Mei Huang1, Keon Jin Lee1, Kyung-Jin Kim2, Mi Kyoung Ahn1, Chung-Hyun Cho2, Do Han Kim3, Eun Hui Lee1. 1. Department of Physiology, College of Medicine, The Catholic University of Korea, Seoul, Republic of Korea. 2. Department of Pharmacology, College of Medicine, Seoul National University, Seoul, Republic of Korea. 3. School of Life Sciences and Systems Biology Research Center, Gwangju Institute of Science and Technology, Gwangju, Korea.
Abstract
Sildenafil relaxes vascular smooth muscle cells and is used to treat pulmonary artery hypertension as well as erectile dysfunction. However, the effectiveness of sildenafil on skeletal muscle and the benefit of its clinical use have been controversial, and most studies focus primarily on tissues and organs from disease models without cellular examination. Here, the effects of sildenafil on skeletal muscle at the cellular level were examined using mouse primary skeletal myoblasts (the proliferative form of skeletal muscle stem cells) and myotubes, along with single-cell Ca2+ imaging experiments and cellular and biochemical studies. The proliferation of skeletal myoblasts was enhanced by sildenafil in a dose-independent manner. In skeletal myotubes, sildenafil enhanced the activity of ryanodine receptor 1, an internal Ca2+ channel, and Ca2+ movement that promotes skeletal muscle contraction, possibly due to an increase in the resting cytosolic Ca2+ level and a unique microscopic shape in the myotube membranes. Therefore, these results suggest that the maintenance ability of skeletal muscle mass and the contractility of skeletal muscle could be improved by sildenafil by enhancing the proliferation of skeletal myoblasts and increasing the Ca2+ availability of skeletal myotubes, respectively.
Sildenafil relaxes vascular smooth muscle cells and is used to treat pulmonary artery hypertension as well as erectile dysfunction. However, the effectiveness of sildenafil on skeletal muscle and the benefit of its clinical use have been controversial, and most studies focus primarily on tissues and organs from disease models without cellular examination. Here, the effects of sildenafil on skeletal muscle at the cellular level were examined using mouse primary skeletal myoblasts (the proliferative form of skeletal muscle stem cells) and myotubes, along with single-cell Ca2+ imaging experiments and cellular and biochemical studies. The proliferation of skeletal myoblasts was enhanced by sildenafil in a dose-independent manner. In skeletal myotubes, sildenafil enhanced the activity of ryanodine receptor 1, an internal Ca2+ channel, and Ca2+ movement that promotes skeletal muscle contraction, possibly due to an increase in the resting cytosolic Ca2+ level and a unique microscopic shape in the myotube membranes. Therefore, these results suggest that the maintenance ability of skeletal muscle mass and the contractility of skeletal muscle could be improved by sildenafil by enhancing the proliferation of skeletal myoblasts and increasing the Ca2+ availability of skeletal myotubes, respectively.
Skeletal muscle is composed of myotubes, which are long-cylindrical and multi-nucleated cells (also called myofibers).[1, 2] In the postnatal and adult periods, satellite cells (that is, skeletal muscle stem cells) in skeletal muscle have qualities of mitotic quiescence and self-renewal, and they proliferate in response to regenerative cues, such as injury or exercise, to repair and maintain skeletal muscle.[3] Proliferative skeletal muscle satellite cells, generally called myoblasts, migrate to align closely together, fuse to one another (and/or fuse to immature myotubes) and become multi-nucleated myotubes, a process that is called differentiation.[3] Therefore, migration and fusion of myoblasts are important steps for the differentiation to myotubes and for the regenerative activity of skeletal muscle.[3, 4] Cytosolic Ca2+ elevation to activate various signaling pathways is required for myoblast migration and fusion.[5, 6] In addition, myogenic regulatory factors (MRFs) have key roles in differentiation as follows: primary MRFs such as MyoD are required for the determination of myoblasts and are necessary for retaining the expression of muscle-related genes and secondary MRFs such as myogenin are expressed on differentiation and regulate differentiation.[7, 8]Body posture and locomotion are accomplished by skeletal muscle contraction operated by excitation–contraction (EC) coupling.[9, 10, 11] During skeletal EC coupling, α-motor neurons depolarize the transverse (t)-tubule membranes of skeletal myotubes. The dihydropyridine receptor (DHPR, a Ca2+ channel in the t-tubule membrane) senses the depolarization and, in turn, activates ryanodine receptor 1 (RyR1, a Ca2+ channel on sarcoplasmic reticulum (SR) membrane) by physical interactions. Ca2+ ions in the SR are released into the cytosol through the activated RyR1, and these Ca2+ ions ultimately activate contractile proteins for skeletal muscle contraction. RyR1 is also activated by Ca2+ and releases Ca2+ from the SR, which is called Ca2+-induced Ca2+ release (CICR); however, CICR is not predicted to contribute significantly to physiological Ca2+ supply for volitional skeletal muscle contraction.