Literature DB >> 27978536

Downregulation of FBP1 Promotes Tumor Metastasis and Indicates Poor Prognosis in Gastric Cancer via Regulating Epithelial-Mesenchymal Transition.

Jing Li1,2, Ying Wang1, Qing-Guo Li3,4, Jin-Jun Xue1, Zhu Wang1, Xin Yuan1, Jian-Dong Tong1, Li-Chun Xu2.   

Abstract

BACKGROUND: Recent studies indicated that some glycolytic enzymes are complicated, multifaceted proteins rather than simple components of the glycolytic pathway. FBP1 plays a vital role in glucose metabolism, but its role in gastric cancer tumorigenesis and metastasis has not been fully understood.
METHODS: The prognostic value of FBP1 was first studied in The Cancer Genome Atlas (TCGA) database and validated in in-house database. The effect of FBP1 on cell proliferation and metastasis was examined in vitro. Nonparametric test and Log-rank test were used to evaluate the clinical significance of FBP1 expression.
RESULTS: In the TCGA cohort, FBP1 mRNA level were shown to be predictive of overall survival in gastric cancer (P = 0.029). In the validation cohort, FBP1 expression were inversely correlated with advanced N stage (P = 0.021) and lymphovascular invasion (P = 0.011). Multivariate Cox regression analysis demonstrated that FBP1 was an independent predictor for both overall survival (P = 0.004) and disease free survival (P<0.001). Functional studies demonstrated that ectopic FBP1 expression inhibited proliferation and invasion in gastric cancer cells, while silencing FBP1 expression had opposite effects (P<0.05). Mechanically, FBP1 serves as a tumor suppressor by inhibiting epithelial-mesenchymal transition (EMT).
CONCLUSIONS: Downregulation of FBP1 promotes gastric cancer metastasis by facilitating EMT and acts as a potential prognostic factor and therapeutic target in gastric cancer.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27978536      PMCID: PMC5158319          DOI: 10.1371/journal.pone.0167857

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Cancer is still one of the biggest threatens to human health. Among all cancer types, gastric cancer (GC) is the one of most frequently diagnosed causes of death worldwide. It is estimated that there will be 26,370 new gastric cancer cases and 10,730 deaths occurred in USA, and the incidence rate were the highest in Eastern Asia, Central and Eastern Europe, and South America [1]. Despite the wide usage of advanced surgical techniques, chemotherapy, and targeted therapy, the overall recovery rate for patients continues to remain poor [2]. GC pathogenesis is a complex, multistage, and heritage-related process. So far, the mechanisms are far from understood. Various pathological and epidemiological studies have provided evidence that activation of oncogenes and inactivation of tumor suppressive genes play crucial roles in gastric carcinogenesis [3, 4]. Increasing evidence in recent years indicates that cancer is a metabolic disease [5], in which cells have lost their normal check-points on cell proliferation, resulting in excessive bioenergetic and biosynthetic needs [6, 7]. To sustain such a high demand, cancer cells must alter their metabolism. The most well-known metabolic reprogramming of tumor cells involves increased glucose uptake and glycolytic capacity, even in the presence of a high oxygen concentration, as first described by Otto Warburg over 90 years ago, also known as the “Warburg effect” [8, 9]. The glycolysis pathway is upregulated and gluconeogenesis is inhibited to exert this “Warburg effect” on proliferation and tumourigenicity of cancer cells [10]. Fructose-1, 6-bisphosphatase (FBP) is one of the key enzymes in glucose metabolism. This enzyme catalyses the hydrolysis of fructose-1, 6-bisphosphate to fructose-6-phosphate and inorganic phosphate, and exists as two isoenzymes in mammals: FBP1 and FBP2 [7]. FBP2 participates in glycogen synthesis from carbohydrate precursors. It negatively regulates cell growth, and inhibits carcinogenesis of GC [7]. FBP1 acts as a rate-limiting enzyme in gluconeogenesis and it has been validated as a strong tumor suppressor in renal cancer and basal-like breast cancer [11-13]. However, the role of FBP1 in GC has not been studied. In the present study, we first studied FBP1 and FBP2 in The Cancer Genome Atlas (TCGA) and found that reduced FBP1 expression was associated with poor overall survival (OS) in GC patients, and validated the prognostic value of FBP1 in in-house GC samples by immunohistochemical (IHC) staining. Functional study demonstrated that ectopic FBP1 expression inhibited proliferation and invasion in gastric cancer cells, while silencing FBP1 expression had opposite effects.

Methods

Patients and tissue samples

For the TCGA cohort, expressions of FBP1 and FBP2 and clinical data of TCGA RNA sequence database are acquired from the website of Cancer Genomics Browser of University of California Santa Cruz (UCSC) (https://genome-cancer.ucsc.edu/). Inclusion criteria were: patients with no pretreatment, with fully characterized tumors and intact OS information. Follow-up was completed on Dec 21, 2014. The clinical characteristics of these patients are shown in Table 1.
Table 1

Clinical characteristics of patients with gastric cancer in TCGA and validation cohort.

