Heph/Cp results in reduced iron export from renal cells, which in turn results in cellular iron overload and decreased Dmt1 and Tfrc expression. We propose that the role played by HEPH or CP protein in the kidney is similar to that of other cells types. Under physiological conditions, iron reabsorption is mediated through the uptake diferric TF by TFR1 and/or cubilin on the apical surface of the epithelial cells in the renal tubules1015. Transferrin-bound iron is transported into endosomes, where ferric iron dissociates from transferrin and is reduced to the ferrous state, possibly by STEAP33233. Iron is then exported from the endosomes into the cytoplasm by DMT116. This iron can be utilized by cell itself, or exported back into the circulation via FPN1, a process in which HEPH and CP participate. Lack of HEPH and CP would be expected to block this final iron export step. Our current result has showed that iron reuptake is stuck in the apical side of renal tubular cells. It could be explained that a defective iron export at the basolateral membrane could block the mobilization of HEPH (maybe CP) from intracellular sites to the basolateral membrane, and cause stopping of iron transport at the apical side. For understanding a detailed process, the further study is needed. Excess intracellular iron is toxic and prolonged exposure can lead to the generation of reactive oxygen species and tissue damage. Our demonstration that mice lacking both MCFs showed significant increase urinary iron excretion, proteinuria, as well as morphological abnormalities in the renal tubules suggests considerable structural and functional damage to the kidney. Together, these findings suggest that MCFs play an important role in protecting the kidney against injury. In summary, our work has provided further insights into iron transport pathways in the kidney and has shown that copper-dependent ferroxidases play an important role in the homeostasis of this essential organ.

Methods

Mice

Heph KO and Cp KO mouse strains have been previously described83435. The mice were originally obtained from the laboratory of Dr Greg Anderson at the QIMR Berghofer Medical Research Institute (Brisbane, Australia) and were bred and maintained at the Medical School of Nanjing University36. Heph (Heph KO) mice were bred to Cp (Cp KO) mice to generate Heph/Cp (Heph/Cp KO) mice. All mice were on the C57BL/6J genetic background and were allowed unlimited access to a standard rodent unpurified diet containing approximately 180 mg/kg iron provided by Jiangsu Province Collaborative Medical Bioengineering Co., Ltd37. All animal studies were carried out in accordance with NIH guidelines, as described in the Guide for the Care and Use of Laboratory Animals of the NIH, and were approved by the Institutional Animal Care and Use Committee of Nanjing University.

Tissue preparation

Male mice from each litter were euthanized at 6 months of age after anesthesia with an intra-peritoneal injection of 3% sodium pentobarbital. Blood was collected by cardiac puncture using potassium EDTA tubes (catalogue no. 367841, Becton Dickinson and Company, Franklin Lakes) and the liver and kidney were removed. Whole blood was used for hematological analysis and centrifuged to provide plasma for iron measurement as previously described38. A piece of liver and the whole left kidney were dried by heating at 80–100 °C for 2 hours and used for subsequent iron analysis. Four mice in each genotype group were perfused via the heart, first with phosphate buffered saline (PBS), then with 4% Paraformaldehyde (PFA). Collected tissues were immediately fixed in 4% PFA solution. Tissues were embedded in paraffin and sectioned for future immunostaining experiments. The kidney was dissected to separate the cortex and medulla. Samples of each were snap frozen in liquid nitrogen and then stored at −80 °C until required for RNA, protein, and iron concentration analyses.

Tissue iron staining and iron status measurements

For immunostaining experiments, tissue was embedded in paraffin, sectioned and stained for ferric iron using Perls’ Prussian blue staining as previously described35. Other sections were detected with H&E or periodic acid Schiff (PAS) staining following the standard procedure. Blood hemoglobin and hematocrit levels were measured by an Automated Hematology Analyzer XS series (XS-800i Sysmex Corporation; Japan) in the Clinical Laboratory at Nanjing Drum Tower Hospital, The Affiliated Hospital of Nanjing University Medical School. The total concentration of iron in the dried tissues and plasma was measured using an Atomic Absorption Spectrometer (180–80, Hitachi; Japan) at the Modern Instrumental Analysis Center of Nanjing University after nitric acid digestion38. The concentration of non-heme iron in the renal cortex, renal medulla and total kidney was measured as previously described by a modification of the bathophenanthroline assay described by Torrance and Bothwell39. Data are expressed as μmol Fe/g dry weight or μmol Fe/L plasma.