[9, 12, 13] Extracellular Ca2+ entry in skeletal myotubes via either the Orai1 or the canonical-type transient receptor potential cation channel 3 (TRPC3) contributes to maximizing the Ca2+ supply.[14, 15, 16] During skeletal muscle relaxation, to reduce cytosolic Ca2+ levels for rest and to replenish the SR with Ca2+, sarcoplasmic/endoplasmic reticulum Ca2+-ATPase 1a (SERCA1a) takes up Ca2+ from the cytosol to the SR.[9, 10, 11] Entry of extracellular Ca2+ through the DHPR also contributes to replenishing the SR with Ca2+.[17] A close and efficient arrangement of the proteins described above is maintained by the formation of junctional membrane complexes in which t-tubule and the SR membranes are closely juxtaposed.[10, 11, 18, 19]Sildenafil, a specific inhibitor of phosphodiesterase type 5 (PDE5), has been clinically used to treat pulmonary artery hypertension and erectile dysfunction because of its vasodilatation effect on vascular smooth muscle by blocking the degradation of intracellular cyclic guanosine monophosphate (cGMP), subsequently amplifying cGMP-dependent signaling in smooth muscle cells.[20, 21, 22] However, the effectiveness of sildenafil on skeletal muscle and the benefit of its clinical use have been controversial–positive, negative or no effect. Sildenafil reduces fatigue of the knee extensors in generally healthy males[23] and decreases exaggerated skeletal muscle fatigue in a mouse model of Duchenne muscular dystrophy (DMD).[24] Sildenafil enhances the grip-strength of skeletal muscle in mice[25] and alleviates exercise-induced skeletal muscle ischemia in boys with DMD.[26] However, in addition to these positive effects, some negative and neutral effects of sildenafil on skeletal muscle have been also reported. Sildenafil promoted dystrophic pathology in a mouseDMD model[27] and induced the atrophy of skeletal muscle in rats.[28] Sildenafil does not enhance walking tolerance in patients with intermittent claudication.[29] In addition to ‘these discrepancies', most studies on sildenafil in skeletal muscle have been conducted using tissues or organs from ‘disease models', and the functional effects of sildenafil on normal skeletal muscle at the cellular level have not been well examined. Therefore, in the present study, the effects of sildenafil on the proliferation and differentiation of skeletal myoblasts and on differentiated skeletal myotubes were examined using primary skeletal myoblasts and myotubes from normal mouse.
Materials and methods
Ethics statement
All surgical interventions and pre- and post-surgical animal care were provided in accordance with the Laboratory Animals Welfare Act, the Guide for the Care and Use of Laboratory Animals and the Guidelines and Policies for Rodent Survival Surgery provided by the Institutional Animal Care and Use Committee of the College of Medicine at The Catholic University of Korea.
Cell culture and sildenafil treatment
Mouse skeletal satellite cells were isolated from mouse skeletal muscle, and a ‘single satellite cell clone' was allowed to proliferate (that is, primary skeletal myoblasts) or differentiate to myotubes, as previously described.[18, 30, 31, 32, 33] Briefly, primary myoblasts were cultured on 10-cm plates coated with collagen in growth medium (F-10 Nutrient Mixture (HyClone Laboratories, Logan, UT, USA) containing 20% fetal bovine serum (FBS), 100 units ml−1 penicillin, 100 μg ml−1 streptomycin, 2 mM L-glutamine and 20 nM basic FGF) at 37 °C in a 5% CO2 incubator. For the differentiation of myoblasts into myotubes, myoblasts were replated either on 10-cm plates (for the quantitative RT-PCR (qPCR) analysis or for the preparation of myotube lysate) or on 96-well plates (for the single myotube Ca2+ imaging experiment) coated with Matrigel (BD Biosciences, San Jose, CA, USA). When the myoblasts reached ~70% confluence, the growth medium was replaced with differentiation medium (5% heat-inactivated horse serum and low-glucoseDMEM without growth factors instead of 20% FBS and F-10 Nutrient Mixture in the growth medium), and the myoblasts were placed in an 18% CO2 incubator for 5 days to induce differentiation. For treatment, various amounts of sildenafil (Sigma-Aldrich, St Louis, MO, USA) dissolved in dimethyl sulfoxide (DMSO, <0.05%) were added to the growth or differentiation medium, and the medium was changed to fresh medium once per day. All reagents for cell culture were obtained from Invitrogen or Gibco (Waltham, MA, USA).