VariableTCGA(n = 360)Validation Cohort(n = 186)
N%N%
Sex
Male23465.09953.2
Female12635.08746.8
Age(median, range)6530–905919–81
Primary site
Antrum/Distal13738.16937.1
Cardia/Proximal4813.36736.0
Fundus/Body13236.73619.4
Gastroesophageal Junction3710.3147.5
Unspecific61.700
Grade
G1/G213336.97841.9
G321860.610858.1
Gx92.500
T stage
T1174.773.8
T27019.42412.9
T316746.48244.1
T410529.27339.2
Tx10.300
N stage
N011331.45228.0
N19426.13518.8
N27220.04725.3
N37520.85228.0
Nx61.700
M stage
M032891.1186186
M1185.000
Mx143.900
The validation cohort consists of 186 patients with histologically confirmed invasive GC who had undergone radical surgical resection between from 2006 to 2010. None of the patients received chemotherapy or radiotherapy prior to surgery. The clinical stage of the tumors was restaged according to the 7th edition TNM classification of the International Union Against Cancer (2009). Follow-up by telephone or at outpatient department was performed until death or June 2015. The project was approved by the ethics committee of Yangzhou No.1 People’s Hospital. The methods were carried out in accordance with the approved guidelines. Written informed consent was obtained from all subjects.

IHC staining of FBP1

IHC examination of FBP1 was performed using rabbit anti-FBP1 polyclonal antibody (Abcam; ab109020; 1:100) on the surgical resection specimens described previously [14]. Tissue sections were first incubated at 68°C for 4 h or overnight, followed by deparaffinizing in xylene; then they were rehydrated in a list of graded alcohols. For retrieval of the FBP1 antigen, the sections were boiled in EDTA buffer (pH = 8.0) for 20 min. After natural cooling under room temperature, the specimens were incubated with 3% (v/v) H2O2 in methanol for another 10 min to block endogenous tissue peroxidase activity, followed by rabbit anti-FBP1 incubation in a moist chamber overnight at 4°C. Negative controls were managed with PBS instead of the primary antibody. Subsequently, the specimens were incubated with a horseradish peroxidase (HRP)-conjugated secondary antibody for 30 min at room temperature. Finally, the slides were incubated with 3,3'-diaminobenzidine (DAB) substrate (Genetech, Shanghai, China) for 2 min. All the immunostained sections were evaluated independently by two expert pathologists who were blinded from the clinical details. If scores differed between the two investigators, the sections were reassessed and discussed by them. A semiquantitative scoring system was used, which evaluated both staining intensity (0, no stain; 1+, weak stain; 2+, moderate stain; 3+, strong stain) and the percentage of stained cells (0, <5%; 1, 5–25%; 2, 26–50%; 3, 51–75%; and 4, >75%). Scores for staining intensity and percentage positivity of cells were then multiplied to generate the immunoreactivity score (IS) for each case. All cases were sorted into two groups according to the IS. High expression of FBP1 was defined as detectable immunoreactions in the cytoplasm with IS≥4 [15].

Cell culture

The human GC cell lines, AGS and MGC803 were originally obtained from the American Type Culture Collection (Manassas, VA, USA). The cells were cultured in 1640 supplemented with 10% fetal bovine serum at 37°C under a humidified atmosphere containing 5% CO2.

Stable transfection of gastric cancer cells

The coding sequence of human FBP1 was amplified and cloned into a lentiviral expression vector, pCDH-CMV-MCS-EF1-Puro, to generate pCDH-FBP1. The shRNA sequences were inserted into a pLKO.1 expression vector to produce pLKO.1-shFBP1. The shRNA target sequences for FBP1 was 5′-CGACCTGGTTATGAACATGTT-3′. AGS and MGC803 cells were transfected with pCDH-FBP1 or the control vector. The MNK45 and SGC7901 were transfected with shRNA-FBP1 or scramble sequence. The cells were selected using puromycin after the cells were transfected with expression vector or control plasmids for 48h.

RNA isolation, reverse transcription, and qRT-PCR

Total RNA was isolated from the GC cells using TRIzol reagent (Thermo Fisher Scientific). RNA concentration and purity were determined using Nanodrop 2000 (Thermo Fisher Scientific). Reverse transcription was performed using the PrimeScript™ RT Master Mix (RR036A, Takara). RT-PCR was carried out on the 7900 real-time PCR system (ABI, Life Technology) to detect each facto. All reactions were performed in triplicate. The primers used for amplification of FBP1 were 5′- CGCGCACCTCTATGGCATT -3′ (Forward) and 5′- TTCTTCTGACACGAGAACACAC -3′ (Reverse), E-cadherin were 5′-CGGGAATGCAGTTGAGGATC-3′ (Forward) and 5′-AGGATGGTGTAAGCGATGGC-3′ (Reverse), N-cadherin were 5′- TGTTTGACTATGAAGGCAGTGG-3′ (Forward) and 5′- TCAGTCATCACCTCCACCAT-3′ (Reverse), Vimentin were 5′- CCCTCACCTGTGAAGTGGAT-3′ (Forward) and 5′- GCTTCAACGGCAAAGTTCTC-3′ (Reverse), β-actin were 5′-CTACGTCGCCCTGGACTTCGAGC-3′ (Forward) and 5′- GATGGAGCCGCCGATCCACACGG-3′. β-actin was used as an internal reference. The relative expression levels were calculated using the RQ value.