Total RNA extraction and qRT-PCR analysis

Total RNA was isolated from mouse tissues using TRIzol reagent (Invitrogen) according to the manufacturer’s protocol. Three micrograms of total RNA were reverse transcribed using a Transcriptor First stand cDNA Synthesis Kit (Roche Applied Science) and qRT-PCR was used to measure the expression of Dmt1 (the transcripts with and without an iron responsive element; Dmt1 + IRE and Dmt1-IRE respectively), Fpn1, Heph, Cp, and Tfrc in different parts of the kidney. All primers (Table 3) were designed by Primer3 software using the default settings40. Expression levels were normalized to that of the housekeeping gene GAPDH. Two-step PCR was monitored in real time by the FastStart Universal SYBR-Green Master (Roche Applied Science) according to the manufacturer’s instructions on an Applied Biosystems 7300 Real-Time PCR System instrument (Life Technologies, Shanghai, China). Fluorescence curves were analyzed with the LightCycler software (version 3.5.3). Automated calculation of crossing points was carried out by the second-derivative maximum method. Each reaction showed a single specific peak in the corresponding melting curve.
Table 3

Sequences of primers for quantitative RT-PCR.

TargetForward primerReverse primer
CpTCTACCAAGGAGTAGCCAGGAATCTTCCCTCTCATCCGTGC
HephGAATTTTGCGAGCCGACCTTTCATCCGCTTTCAGATACCC
Fpn1TGTACCATGGATGGGTCCTTTGCCACAACAACAATCCAGT
Dmt1 + IRETAGGCTGTGCTCAAACCTACAGCATACATGAGAGCCAGGCATGGTAGA
Dmt1-IRECTCAGGTCTTCCTGGACAGCCGCGTAGAGTGGGAAGAAAG
TfrcGGTGTTGCGGCGAAGTCCAGTACTCAGTGGCACCAACAGCTCC
GAPDHAACTTTGGCATTGTGGAAGGGGATGCAGGGATGATGTTCT

The targets are designated by their gene symbols.

Immunoblot analysis

Kidney regions from 6 month old WT, Heph/Cp KO, Cp KO, and Heph KO mice (n = 4–5 per genotype) were homogenized in 1 X PBS containing 1% Triton X-100, 0.1% SDS, and a protease inhibitor cocktail (Calbiochem.com, catalogue no. 539134). The total protein concentration was determined by the bicinchoninic acid (BCA) method (Bioworld Technology CO., MN). For most studies, samples containing 20–100 μg of protein were denatured by boiling for 5 minutes in 2 X SDS sample buffer. The proteins were separated by SDS–PAGE (7.5% acrylamide running gel) and transferred to nitrocellulose membranes. For FPN1 immunoblots, the samples were not heated. Blots were first incubated for 1 hour with blocking buffer (PBS containing 0.1% Tween-20 and 10% nonfat dry milk), and then incubated with primary antibodies overnight at 4 °C. The following primary antibodies were used: Anti-CP rabbit polyclonal antibody (1:1000; catalogue no. AP7340a, Abgent, CA); anti-HEPH rabbit polyclonal antibody raised against an N-terminus oligopeptide of hephaestin (Hp2, 1:1000)4; anti-FPN1 rabbit polyclonal antibody (Ireg1, 1:1000)27; anti-DMT1(IRE) rabbit antiserum (1:1000)41; anti-TFR1(CD71) mouse monoclonal antibody (1:1000; catalogue no. 136890, Life technologies, USA); anti-ferritin light chain (D-9) mouse monoclonal antibody (1:1000; catalogue no. sc-74513, Santa Cruz Biotech, CA); and anti-β-tubulin mouse monoclonal antibody (1:5000; catalogue no. M20005, Abmart, Shanghai, China). Blots were then washed 3 times in 0.1% PBS-Tween, incubated for 1 hour at room temperature with 1:2000 diluted peroxidase-labeled anti-mouse secondary antibody (catalogue no. sc-2031, Santa Cruz Biotech, CA) or 1:40000 diluted peroxidase-labeled anti-rabbit secondary antibody (catalogue no. sc-2030, Santa Cruz Biotech, CA), and signals were visualized by enhanced chemiluminescence (Thermo Scientific). Protein levels were then quantified by densitometry using UN-SCAN-IT software (Silk Scientific Corporation).