Proliferation and migration assay
For the proliferation assay, images of primary skeletal myoblasts on 10-cm culture dishes were randomly captured, and the number of myoblasts in 0.33 mm2 was counted. The cell migration assay was performed in accordance with previously described methods.[34] Briefly, myoblasts grown on 10-cm plates were scraped off using a pipette tip to produce a long and thin acellular area, and the growth medium was then treated with sildenafil. To evaluate the number of migrated myoblasts into the acellular area, images of the acellular area were obtained immediately after scraping and sildenafil treatment, and images of the same areas were obtained again at 12 h post-scraping. The number of myoblasts that migrated into the acellular area (0.24 mm2) was counted.
qPCR analysis
The qPCR was performed as previously described.[34] The complimentary DNA (cDNAs) were synthesized using total RNA from primary skeletal myotubes treated with sildenafil. The qPCR was performed using 20 ng of synthesized cDNA, the primers presented in Table 1, a SYBR Green PCR kit (Invitrogen, Waltham, MA, USA) and an i-Cycler PCR thermocycler (Bio-Rad Laboratories, Hercules, CA, USA): denaturation at 95 °C for 15 s, annealing at 58 °C for 30 s and extension at 72 °C for 30 s (in duplicate, eight sets per each). The obtained values were normalized to those from the corresponding α-actin samples.
Table 1
List of qPCR primers
qPCR primers
Myogenin
Forward
5′–TTGCTCAGCTCCCTCAACCAGGA–3′
Backward
5′–TGCAGATTGTGGGCGTCTGTAGG–3′
Actin
Forward
5′–CCAGGCATTGCTGACAGGAT–3′
Backward
5′–AGCCACCGATCCACACAGAG–3′
Abbreviation: qPCR, quantitative RT-PCR.
Single myotube Ca2+ imaging experiment
Single myotube Ca2+ imaging experiments were performed as previously described.[18, 30, 31, 32, 33] Primary skeletal myotubes on 96-well plates were loaded with 5 μM fura-2-acetoxymethyl ester (AM) for the measurement of resting cytosolic Ca2+ levels or with 5 μM fluo-4-AM for other measurements in an imaging buffer (25 mM HEPES, pH 7.4, 125 mM NaCl, 5 mM KCl, 2 mM KH2PO4, 2 mM CaCl2, 6 mM glucose, 1.2 mM MgSO4 and 0.05% BSA) at 37 °C for 45 min. Each well of the 96-well plate was then washed three times with imaging buffer. The myotubes were transferred to an inverted stage microscope (Nikon Eclipse TS100, Melville, NY, USA) equipped with a 40 × oil-immersion objective (NA 1.30). Before starting the single myotube Ca2+ imaging experiments, images of myotubes were captured for comparison of myotube formations and for the observation of myotube membranes and the measurement of width. During single myotube Ca2+ imaging, images of the myotubes were captured using a high-speed monochromator with a 75 W xenon lamp (FSM150Xe, Bentham Instruments, Verona, VA, USA) and a 12-bit charge-coupled device camera (DVC-340M-OO-CL, Digital Video Camera Company, Austin, TX, USA). The data were displayed and analyzed using image acquisition and analysis software (High-Speed InCyt Im1 for fluo-4 and InCyt Im2 for fura-2, v5.29, Intracellular Imaging, Cincinnati, OH, USA). Either caffeine or KCl was dissolved in imaging buffer and applied via an auto-perfusion system (AutoMate Scientific, Berkeley, CA, USA). To measure the amount of releasable Ca2+ from the SR to cytosol, thapsigargin (TG, 2.5 μM) dissolved in DMSO (<0.05%) was manually applied to myotubes in the absence of extracellular Ca2+. DMSO (0.05%) alone had no effect on the release of Ca2+. To analyze the Ca2+ release obtained from the Ca2+ imaging experiments, the peak amplitude, which exhibited similar increases or decreases in peak areas, was considered. For the long-term Ca2+ release induced by TG, both the peak area under the traces and peak amplitude (height) were analyzed. All reagents for Ca2+ imaging experiments were obtained from Sigma-Aldrich.