Cell transfection

GC cells (1×105 per well) were seeded in six-well plates. After 24 hours, the cells were transfected with pCDH-FBP1/pCDH-puro or FBP1-shRNA/scramble, using Lipofectamine 3000 transfection reagent (Thermo Fisher Scientific, Waltham, MA, USA) following the manufacturer’s protocol. After being transfected for 24 to 48h, cells were collected for future examination. The effects of pCDH-FBP1 transfection were determined by qRT-PCR and western blot 48 hours after transfection.

CCK8 assays

As described in detail previously [15], 96-well plates were seeded with each group of cells at a density of 2000 cells per well and cultured for 24, 48, 72 or 96 h, respectively. 10 μL of CCK8 solution (Dojindo Laboratories, Kumamoto, Japan) was added to each well and incubated for 2h at 37°C. Then, each solution was measured spectrophotometrically at 450nm to determine cell viability. The cell viability of different groups at each measuring time point was compared.

Colony formation assay

Cells were trypsinized and seeded in 6-well plates at a density of 200 cells per well. After 10 days, cells were fixed with 4% formaldehyde for 15 min, stained with 1.0% crystal violet for 5 min, and then counted and photographed. Colony-forming efficiency (CFE %) was defined as the ratio of the number of colonies formed in culture to the number of cells inoculated.

In vitro cell migration and invasion assays

Cell migration and invasion assays were conducted in a 24-well Transwell chamber (Costar, Cambridge, MA) with uncoated membranes or membranes coated with Matrigel (BD Biosciences, San Jose, CA, USA). Cells were trypsinized and 1×104 cells in 100μl of serum-free medium were transferred to the upper chamber and incubated for 24 h. Medium containing with 15% FBS was added to the lower chamber as the chemoattractant. After incubation, the noninvaded cells on the upper membrane surface were removed with a cotton swabs, and the cells that passed through the filter were fixed with 4% paraformaldehyde and stained with crystal violet.

Confocal immunofluorescent analysis

A total of 5×104 cells were seeded into a slide for 24 hours. After 24 hours, the cells were fixed in 4% paraformaldehyde for 30 minutes, permeabilized using 0.5% Triton X-100 for 5 min at room temperature. The cells were incubated with a primary anti-E-cadherin, or anti-Vimentin antibody for 2 hours at room temperature, followed by incubation with a Alexa fluor-594-conjugated secondary antibody (Invitrogen). Nuclei were stained with propidium iodide for 5 minutes when necessary. Fluorescence images were photographed with a confocal microscopy.

Western blotting

Briefly, equal quantities of cellular proteins were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred onto polyvinylidene difluoride membranes, and immunoblotted with primary antibody for detection of E-cadherin (1/1,000 dilution; Abcam, San Francisco, CA, USA), N-cadherin (1/10,000 dilution; Abcam), and Vimentin (1/1,000 dilution; Abcam) overnight at 4°C. After incubation with a secondary antibody, blots were visualized using ECL (Pierce, Thermo Scientific, USA) and detected using a BioImaging System. Relative protein expression was normalized to β-actin.

Statistical analyses

All statistical analyses were performed using Statistical Package for the Social Sciences version 22.0 (SPSS Inc., Chicago, IL, USA). Data is presented as mean ± standard deviation. The means of normally distributed data were compared by either paired sample t-tests or two independent samples t-tests as appropriate. If the results were not normally distributed, Wilcoxon test was used as appropriate. Chi-square or Fisher’s exact test was used to assess the statistical significance of the association between FBP1 and clinicopathologic parameters. A risk score formula for survival prediction was constructed as previously described [16]. Kaplan-Meier method and life-table method were used to calculate the cumulative survival rate. Log-rank test and Cox’s proportional hazard regression model were conducted for univariate and multivariate survival analysis, respectively. A P-value of <0.05 was considered to indicate statistical significance.

