Literature DB >> 27942558

Data on polymorphism of XRCC1 and cervical cancer risk from South India.

Geethakumari Konathala1, Ramesh Mandarapu1, Sudhakar Godi1.   

Abstract

X-ray repair cross-complementing group 1 (XRCC1) is a major DNA repair gene involved in BER mutation. Polymorphisms in DNA repair genes associated with repair efficiency against DNA damage may predispose an individual׳s cancer susceptibility. Data from cervical cancer patients was collected from South Indian Women. Genotyping of XRCC1 polymorphisms (194C/T, 280G/A and 399G/A) was done by polymerase-chain-reaction with the confronting-two-pair primer (PCR-CTPP) method.

Entities:  

Keywords:  DNA Repair Genes; Indian population; Polymorphism; XRCC1

Year:  2016        PMID: 27942558      PMCID: PMC5133639          DOI: 10.1016/j.dib.2016.11.052

Source DB:  PubMed          Journal:  Data Brief        ISSN: 2352-3409


Specifications Table Value of the data Only few works on cervical cancer have been carried out from India. Especially, no data is available on DNA repair genes polymorphisms of cervical cancer from north coastal Andhra Pradesh. This data may fill the gap from this region. To acquire the knowledge of XRCC1 allelic profiles and genotype distribution in the normal population and patients to observe their association with risk of cervical cancer. The Multifactor Dimensionality Reduction (MDR) method was used to assess higher order gene-gene interactions that may confer high or low-risk for cervical cancer development using genotype data on three SNPs. This data is useful to determine the genetic diversity from this region.

Data

Tables 1 and 2 describe the Association, Relative Risk and Odds Ratio of XRCC1 (194C>T), (280G>A), (399G>A) genotypes in disease and control groups. Table 3 summarizes the comparative table of polymorphisms of DNA repair gene XRCC1. Graphs 1 and 2 represent the best double and three-locus bar diagrams. Fig. 1 illustrates the MDR interaction information analysis of the three polymorphisms, represented in the form of a dendrogram. Pairwise linkage disequilibrium (LD) for three SNPs were calculated. The analysis has generated 8 marker combinations from three SNPs in both cases and controls (Table 4; Graph 3).

Experimental design, materials and methods

Subjects

This research was designed to be a case-control study. The study was ethically approved for collecting blood samples from the human subjects by the local [Andhra University] ethics committee. 125 patients who were diagnosed with cervical cancer at King George Government Hospital, Lions Cancer Hospital and Mahatma Gandhi Cancer Hospital and Research Institute, Visakhapatnam, Andhra Pradesh, India were recruited. Around 150 control samples were collected and analyzed for the molecular parameters.

DNA extraction

Genomic DNA was obtained from 1 ml of EDTA anticoagulated whole blood by the salting-out method with slight modifications [1]. Both cases and controls were genotyped in a randomized, blinded fashion.