Width measurement
Measurements of the width in primary skeletal myotubes (one criterion that is used to evaluate the degree of skeletal myotube formation (that is, the degree of differentiation)[18, 30, 31, 32]) were performed as previously described.[30, 31] The width at the thickest part of each myotube was measured using the ImageJ program (http://imagej.nih.gov/ij/).
Immunoblot assay
Primary skeletal myotubes were solubilized as previously described,[18, 30, 31, 32, 33] and the solubilized lysate (10 μg of total protein) was subjected to SDS–PAGE (8, 10 or 12% gel). The proteins on the gel were transferred to a polyvinylidene difluoride membrane at 100 V for 1 h. The membranes were blocked with 5% (w/v) non-fat milk dissolved in PBS, incubated with a corresponding primary antibody, washed three times with PBS containing 0.1% Tween20 and then incubated with horseradish peroxidase-conjugated secondary antibodies (anti-goat (205-035-108), anti-mouse (715-035-151), anti-rabbit (711-035-152), 1:50 000 dilution, Jackson ImmunoResearch Laboratories, West Grove, PA, USA) at room temperature (24 °C). The membranes were washed three times with PBS and developed using a SuperSignal Ultra Chemiluminescent substrate (Pierce, Rockford, IL, USA). Anti-RyR1 (anti-mouse, MA3-925), anti-SERCA1a (anti-mouse, MA3-912), anti-CSQ (anti-rabbit, PA1-913), anti-CaM1 (anti-mouse, MA3-917), anti-Mg29 (also called TRIM29, anti-rabbit, PA5-30488), anti-Mg53 (also called TRIM72, anti-goat, PA5-19398), anti-JP1 (anti-rabbit, PA5-20640) and anti-JP2 (anti-rabbit, PA5-20642) antibodies (1:1000) were obtained from Thermo Scientific (Rockford, IL, USA). Anti-TRPC1 (anti-rabbit, ACC-010), anti-TRPC3 (anti-rabbit, ACC-016), anti-TRPC4 (anti-rabbit, ACC-018) and anti-TRPC6 (anti-rabbit, ACC-017) antibodies (1:800 dilution) were obtained from Alomone Laboratories (Jerusalem, Israel). Anti-DHPR (anti-mouse, ab2864), anti-Orai1 (anti-mouse, ab59330), anti-STIM1 (anti-mouse, ab57834) and anti-α-actin (anti-mouse, ab28052) antibodies (1:1000 dilution) were obtained from Abcam (Cambridge, MA, USA).
Statistical analysis
The results are presented as the means±s.e. for the number of experiments presented in Table 2 and in the figure legends. Significant differences were analyzed using an unpaired t-test (GraphPad InStat, v2.04, GraphPad Software, La Jolla, CA, USA). The differences were considered significant at P<0.05. For the myoblast proliferation assay, the number of myoblasts at each concentration was compared with the corresponding DMSO control using t-tests, and a Bonferroni correction was conducted. The graphs were prepared using Origin v7 software (OriginLab, Northampton, MA, USA).
Table 2
Properties of primary skeletal myotubes with sildenafil treatments
Significant difference compared with the untreated control (P<0.05).
The values, except for those of resting cytosolic Ca2+ levels, were normalized to the mean value of those from the untreated controls. The values are presented as the mean±s.e. for the number of myotubes shown in parentheses.