Results

FBP1 was a prognostic predictor in GC from TCGA data set

A total of 360 patients with GC were identified in TCGA cohort, including 234 males and 126 females (Table 1). The mRNA expression level of FBP1 ranged from 1.66–8.22 with its mean value of 4.85±1.19. The mRNA expression level of FBP2 varied from 0–5.15 with its mean value of 0.90±0.83. At last follow-up, 99 patients were relapsed and 76 were died. The median follow-up time of this cohort was 32 months. By using the univariable Cox proportional hazards regression analysis, FBP1 was found to be significantly correlated with OS (Hazard ratio (HR) 0.842, 95% Confidence interval (CI) 0.722–0.983, P = 0.029), while FBP2 was not associated with OS (HR 0.949, 95% CI 0.765–1.176, P = 0.631) (Table 2, Fig 1A). The expression level of FBP1 in TCGA cohorts was distributed in a nearly normal fashion (data not shown); therefore, we divided the cohort into low or high expression groups according to median expression level. The log-rank test demonstrated that there were significantly longer OS for patients in FBP1-high subgroup than those in low expression subgroup (P = 0.034; Fig 1B). Specifically, the FBP1 expression was negatively correlated with TNM stage for gastric cancer patients in TCGA database (Fig 1C).
Table 2

Univariate Cox proportional hazards analysis of FBP1 and FBP2 expression and overall survival for patients with gastric cancer in the TCGA cohort (n = 360).

Univariate analysis
FactorHR (95% CI)P
Gender0.681(0.457–1.016)0.060
Age1.023(1.004–1.041)0.014
T category1.375(1.094–1.727)0.007
N stage1.300(1.113–1.518)0.001
M stage1.590(1.132–2.234)0.007
Grade1.313(0.933–1.848)0.119
Tumor location0.971(0.828–1.139)0.721
FBP10.842(0.722–0.983)0.029
FBP20.949 (0.765–1.176)0.631

Abbreviation: CI, confidence interval; HR, hazard ratio

Bold type indicates statistical significance

Fig 1

(A) Survival analysis of Fructose-1, 6-bisphosphatase (FBP) in gastric patients in TCGA cohort. Patients were sorted according to the mRNA expression levels of FBP1. The vertical axis in (I) indicates risk score. The vertical axis in (II) indicates survival time (days). The dotted line in the middle divided the patients into two groups: one group with low risk and the other one with high risk. As the risk score rising, patients had a shorter survival time. (III) Heatmap of the FBP expression profiles. Rows represent FBP1/FBP2, and columns represent patients. (B) The log-rank test demonstrated that there were significantly longer OS for patients in FBP1-high subgroup than those in FBP1-low subgroup (P = 0.034). (C) The FBP1 mRNA decreased significantly from stage I/II to IV (P = 0.035).

Abbreviation: CI, confidence interval; HR, hazard ratio Bold type indicates statistical significance (A) Survival analysis of Fructose-1, 6-bisphosphatase (FBP) in gastric patients in TCGA cohort. Patients were sorted according to the mRNA expression levels of FBP1. The vertical axis in (I) indicates risk score. The vertical axis in (II) indicates survival time (days). The dotted line in the middle divided the patients into two groups: one group with low risk and the other one with high risk. As the risk score rising, patients had a shorter survival time. (III) Heatmap of the FBP expression profiles. Rows represent FBP1/FBP2, and columns represent patients. (B) The log-rank test demonstrated that there were significantly longer OS for patients in FBP1-high subgroup than those in FBP1-low subgroup (P = 0.034). (C) The FBP1 mRNA decreased significantly from stage I/II to IV (P = 0.035).

FBP1 was an independent prognostic factor in validation cohort

To further validate and determine the clinicopathologic significance of FBP1 protein expression, IHC was performed to detect the expression of FBP1 in 186 cases of primary GC (Table 1). As shown in Fig 2, FBP1 protein was localized in the cytoplasm of the tumor cells. FBP1 was highly expressed in 92 (49.5%) GC samples. Comparisons of clinicopathological characteristics between FBP1-high and FBP1-low groups were shown in Table 3. Patients in FBP1-low group had significantly more tumors at advanced N stage (P = 0.021) and with lymphovascular invasion (P = 0.011) than those in FBP1-high group. The median follow-up time was 32 months. At the end of follow-up, 85 patients experienced recurrence and 62 patients died of GC. Kaplan-Meier survival analysis and log-rank test demonstrated that the expression of FBP1 was significantly correlated with OS (HR 0.472, 95% CI 0.281–0.794, P = 0.005) and DFS (HR 0.457, 95% CI 0.294–0.717, P = 0.001) of patients with GC (Tables 4 and 5, Fig 3). Then, the significantly associated variables in univariate log-rank test were incorported into multivariate Cox regression analysis. The results further confirmed that high FBP1 level was an independent prognostic factor for both OS (HR 0.603, 95%CI 0.357–0.989, P = 0.047) and DFS (HR 0.542, 95%CI 0.344–0.854, P = 0.008) in patients with GC (Tables 4 and 5).
Fig 2

Representative pictures of FBP1 expression in gastric cancer tissues.

FBP1 protein was localized in the cytoplasm of the tumor cells. (A) (B) Represent high (A) and low (B) FBP1 expression in gastric cancer tissues. (C) Represent high FBP1expression in normal gastric tissues (Original magnification: 400× for the inserts, 100× for all).

