| Literature DB >> 27965655 |
Chuan Chiang-Ni1, Teng-Ping Chu2, Jiunn-Jong Wu3, Cheng-Hsun Chiu4.
Abstract
CovR/CovS is an important two-component regulatory system in human pathogen group A Streptococcus (GAS). Epidemiological studies have shown that inactivation of the sensor kinase CovS is correlated with invasive clinical manifestations. The phosphorylation level of response regulator CovR decreases dramatically in the absence of CovS, resulting in the derepression of virulence factor expression and an increase in bacterial invasiveness. Streptococcal pyrogenic exotoxin B (SpeB) is a cysteine protease and is negatively regulated by CovR; however, the expression of SpeB is almost completely repressed in the covS mutant. The present study found that in the emm1-type A20 strain, non-phosphorylated CovR acts as a transcriptional repressor for SpeB-positive regulator Rgg. In addition, the expression of Rgg-negative regulator LacD.1 is upregulated in the covS mutant. These results suggest that inactivation of Rgg in the covS mutant would directly mediate speB repression. The current study showed that overexpression of rgg but not inactivation of lacD.1 in the covS mutant partially restores speB expression, indicating that only rgg repression, but not lacD.1 upregulation, contributes to the speB repression in the covS mutant.Entities:
Keywords: CovR/CovS; LacD.1; Rgg; SpeB; group A Streptococcus
Year: 2016 PMID: 27965655 PMCID: PMC5126071 DOI: 10.3389/fmicb.2016.01935
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Group A Streptococcus (GAS) strains used in this study.
| Strain | Parental strain | Description | Reference |
|---|---|---|---|
| A20 | - | ||
| AP3 | A20 | A20 animal-passage strain with early translational termination mutation in the | This study |
| SW656 | A20 | This study | |
| SW934 | AP3 | This study | |
| SCN121 | AP3 | This study | |
| SCN127 | AP3 | pTRKL2 vector control strain | This study |
| SCN128 | A20 | CovRD53A mutation strain | This study |
| SCN134 | AP3 | This study | |
| SCN139 | A20 | This study | |
| SCN140 | AP3 | This study | |
| SCN141 | SCN128 | This study | |
Primers used in this study.
| Primer | Use | Sequence (5′-3′)# | Reference |
|---|---|---|---|
| covR-F-2 | Construction | gcg | This study |
| covR-D53A-R | Construction | ctggtaacattaaggcaagcaggatt | |
| covR-R-2 | Construction | gcg | This study |
| covR-D53A-F | Construction | aatcctgcttgccttaatgttaccag | |
| CovR/S-F-3 | Construction | gc | This study |
| CovR/S-R-2 | Construction | gc | This study |
| A20-lacD.1-F-1 | Real-time PCR | tttggcgttgatgtgctaa | |
| A20-lacD.1-R-1 | Real-time PCR | gacttccccttcagtaaaaccttc | |
| lacD.1-F-4 | Construction | c | This study |
| lacD.1-R-2 | Construction | c | This study |
| lacD.1-F-3 | Construction | cc | This study |
| lacD.1-R-3 | Construction | cc | This study |
| lacD.1-F-2 | PCR | cgagctcgtggaactggagttggcatt | This study |
| lacD.1-F | Southern blot | agattcaaacaattatccccatacttatc | This study |
| lacD.1-R | Southern blot | tgagtactattgctaagccgtttga | This study |
| rgg-F-4 | Construction | cg | This study |
| rgg-R-3 | Construction | cg | This study |
| Rgg-F-3 | Real-time PCR | tttgaatgccgaaacatagaaggtt | This study |
| Rgg-R-2 | Real-time PCR | ctaataacaccttgaccaaggcaaa | This study |
| gyrA-F-3 | Real-time PCR | cgtcgtttgactggtttgg | This study |
| gyrA-R-3 | Real-time PCR | ggcgtgggttagcgtattta | This study |
| speB-F-2 | Real-time PCR | tgcctacaacagcactttgg | This study |
| speB-R-2 | Real-time PCR | ggtaaagtaggcggacatgc | This study |
| speB-F-1 | Northern blot | gtgtcggtaaagtaggcgga | This study |
| speB-R-2 | Northern blot | ctttggtaaccgttgaagcc | This study |
| ska-F-1 | Real-time PCR | ttgctgacaaagatggttcg | This study |
| ska-R-1 | Real-time PCR | ccctggtctgaaatcgtcat | This study |
| spy1793-F-2 | Real-time PCR | caatccaaaccctctgctgt | This study |
| spy1793-R-2 | Real-time PCR | ccatcaagtggtcgaaggtt | This study |