Results
The proliferation of primary skeletal myoblasts is enhanced by sildenafil
To examine the effect of sildenafil on the proliferation of skeletal myoblasts, primary skeletal myoblasts (that is, proliferative form of satellite cells) were isolated from mouse skeletal muscle as described in the ‘Materials and methods' section. Various concentrations of sildenafil dissolved in DMSO were added to the myoblast culture medium for different periods of time and the number of myoblasts was counted. DMSO treatments were used as controls. For different concentrations of sildenafil from 10 nM to 1 μM, 50 nM sildenafil effectively enhanced the proliferation of myoblasts, and the enhancement was observed after 24 h of treatment and after treatments for longer than 24 h (~11.2 or 11.3% higher than the DMSO control in both the 24 or 72 h-treatment, respectively, in Figure 1a and Supplementary Figure 1a). Note that the enhancement of skeletal myoblast proliferation is presented as ‘fold-increase'. Concentrations of sildenafil lower or greater than 50 nM did not affect the proliferation of myoblasts, suggesting that the enhancement of skeletal myoblast proliferation by sildenafil was not dose-dependent. Representative images of myoblasts at 84 h after 50 nM sildenafil treatment are shown in Figure 1b. All further experiments were conducted using 50 nM sildenafil.
Figure 1
Proliferation of primary skeletal myoblasts. (a) A quantitative analysis of myoblast proliferation using various concentrations of sildenafil for 24 or 72 h. The number of myoblasts was normalized to the corresponding number of myoblasts in the DMSO control and is presented as histograms (fold-increase). The number of myoblasts at each concentration was compared with the corresponding DMSO control using t-tests (*, significant, P<0.05) and a Bonferroni correction was conducted. The results are presented as the means±s.e. A quantitative analysis of myoblast proliferation using various concentrations of sildenafil for various time periods is presented in Supplementary Figure 1a. The number of places used in the analysis of the sildenafil effect on myoblast proliferation is presented in Supplementary Figure 1b. (b) Representative images of myoblasts treated with DMSO or 50 nM sildenafil for 84 h are presented. The scale bar indicates 50 μm. The proliferation of primary skeletal myoblasts is significantly enhanced by 50 nM sildenafil treatment for 24 h or longer periods.
The migration of primary skeletal myoblasts is slowed by sildenafil
During the differentiation of skeletal myoblasts to myotubes, myoblasts migrate and fuse to one another to form myotubes. The first step in determining the effect of sildenafil on the degree of differentiation is to evaluate the effect of sildenafil on skeletal myoblast migration, which involves the formation of an acellular area by scraping the myoblasts off a culture plate and then treating the resultant culture medium with sildenafil. After 12 h of sildenafil treatment, the number of myoblasts that migrated into the acellular area was counted (Figure 2). To exclude the proliferative effect of sildenafil and to determine the sole effect of sildenafil on myoblast migration, sildenafil was treated to myoblasts for 12 h (that is, myoblast migration was examined at 12 h (Supplementary Figure 2) because this time point preceded the first observation of significant effects of sildenafil on proliferation at 24 h of treatment). The number of myoblasts that migrated into the acellular area was reduced by sildenafil. Therefore, sildenafil slowed the migration of skeletal myoblasts, suggesting that sildenafil has different effects on differentiation based on its effect on the proliferation of skeletal myoblasts.
Figure 2
Migration of primary skeletal myoblasts. At 12 h after treatment with sildenafil, the number of myoblasts that migrated into the acellular area was counted. DMSO treatments were used as controls. The scale bar indicates 100 μm. The number of myoblasts in the acellular area was normalized to the DMSO control. Sixteen places per sample were examined, and the results are presented as the means±s.e. *, and the significant difference was compared with DMSO (P<0.05). The migration of primary skeletal myoblasts was significantly slowed by sildenafil.
The overall differentiation of primary skeletal myoblasts to myotubes is not affected by sildenafil
The second step was to evaluate the effect of sildenafil on skeletal myoblast fusion during differentiation, which involved treatment of the culture medium with sildenafil during differentiation. Interestingly, instead of the typically smooth and cylindrical shape of skeletal myotube membranes, the myotubes treated with sildenafil were characterized by uneven plasma membranes, which can be described as puddles or bumpy regions similar to twisted bread sticks (enlarged images 1 and 2 in Figure 3a). However, the widths (one criterion used to evaluate the degree of myoblast fusion and differentiation, as described in the ‘Materials and methods' section) and lengths of myotubes were not changed by sildenafil (Supplementary Figure 3), suggesting that overall differentiation was not affected by sildenafil.