Table 3

Comparison of baseline clinical characteristics based on FBP1 expression levels in validation cohort.

VariableFBP1
Low (%)High (%)P
Sex0.776
Male51(54.3)48(52.2)
Female43(45.7)44(47.8)
Age0.555
≥6048(51.1)43(46.7)
<6046(48.9)49(53.3)
Primary site0.836*
*Antrum/Distal33(35.1)36(39.1)
Cardia/Proximal33(35.1)34(37.0)
Fundus/Body20(23.1)16(17.4)
Gastroesophageal Junction8(8.5)6(6.5)
Grade0.173
G1/G244(46.8)34(37.0)
G350(53.2)58(63.0)
T stage
T1/T212(12.8)19(20.7)0.320
T342(44.7)40(43.5)
T440(42.6)33(35.9)
N stage0.021
N020(21.3)32(34.8)
N115(16.0)20(21.7)
N224(25.5)23(25.0)
N335(37.2)17(18.5)
Lymphovascular invasion0.011
Negative61(64.9)75(81.5)
Positive33(35.1)17(18.5)
Perineural invasion0.547
Negative74(78.7)69(75.0)
Positive20(21.3)23(25.0)

* Fisher’s exact test

Table 4

Univariate and multivariate Cox proportional hazards analysis of FBP1 expressions and overall survival for patients with gastric cancer in the validation cohort.

Univariate analysisMultivariate analysis
FactorHR (95% CI)PHR (95% CI)P
Gender0.906(0.548–1.496)0.699
Age1.179(0.789–1.945)0.519
T category1.777(1.207–2.615)0.0040.993(0.606–1.628)0.978
N stage1.796(1.408–2.291)<0.0011.770 (1.303–2.406)<0.001
Grade1.208(0.721–2.023)0.473
Lymphovascular invasion1.620(0.957–2.741)0.073
Perineural invasion1.840(1.086–3.116)0.0231.849(1.080–3.165)0.025
Tumor location1.209(0.969–1.508)0.092
FBP10.472(0.281–0.794)0.0050.603(0.357–0.989)0.047

Abbreviation: CI, confidence interval; HR, hazard ratio

Bold type indicates statistical significance

Table 5

Univariate and multivariate Cox proportional hazards analysis of FBP1 expressions and disease free survival for patients with gastric cancer in the validation cohort.

Univariate analysisMultivariate analysis
FactorHR (95% CI)PHR (95% CI)P
Gender0.943(0.615–1.446)0.787
Age1.323(0.860–2.036)0.203
T category2.085(1.489–2.920)<0.0011.362(0.908–2.043)0.136
N stage1.677(1.375–2.044)<0.0011.478(1.172–1.862)0.001
Grade1.618 (1.029–2.545)0.0371.399 (0.873–2.242)0.163
Lymphovascular invasion1.515(0.956–2.386)0.077
Perineural invasion2.208(1.408–3.462)0.0012.016(1.274–3.191)0.003
Tumor location1.148(0.950–1.389)0.154
FBP10.459(0.294–0.717)0.0010.542(0.344–0.854)0.008

Abbreviation: CI, confidence interval; HR, hazard ratio

Bold type indicates statistical significance

Fig 3

Kaplan-Meier estimates of the overall survival and disease free survival of gastric cancer patients with different expression levels of FBP1.

The Kaplan-Meier plots were used to visualize the survival probabilities for high and low FBP1 expression in gastric patients. The tick marked on the Kaplan-Meier curves represents the censored subjects. The differences between the two curves were determined by the two-sided log-rank test. (A) overall survival, χ2 = 8.390, P = 0.004; (B) disease free survival, χ2 = 12.401, P<0.001.

* Fisher’s exact test Abbreviation: CI, confidence interval; HR, hazard ratio Bold type indicates statistical significance Abbreviation: CI, confidence interval; HR, hazard ratio Bold type indicates statistical significance

Representative pictures of FBP1 expression in gastric cancer tissues.

FBP1 protein was localized in the cytoplasm of the tumor cells. (A) (B) Represent high (A) and low (B) FBP1 expression in gastric cancer tissues. (C) Represent high FBP1expression in normal gastric tissues (Original magnification: 400× for the inserts, 100× for all).

Kaplan-Meier estimates of the overall survival and disease free survival of gastric cancer patients with different expression levels of FBP1.

The Kaplan-Meier plots were used to visualize the survival probabilities for high and low FBP1 expression in gastric patients. The tick marked on the Kaplan-Meier curves represents the censored subjects. The differences between the two curves were determined by the two-sided log-rank test. (A) overall survival, χ2 = 8.390, P = 0.004; (B) disease free survival, χ2 = 12.401, P<0.001.