Measurement of Urine iron, protein and Creatinine

Base-line urine was collected in all group mice. Total iron content in the urine of all group mice was measured using an atomic absorption spectrometer as previously described. Urinary protein concentration was measured using the bicinchoninic acid assay (Bioworld Technology CO., MN) and urine creatinine (CR) levels were measured using the creatinine assay kit (Jian Cheng Biological Engineering Institute, Nanjing, China) according to the manufacture’s instruction. Total urine iron content was normalized to urine CR and the urine protein excretion rate was expressed as the ratio of the urinary protein to urine CR.

Statistical analysis

Unless otherwise indicated, values are presented as means ± SEM. One-way ANOVA with Tukey’s test for multiple comparisons was used to compare means for mouse tissue iron concentrations (i.e., liver, kidney, and plasma) and protein levels (i.e., L-ferritin, HEPH, CP, FPN1, DMT1 and TFR1) among the four groups. One-way ANOVA with Dunnett’s test for multiple comparisons was used to compare means for gene expression (i.e., Heph, Cp, Fpn1, Dmt1 + IRE, Dmt1-IRE, and Tfrc) with WT control expression. Differences were considered statistically significant at P < 0.05. All statistical analyses were performed using GraphPad Prism 6 Software (GraphPad Software, San Diego, CA).

Additional Information

How to cite this article: Jiang, B. et al. Hephaestin and ceruloplasmin facilitate iron metabolism in the mouse kidney. Sci. Rep. 6, 39470; doi: 10.1038/srep39470 (2016). Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
  41 in total

Review 1.  Aceruloplasminemia: an inherited neurodegenerative disease with impairment of iron homeostasis.

Authors:  Xueying Xu; Sokhon Pin; Muraya Gathinji; Ralph Fuchs; Z Leah Harris
Journal:  Ann N Y Acad Sci       Date:  2004-03       Impact factor: 5.691

2.  A mutation in the ceruloplasmin gene is associated with systemic hemosiderosis in humans.

Authors:  K Yoshida; K Furihata; S Takeda; A Nakamura; K Yamamoto; H Morita; S Hiyamuta; S Ikeda; N Shimizu; N Yanagisawa
Journal:  Nat Genet       Date:  1995-03       Impact factor: 38.330

3.  Report of the American Institute of Nurtition ad hoc Committee on Standards for Nutritional Studies.

Authors: 
Journal:  J Nutr       Date:  1977-07       Impact factor: 4.798

4.  A simple technique for measuring storage iron concentrations in formalinised liver samples.

Authors:  J D Torrance; T H Bothwell
Journal:  S Afr J Med Sci       Date:  1968-04

5.  Glomerular protein sieving and implications for renal failure in Fanconi syndrome.

Authors:  A G Norden; M Lapsley; P J Lee; C D Pusey; S J Scheinman; F W Tam; R V Thakker; R J Unwin; O Wrong
Journal:  Kidney Int       Date:  2001-11       Impact factor: 10.612

6.  In vivo characterization of renal iron transport in the anaesthetized rat.

Authors:  M Wareing; C J Ferguson; R Green; D Riccardi; C P Smith
Journal:  J Physiol       Date:  2000-04-15       Impact factor: 5.182

7.  Hephaestin, a ceruloplasmin homologue implicated in intestinal iron transport, is defective in the sla mouse.

Authors:  C D Vulpe; Y M Kuo; T L Murphy; L Cowley; C Askwith; N Libina; J Gitschier; G J Anderson
Journal:  Nat Genet       Date:  1999-02       Impact factor: 38.330

8.  Megalin-dependent cubilin-mediated endocytosis is a major pathway for the apical uptake of transferrin in polarized epithelia.

Authors:  R Kozyraki; J Fyfe; P J Verroust; C Jacobsen; A Dautry-Varsat; J Gburek; T E Willnow; E I Christensen; S K Moestrup
Journal:  Proc Natl Acad Sci U S A       Date:  2001-10-16       Impact factor: 11.205

Review 9.  Novel approaches targeted toward oxidative stress for the treatment of chronic kidney disease.