Figure 3
Differentiation of primary skeletal myoblasts to myotubes. (a) Representative images of myotubes treated with sildenafil are presented, and the boxed areas in the images are enlarged in the right panel. The scale bar indicates 100 μm. Neither the fusion of myoblasts nor the formation of myotubes was affected by sildenafil. A unique microscopic shape in the myotube membranes was induced by sildenafil (indicated by asterisks). (b) The mRNA level of myogenin in myotubes treated with sildenafil was assessed by qPCR analysis. The mRNA levels were normalized to the DMSO control (in duplicate, eight sets). The results are presented as the means±s.e. *, and the significant difference was compared with DMSO (P<0.05). There was no significant change in the mRNA level of myogenin. The overall differentiation of primary skeletal myoblasts to myotubes was not affected by sildenafil.
To confirm the lack of an effect of sildenafil on differentiation, the mRNA level of myogenin, a secondary MRF that is expressed on differentiation and regulates differentiation, was examined in myotubes treated with sildenafil using qPCR analysis. There were no changes in the mRNA levels of myogenin, (Figure 3b), which again showed that the overall differentiation of skeletal myoblasts to myotubes was not affected by sildenafil.
In primary skeletal myotubes, RyR1 activity and Ca2+ movements for muscle contraction are enhanced by sildenafil
Functional properties of myotubes treated with sildenafil were examined by measuring intracellular Ca2+ movement. RyR1 is a key protein for releasing Ca2+ from the SR into the cytosol during skeletal muscle contraction, and myotubes were treated with caffeine, which is a direct agonist of RyR1. Responses to caffeine were enhanced in myotubes treated with sildenafil compared with control myotubes (Figure 4a; Table 2). Responses to KCl were also enhanced by sildenafil (Figure 4b; Table 2). Ca2+ movements in skeletal myotubes in response to KCl mimic Ca2+ movements during EC coupling (that is, membrane depolarization by KCl activates DHPR, and direct interaction between the activated DHPR and RyR1 induces RyR1 activation), suggesting that, indeed, the enhanced Ca2+ movement by sildenafil could contribute to the Ca2+ supply needed for skeletal muscle contraction. Therefore, in skeletal muscle, sildenafil could enhance Ca2+ movement and supply more Ca2+ for muscle contraction. In addition, the increment of the response to KCl by sildenafil was similar to that of caffeine, a specific agonist of RyR1, suggesting that RyR1 activity could be increased in a selective manner by sildenafil, and this increased RyR1 activity could be a major reason for the enhanced Ca2+ movement.
Figure 4
Ca2+ movement in primary skeletal myotubes. Caffeine (a), which is a direct RyR1 agonist or KCl (b), a membrane depolarizer, was applied to myotubes treated with sildenafil, and Ca2+ movement from the SR to cytosol in myotubes was measured. Histograms are shown for the normalized peak amplitude to the mean value of those from an untreated control. The results are presented as the means±s.e. for the number of experiments in the parentheses in Table 2. *, and the significant difference was compared with untreated controls (P<0.05). Ca2+ release in primary skeletal myotubes in response to both caffeine and KCl as significantly enhanced by sildenafil.
In primary skeletal myotubes, the resting cytosolic Ca2+ level is increased by sildenafil
To identify other proteins that participate in the enhancement of Ca2+ movement in myotubes treated with sildenafil (Figure 4), 15 proteins that are related to or mediate Ca2+ movement during the contraction and maintenance of skeletal muscle were examined by immunoblot assays using myotube lysate from sildenafil treated cells (Figure 5a). There was no significant change in the expression levels of the three main proteins that mediate Ca2+ movements between the SR and cytosol during skeletal muscle contraction and relaxation: DHPR, RyR1 and SERCA1a. There was also no significant change in the expression levels of proteins responsible for extracellular Ca2+ entry: Orai1, STIM1, TRPC1, TRPC3, TRPC4 and TRPC6. This suggested a low possibility that a change in extracellular Ca2+ entry is a direct cause of the enhanced Ca2+ movement. There was also no change in the expression levels of proteins that mediate formation of the junctional membrane complex and the handling of Ca2+: JP1, JP2, calsequestrin, calmodulin, mitugumin 29 and mitugumin 53. Therefore, these results suggest that a change in the expression levels of proteins that mediate Ca2+ movement in skeletal muscle does not result in an enhancement of Ca2+ movement in myotubes treated with sildenafil.