FBP1 inhibits GC proliferation and invasion

To evaluate the effect of FBP1 on GC cells, we ectopically expressed FBP1 in AGS and MGC803 cells, which have low endogenous FBP1 expression, and silenced FBP1 expression in MNK45 and SGC7901 cells, which exhibis high endogenous FBP1 expression (Fig 4A). Western blot and qRT-PCR were used to verify increased or decreased levels of FBP1 in the transfected cells, as compared with control cell lines (Fig 4B and 4C). The CCK-8 assays and colony formation assays were carried out to examine whether the overexpression of FBP1 affected GC cell proliferation in vitro. As shown in Fig 4D and 4E, ectopic FBP1 significantly inhibited cell proliferation and growth in vitro (P>0.05), while silencing FBP1 promoted cell proliferation and growth. Transwell migration assay and Matrigel invasion assay showed that ectopic expression of FBP1 inhibited migration and invasion of AGS and MGC803 cells with statistically significant difference. Conversely, silencing FBP1 expression in MNK45 and SGC7901 cells had opposite effects (Fig 4F and 4G) (P<0.05).
Fig 4

FBP1 inhibits GC proliferation and invasion.

(A) Basic FBP1 expression in different gastric cancer cells were demonstrated. The endogenous low FBP1 expression cancer cells AGS and MGC803 were used to be transfected with pCDH-FBP1 or control (empty vector), and the endogenous high FBP1 expression cancer cells MNK45 and SGC7901 were used to be transfected with FBP1-shRNA or scramble control. Western blot (B) and qRT-PCR (C) were used to verify increased or decreased levels of FBP1 in the transfected cells. The CCK-8 assays (D) and colony formation study (E) demonstrated that ectopically expressed FBP1 significantly inhibited gastric cancer cell proliferation, while silencing FBP1 expression dramatically increased cell proliferation. Similarly, Transwell migration assay (F) and Matrigel invasion assay (G) showed that ectopic expression of FBP1 suppressed migration and invasion abilities of AGS and MGC803 cells significantly, and silencing FBP1 had opposite effects. Each bar represents the mean ± SD. of three independent experiments. (*P<0.05).

FBP1 inhibits GC proliferation and invasion.

(A) Basic FBP1 expression in different gastric cancer cells were demonstrated. The endogenous low FBP1 expression cancer cells AGS and MGC803 were used to be transfected with pCDH-FBP1 or control (empty vector), and the endogenous high FBP1 expression cancer cells MNK45 and SGC7901 were used to be transfected with FBP1-shRNA or scramble control. Western blot (B) and qRT-PCR (C) were used to verify increased or decreased levels of FBP1 in the transfected cells. The CCK-8 assays (D) and colony formation study (E) demonstrated that ectopically expressed FBP1 significantly inhibited gastric cancer cell proliferation, while silencing FBP1 expression dramatically increased cell proliferation. Similarly, Transwell migration assay (F) and Matrigel invasion assay (G) showed that ectopic expression of FBP1 suppressed migration and invasion abilities of AGS and MGC803 cells significantly, and silencing FBP1 had opposite effects. Each bar represents the mean ± SD. of three independent experiments. (*P<0.05).

FBP1 suppresses epithelial-mesenchymal transition in human gastric cancer

Since epithelial-mesenchymal transition (EMT) is closely related to cancer cell metastasis ability, and we found FBP1 expression was positively correlated with E-cadherin, a central marker of epithelial cell phenotype, and negatively related with N-cadherin expression in TCGA database (P<0.05, Fig 5A). We next examined EMT markers in FBP1 overexpression or knockdown cells and their control cell lines. We found that ectopic expression of FBP1 was correlated with overexpression of epithelial cell-specific protein, E-cadherin, and repression of mesenchymal markers, Vimentin and N-cadherin, and silencing FBP1 led to opposite effects (Fig 5B and 5C). These results were confirmed by confocal microscopy examination in AGS and MGC803 cells (Fig 5D).
Fig 5

FBP1 suppresses epithelial-mesenchymal transition in gastric cancer.

FBP1 expression was positively correlated with E-cadherin mRNA levels, and negatively correlated with N-cadherin expression in TCGA database (P<0.05). Over-expression of FBP1 resulted in increased expression of E-cadherin and decreased expression of Vimentin and N-cadherin both on protein level (A) and transcriptional level (B). (C) Confocal microscopy analysis of phenotypic marker including E-cadherin, crystal violet Vimentin. The red signal represents the staining of corresponding protein, and the blue signal represents the nuclear DNA staining by DAPI.

FBP1 suppresses epithelial-mesenchymal transition in gastric cancer.

FBP1 expression was positively correlated with E-cadherin mRNA levels, and negatively correlated with N-cadherin expression in TCGA database (P<0.05). Over-expression of FBP1 resulted in increased expression of E-cadherin and decreased expression of Vimentin and N-cadherin both on protein level (A) and transcriptional level (B). (C) Confocal microscopy analysis of phenotypic marker including E-cadherin, crystal violet Vimentin. The red signal represents the staining of corresponding protein, and the blue signal represents the nuclear DNA staining by DAPI.