Determination of XRCC1 genotype

Genotyping of XRCC1 polymorphisms (194C/T, 280G/A and 399G/A) was made by polymerase-chain-reaction with the confronting-two-pair primer (PCR-CTPP) method [2]. PCRs were carried out in a total volume of 15 μl. The primers are as follows: The primers were designed by using primer 3plus software (http://primer3plus.com/cgi-bin/dev/primer3plus.cgi). PCR amplification was performed in a thermal cycler gradient PCR system (Lark, India). The PCR amplification was performed for 30 cycles (denaturation at 95 °C for 20 s, annealing for 30 s at 56 °C, extension at 72 °C for 20 s and final extension for 5 min at 72 °C. PCR products of 608 bp (194 C/T), 747 bp (280 G/C) and 837 bp (399 G/C) were analyzed by 1.5% agarose gel stained with ethidium bromide.
Subject areaBiology
More specific subject areaMolecular Genetics
Type of dataTables, graphs, figures
How data was acquiredSurvey, Collection of blood samples, Gradient PCR
Data formatAnalyzed
Experimental factorsIsolation of genomic DNA from peripheral blood.
Experimental featuresGenotyping of three SNPs by polymerase-chain-reaction with the confronting-two-pair primer (PCR-CTPP) method.
Data source locationMahatma Gandhi cancer Hospital, King George Hospital and Lions Cancer Hospital, Visakhapatnam, Andhra Pradesh, India.
Data accessibilityData are presented in this article
194C/TNF: 5′ CCCTTTGGCTTGAGTTTTGT 3′;MF: 5′ GGGCTCTCTTCTTCAGCT 3′
NR: 5′ GGGATGTCTTGTTGATCCG 3′;MR:5′ TGCTGGGTCGCTGGCTGTG 3′
280G/ANF: 5′ CTCTTCCCAAGAGACCTAAAT 3′;MF: 5′ TCCAGTGCCAGCTCCAACTCA 3′
NR: 5′ ACTGGGGCTGTGGCTGGGGTAC 3′;MR: 5′ TAGGGCCTTATCTCGCAGCTC 3′
399G/ANF: 5′ ATCCTTCAGGGTGTGGTAGTG 3′;MF: 5′ GTCGGCGGCTGCCCTCCCG 3′
NR: 5′ TGGCGTGTGAGGCCTTACCTCT 3′;MR: 5′ TCCCACCCCTGAGTTTTTGCAC 3′
  2 in total

Review 1.  Recent advances in the polymerase chain reaction.

Authors:  H A Erlich; D Gelfand; J J Sninsky
Journal:  Science       Date:  1991-06-21       Impact factor: 47.728

2.  Modified salting-out method: high-yield, high-quality genomic DNA extraction from whole blood using laundry detergent.

Authors:  H Nasiri; M Forouzandeh; M J Rasaee; F Rahbarizadeh
Journal:  J Clin Lab Anal       Date:  2005       Impact factor: 2.352

  2 in total
  6 in total

1.  Genetic Variant XRCC1 rs1799782 (C194T) and Risk of Cancer Susceptibility in Indian Population: A Meta-analysis of Case-Control Studies.

Authors:  Raju Kumar Mandal; Rama Devi Mittal
Journal:  Indian J Clin Biochem       Date:  2020-03-02

Review 2.  Meta-Analysis of Polymorphic Variants Conferring Genetic Risk to Cervical Cancer in Indian Women Supports CYP1A1zzm321990as an Important Associated Locus

Authors:  Debmalya Sengupta; Udayan Guha; Sagnik Mitra; Sampurna Ghosh; Samsiddhi Bhattacharjee; Mainak Sengupta
Journal:  Asian Pac J Cancer Prev       Date:  2018-08-24

3.  Association of DNA Repair Genes XRCC1 and APE-1 with the Risk of Cervical Cancer in North Indian population.

Authors:  Mark Rector Charles; Syed Tasleem Raza; Rolee Sharma; Pushpendra Pratap; Ale Eba; Manvendra Singh
Journal:  Asian Pac J Cancer Prev       Date:  2020-07-01

4.  Impact of Polymorphism in Base Excision Repair and Nucleotide Excision Repair Genes and Risk of Cervical Cancer: A Case-Control Study.

Authors:  Kailas D Datkhile; Pratik P Durgawale; Madhavi N Patil; Rashmi A Gudur; Anand K Gudur; Satish R Patil
Journal:  Asian Pac J Cancer Prev       Date:  2022-04-01

5.  Statistical data analysis of cancer incidences in insurgency affected states in Nigeria.

Authors:  Patience I Adamu; Pelumi E Oguntunde; Hilary I Okagbue; Olasunmbo O Agboola
Journal:  Data Brief       Date:  2018-05-05

6.  Association of XRCC1, XRCC2 and XRCC3 Gene Polymorphism with Esophageal Cancer Risk.

Authors:  Jagjeet Kaur; Vasudha Sambyal; Kamlesh Guleria; Neeti Rajan Singh; Manjit Singh Uppal; Mridu Manjari; Meena Sudan
Journal:  Clin Exp Gastroenterol       Date:  2020-03-16
  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.