Figure 5
Expression level of skeletal muscle proteins, the amount of releasable Ca2+ from the SR to the cytosol, and the resting cytosolic Ca2+ level in primary skeletal myotubes. (a) The immunoblot analysis of proteins mediating Ca2+ movements and handling in skeletal muscle was conducted using the lysate of myotubes treated with sildenafil. Fifteen proteins were examined, and no expression levels were changed by sildenafil (the expression level of proteins is presented as bar graphs in Supplementary Figure 5). α-Actin was used as a loading control. At least three independent experiments per protein were conducted and a representative result is presented. JP, junctophilin; CSQ, calsequestrin; Mg, mitsugumin; CaM, calmodulin. The amount of releasable Ca2+ from the SR to the cytosol in response to TG (2.5 μM) (b) or resting cytosolic Ca2+ level (c) was examined in myotubes treated with sildenafil, and histograms are shown for the normalized peak amplitude or area under the peak to the mean value of those from untreated controls as described in the ‘Materials and methods' section. TG was applied to myotubes in the absence of extracellular Ca2+ to avoid extracellular Ca2+ entry. The results are presented as the means±s.e. for the number of experiments presented in the parentheses of Table 2. *, and the significant difference was compared with the untreated control (P<0.05). There was no significant change in the amount of releasable Ca2+ from the SR to the cytosol caused by sildenafil, and the resting cytosolic Ca2+ levels in primary skeletal myotubes were significantly increased by sildenafil.
To maintain or increase cytosolic Ca2+ levels to a certain level at different time points is the key to evoking skeletal muscle contraction, and the amount of releasable Ca2+ from the SR into the cytosol or resting cytosolic Ca2+ level was measured in myotubes treated with sildenafil. To measure the amount of releasable Ca2+ from the SR to the cytosol (that is, to estimate how much Ca2+ ion is stored in the SR), TG was used to treat myotubes in the absence of extracellular Ca2+ to avoid extracellular Ca2+ entry and exclusively assess the amount of Ca2+ stored in the SR. For analyzing TG responses, both the peak area under the traces and amplitude were analyzed. Sildenafil caused no significant change in the amount of releasable Ca2+ from the SR to the cytosol (Figure 5b; Table 2; Supplementary Figure 4). To measure the resting cytosolic Ca2+, the same experimental conditions for the measurement of KCl or caffeine response were used (that is, in the presence of extracellular Ca2+). Interestingly, resting cytosolic Ca2+ levels were significantly increased by sildenafil (Figure 5c; Table 2), suggesting that resting cytosolic Ca2+ levels could be a possible reason for the increase in RyR1 activity and the subsequently enhanced Ca2+ movement in myotubes treated with sildenafil.
Discussion
The effectiveness of sildenafil on skeletal muscle has been controversial, unlike its effect on smooth muscle, as discussed in the Introduction section, displaying positive, negative, or neutral effects.[23, 25, 26, 27, 28, 29] In addition, unlike smooth muscle, most sildenafil studies on skeletal muscle were conducted at macroscopic levels, such as physiological aspects of tissues or organs, but not at the cellular level that constitutes tissues and organs. Crucially, the studies were conducted using different methods for sildenafil administration (oral administration (gavage or as tablet forms), subcutaneous injection, drinking water, intraperitoneal injection and so on), which resulted in various working doses of sildenafil in the tissues or organs that researchers examined. Therefore, uncontrolled concentrations of sildenafil (usually doses higher than those used in clinical prescriptions) could be misleading about the effects of sildenafil on skeletal muscle. Various periods and frequencies for sildenafil administration in disease models[26, 27, 28, 29] are also another key reason for controversies surrounding the effect of sildenafil on skeletal muscle.In the present study, concentrations of sildenafil greater than 50 nM had no effect on myoblast proliferation on the cellular level. There are two possible explanations for the lack of effects with higher doses of sildenafil than 50 nM. One is that higher concentrations of sildenafil may be harmful to myoblasts. Indeed, floating and dead myoblasts were found in the culture medium with the sildenafil treatment of 0.1 mM or more in the present study, which is consistent with the observation that sildenafil aggravates the pathology of DMD[27] and induces skeletal muscle atrophy.[28] The other possibility is that 50 nM of sildenafil may simply be the maximally effective concentration under the given culture conditions. However, trials of cell culture using different sized culture plates (6- or 96-well, or 10-cm culture plates) ruled out the latter possibility. Sildenafil ameliorates age-related dysfunction in the cardiac muscle of a mouseDMD model by inhibiting PDE5 (IC50=10 nM).