Discussion

Despite the intense progress achieved in GC diagnosis and therapy, the dismal prognosis has not substantially improved. Thus, the molecular characterization of GC progression and the identification of effective therapeutic target would be urgently needed to improve patients’ prognosis. Recently, great attention has been focused on metabolic reprogramming as a driver of cancer progression. Indeed, metabolic reprogramming now has emerged as one of the hallmarks of cancer, and has been verified linked to cancer cell growth [5, 17, 18]. To be noted, reprogrammed glucose metabolism not only produces abundant ATP but also provides biosynthetic precursors that subsequently are used as cellular building blocks to fuel the uncontrolled proliferation [18]. Altered glucose metabolism is widespread in various cancer cells and is characterized by the increased uptake of glucose, a high rate of glycolysis, enhanced production of lactate, and activation of the pentose phosphate pathway (PPP), as well as by deregulation of mitochondrial oxidative phosphorylation [9, 18, 19]. Recent studies have provided evidence that some glycolytic enzymes are more complicated, multifaceted proteins rather than simple components of the glycolytic pathway. These glycolytic enzymes have acquired additional non-glycolytic functions in transcriptional regulation [20]. For example, MBP-1, which is an alternative splicing form of ENO1, can transcriptionally represses MYC [21, 22]. Hexokinase can inhibit apoptosis by modulating Bax, Bak and Bad [23, 24]. The existence of multifaceted roles of glycolytic proteins suggests that links between metabolic sensors and transcription are established directly through enzymes that participate in metabolism [20]. FBP1 and FBP2 are gluconeogenesis regulatory enzymes. They can extract carbons from glycolysis or promote the flux of carbons against the flow of the glycolytic pathway [25]. RNA sequencing has been widely used to find novel target genes using high-throughput technologies [26]. In the present study, we first studied FBP1 and FBP2 on transcriptional level in TCGA database and found that high FBP1 mRNA level was a protective prognostic factor in GC. Then we validated the protein level of FBP1 expression by IHC in in-house data and found overexpression of FBP1 is associated with better clinical outcome for GC patients after surgical resection. Functional studies further demonstrated that ectopic expression of FBP1 significantly inhibited the proliferation and invasion of GC cells. Previous studies also indicated that FBP1 promoter was hypermethylated in GC cell lines (57%) and gastric carcinomas (33%), restoration of FBP1 expression reduced growth and glycolysis in gastric cancer cells [17]. EMT is one of the key events in tumor invasion and metastasis [14]. FBP1 expression was indicated inversely correlated with N stage and lymphovascular invasion in GC patients in current study. We then tested whether the function of FBP1 on cancer cell was by way of inducing EMT pathway. As anticipated, overexpression of FBP1 led to increased protein levels of epithelial marker (E-cadherin) and decreased expression of mesenchymal marker (N-cadherin, Vimentin), suggestion that overexpression of FBP1 led to a reversion of EMT progression in GC. In basal-like breast cancer, FBP1 is a direct target of Snail [12], which is also a support of our present study.

Conclusions

This is the first report to describe that FBP1 plays a critical role in GC by regulating EMT pathway. The present study provides new evidence supporting the role of FBP1 in the progression of gastric cancer. FBP1 level appears to be an independent predictor of survival for patients with GC. Our study offers new insights into the pathogenesis of GC and indicates that FBP1 may serve as a potential therapeutic target for GC treatment.
  26 in total

1.  On the origin of cancer cells.

Authors:  O WARBURG
Journal:  Science       Date:  1956-02-24       Impact factor: 47.728

2.  Structural analysis of alpha-enolase. Mapping the functional domains involved in down-regulation of the c-myc protooncogene.

Authors:  A Subramanian; D M Miller
Journal:  J Biol Chem       Date:  2000-02-25       Impact factor: 5.157

3.  Tumorigenesis: FBP1 is suppressed in kidney tumours.

Authors:  Gemma K Alderton
Journal:  Nat Rev Cancer       Date:  2014-09       Impact factor: 60.716

4.  Loss of FBP1 by Snail-mediated repression provides metabolic advantages in basal-like breast cancer.

Authors:  Chenfang Dong; Tingting Yuan; Yadi Wu; Yifan Wang; Teresa W M Fan; Sumitra Miriyala; Yiwei Lin; Jun Yao; Jian Shi; Tiebang Kang; Pawel Lorkiewicz; Daret St Clair; Mien-Chie Hung; B Mark Evers; Binhua P Zhou
Journal:  Cancer Cell       Date:  2013-02-28       Impact factor: 31.743

Review 5.  Systemic treatment of gastric cancer.

Authors:  Alessandro Morabito; Guido Carillio; Raffaele Longo
Journal:  Crit Rev Oncol Hematol       Date:  2008-10-01       Impact factor: 6.312

6.  Warburg effect revisited: an epigenetic link between glycolysis and gastric carcinogenesis.

Authors:  X Liu; X Wang; J Zhang; E K Y Lam; V Y Shin; A S L Cheng; J Yu; F K L Chan; J J Y Sung; H C Jin
Journal:  Oncogene       Date:  2009-11-02       Impact factor: 9.867

Review 7.  Tumor suppressors and cell metabolism: a recipe for cancer growth.