Authors:  Sundararaman Swaminathan; Sudhir V Shah
Journal:  Curr Opin Nephrol Hypertens       Date:  2008-03       Impact factor: 2.894

10.  Iron accumulation in human chronic renal disease.

Authors:  B J Nankivell; R A Boadle; D C Harris
Journal:  Am J Kidney Dis       Date:  1992-12       Impact factor: 8.860

View more
  13 in total

1.  Acute and Chronic Iron Overloading Differentially Modulates the Expression of Cellular Iron-homeostatic Molecules in Normal Rat Kidney.

Authors:  Bassem Refaat; Abdelghany Hassan Abdelghany; Mohammad A BaSalamah; Mohamed El-Boshy; Jawwad Ahmad; Shakir Idris
Journal:  J Histochem Cytochem       Date:  2018-06-06       Impact factor: 2.479

Review 2.  Dynamic and cell-specific transport networks for intracellular copper ions.

Authors:  Svetlana Lutsenko
Journal:  J Cell Sci       Date:  2021-11-04       Impact factor: 5.285

Review 3.  Lactoferrin: from the structure to the functional orchestration of iron homeostasis.

Authors:  Giusi Ianiro; Luigi Rosa; Maria Carmela Bonaccorsi di Patti; Piera Valenti; Giovanni Musci; Antimo Cutone
Journal:  Biometals       Date:  2022-10-10       Impact factor: 3.378

Review 4.  The biology of mammalian multi-copper ferroxidases.

Authors:  Sheridan L Helman; Jie Zhou; Brie K Fuqua; Yan Lu; James F Collins; Huijun Chen; Christopher D Vulpe; Gregory J Anderson; David M Frazer
Journal:  Biometals       Date:  2022-02-15       Impact factor: 3.378

5.  Perls' Prussian Blue Stains of Lung Tissue, Bronchoalveolar Lavage, and Sputum.

Authors:  Andrew J Ghio; Victor L Roggli
Journal:  J Environ Pathol Toxicol Oncol       Date:  2021       Impact factor: 3.567

6.  Novel Dent disease 1 cellular models reveal biological processes underlying ClC-5 loss-of-function.

Authors:  Mónica Durán; Carla Burballa; Gerard Cantero-Recasens; Cristian M Butnaru; Vivek Malhotra; Gema Ariceta; Eduard Sarró; Anna Meseguer
Journal:  Hum Mol Genet       Date:  2021-07-09       Impact factor: 6.150

Review 7.  Iron Metabolism in the Tumor Microenvironment-Implications for Anti-Cancer Immune Response.

Authors:  Alessandro Sacco; Anna Martina Battaglia; Cirino Botta; Ilenia Aversa; Serafina Mancuso; Francesco Costanzo; Flavia Biamonte
Journal:  Cells       Date:  2021-02-02       Impact factor: 6.600

8.  Large scale expression and purification of secreted mouse hephaestin.

Authors:  Chandrika N Deshpande; Vicky Xin; Yan Lu; Tom Savage; Gregory J Anderson; Mika Jormakka
Journal:  PLoS One       Date:  2017-09-07       Impact factor: 3.240

9.  Severe Iron Metabolism Defects in Mice With Double Knockout of the Multicopper Ferroxidases Hephaestin and Ceruloplasmin.

Authors:  Brie K Fuqua; Yan Lu; David M Frazer; Deepak Darshan; Sarah J Wilkins; Linda Dunn; Alex V Loguinov; Scott C Kogan; Pavle Matak; Huijun Chen; Joshua L Dunaief; Chris D Vulpe; Gregory J Anderson
Journal:  Cell Mol Gastroenterol Hepatol       Date:  2018-06-23

10.  Effects of Dietary Glucose and Fructose on Copper, Iron, and Zinc Metabolism Parameters in Humans.

Authors:  Nathaniel H O Harder; Bettina Hieronimus; Kimber L Stanhope; Noreene M Shibata; Vivien Lee; Marinelle V Nunez; Nancy L Keim; Andrew Bremer; Peter J Havel; Marie C Heffern; Valentina Medici
Journal:  Nutrients       Date:  2020-08-25       Impact factor: 5.717

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.