Authors:  Russell G Jones; Craig B Thompson
Journal:  Genes Dev       Date:  2009-03-01       Impact factor: 11.361

8.  Akt inhibits apoptosis downstream of BID cleavage via a glucose-dependent mechanism involving mitochondrial hexokinases.

Authors:  Nathan Majewski; Veronique Nogueira; R Brooks Robey; Nissim Hay
Journal:  Mol Cell Biol       Date:  2004-01       Impact factor: 4.272

9.  MicroRNA-124 reduces the pentose phosphate pathway and proliferation by targeting PRPS1 and RPIA mRNAs in human colorectal cancer cells.

Authors:  Zhaoping Qiu; Weijie Guo; Qifeng Wang; Zhiao Chen; Shenglin Huang; Fangyu Zhao; Ming Yao; Yingjun Zhao; Xianghuo He
Journal:  Gastroenterology       Date:  2015-08-03       Impact factor: 22.682

Review 10.  Altered energy metabolism in cancer: a unique opportunity for therapeutic intervention.

Authors:  Yi Zhang; Jin-Ming Yang
Journal:  Cancer Biol Ther       Date:  2012-11-28       Impact factor: 4.742

View more
  21 in total

Review 1.  Gluconeogenesis in cancer cells - Repurposing of a starvation-induced metabolic pathway?

Authors:  Gabriele Grasmann; Elisabeth Smolle; Horst Olschewski; Katharina Leithner
Journal:  Biochim Biophys Acta Rev Cancer       Date:  2019-05-30       Impact factor: 10.680

Review 2.  Essential role of aerobic glycolysis in epithelial-to-mesenchymal transition during carcinogenesis.

Authors:  Chandra Prakash Prasad; Ajay Gogia; Atul Batra
Journal:  Clin Transl Oncol       Date:  2022-06-25       Impact factor: 3.340

3.  Increased miR-21a provides metabolic advantages through suppression of FBP1 expression in non-small cell lung cancer cells.

Authors:  Qingchun Dai; Na Li; Xiaohong Zhou
Journal:  Am J Cancer Res       Date:  2017-11-01       Impact factor: 6.166

4.  HSF2 regulates aerobic glycolysis by suppression of FBP1 in hepatocellular carcinoma.

Authors:  Li-Na Yang; Zhou-Yu Ning; Lai Wang; Xia Yan; Zhi-Qiang Meng
Journal:  Am J Cancer Res       Date:  2019-08-01       Impact factor: 6.166

5.  Energy stress-induced lncRNA HAND2-AS1 represses HIF1α-mediated energy metabolism and inhibits osteosarcoma progression.

Authors:  Yao Kang; Xiaojun Zhu; Yanyang Xu; Qinglian Tang; Zongwen Huang; Zhiqiang Zhao; Jinchang Lu; Guohui Song; Huaiyuan Xu; Chuangzhong Deng; Jin Wang
Journal:  Am J Cancer Res       Date:  2018-03-01       Impact factor: 6.166

Review 6.  Metabolic reprogramming and epithelial-to-mesenchymal transition in cancer.

Authors:  Marco Sciacovelli; Christian Frezza
Journal:  FEBS J       Date:  2017-05-21       Impact factor: 5.542

7.  The anticipating value of PLK1 for diagnosis, progress and prognosis and its prospective mechanism in gastric cancer: a comprehensive investigation based on high-throughput data and immunohistochemical validation.

Authors:  Peng Lin; Dan-Dan Xiong; Yi-Wu Dang; Hong Yang; Yun He; Dong-Yue Wen; Xin-Gan Qin; Gang Chen
Journal:  Oncotarget       Date:  2017-09-30

8.  Aldolase A as a prognostic factor and mediator of progression via inducing epithelial-mesenchymal transition in gastric cancer.

Authors:  Zhonghua Jiang; Xiaohong Wang; Jing Li; Hongmei Yang; Xin Lin
Journal:  J Cell Mol Med       Date:  2018-07-11       Impact factor: 5.310

9.  Transcriptome Signatures of Canine Mammary Gland Tumors and Its Comparison to Human Breast Cancers.

Authors:  Kang-Hoon Lee; Hyoung-Min Park; Keun-Hong Son; Tae-Jin Shin; Je-Yoel Cho
Journal:  Cancers (Basel)       Date:  2018-09-07       Impact factor: 6.639

10.  FBP1 loss contributes to BET inhibitors resistance by undermining c-Myc expression in pancreatic ductal adenocarcinoma.

Authors:  Bo Wang; Ping Fan; Jingyuan Zhao; Heyu Wu; Xin Jin; Heshui Wu
Journal:  J Exp Clin Cancer Res       Date:  2018-09-10
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.