[35] Skeletal muscle could be less sensitive to sildenafil than cardiac muscle, and a metabolite of sildenafil and/or other types of PDE could mediate the proliferative effect of sildenafil on skeletal myoblasts, although the cellular effects of sildenafil on skeletal myoblasts from normal mice in the present study is not directly comparable to those on cardiac muscle function in a mouse disease model.Nitric oxide promotes skeletal myoblast proliferation and muscle regeneration.[36] In the present study, sildenafil effectively enhanced skeletal myoblast proliferation, and the effects of sildenafil were observed in the absence of the overt manipulation of the nitric oxide level, suggesting that sildenafil could amplify the downstream responses to nitric oxide endogenously produced in skeletal myotubes. Therefore, sildenafil could be an effective way to avoid the superfluous and sometimes deleterious side effects of nitric oxide and provide a shorter path to the proliferation of skeletal myoblasts in adults. Postnatal skeletal muscle growth or regeneration after damage is accomplished by fusions among pre-existing/intact muscle fibers, fusions of pre-existing/intact muscle fibers with satellite cells (that is, precursor cells of myoblasts), or fusions among satellite cells (de novo formation).[37, 38, 39, 40, 41, 42] In adults, satellite cells account for <5% of the total nuclei in skeletal muscle mass, which is much less than the ~32% seen at birth.[43] A reduction in skeletal muscle mass usually occurs during the course of healthy aging as well as with diverse diseases.[44, 45] On the basis of our results, an adequate amount of sildenafil could be beneficial for the maintenance of skeletal muscle mass in healthy people as well as for patients or people with special situations, such as air force pilots or astronauts, who experience high-altitude or non-gravitation situations. A drug repositioning (extended application) of sildenafil to skeletal muscle would have significant advantages because a significant number of toxicity and other test results have already established its safety.Adequate migration of myoblasts is a prerequisite for favorable myoblast fusion to form myotubes during differentiation.[3] In the present study, sildenafil led to slower myoblast migration, but the differentiation of myoblasts to myotubes remained normal. Because the fusion of myoblasts during differentiation requires elevation of the cytosolic Ca2+ level,[5, 6] the higher cytosolic Ca2+ levels in myotubes treated with sildenafil (Figure 5c) could be a link between the slower migration and normal differentiation in the present study, such that the higher ability to fuse due to the increase in resting cytosolic Ca2+ level (a type of ready-to-go kit) could compensate for the slower migration of myoblasts and normalize differentiation. The unique microscopic shape of the plasma membranes and no reduction in the time required for differentiation (no temporal delay) in myotubes treated with sildenafil could be evidence for a higher ability of the myoblasts to fuse, albeit with a slower myoblast migration.Because an increase in the cytosolic Ca2+ level activates RyR1 via a CICR mechanism and accelerates Ca2+ movements through RyR1 by increasing RyR1 sensitivity to agonists by the presence of higher cytosolic Ca2+ level,[9, 12] the enhanced RyR1 activity and Ca2+ movement in myotubes treated with sildenafil could be caused by the increase in the resting cytosolic Ca2+ level (Figure 5c). Extracellular Ca2+ entry via Orai1 or TRPC channels is a possible reason for an increase in the cytosolic Ca2+ level.[14, 15, 16] However, this is not the case here because the expression levels of Orai1 (with its main regulatory protein, STIM1) and four types of TRPCs that are expressed in skeletal muscle (TRPC1, TRPC3, TRPC4 and TRPC6)[10, 11] were not changed by sildenafil. Another possible reason for the enhanced RyR1 activity and Ca2+ movements in myotubes treated with sildenafil could be the unique microscopic shape in the myotube membranes (Figure 3a), similar to caveolae structures in other types of cells.[46] The unique plasma membranes (with puddles and bumpy regions) may be more appropriate for capturing external signals by mimicking the conditions for higher concentrations of signals. This is the first report to suggest that Ca2+ movements via RyR1 and membrane shape (that is, the morphology of myotubes) in skeletal muscle could be correlated. Accordingly, sildenafil could enhance RyR1 activity and Ca2+ movement through a more efficient spatial capturing of KCl or caffeine. This is consistent with no change in the expression levels of RyR1 in myotubes treated with sildenafil. In either case, sildenafil could enhance skeletal muscle contractility by increasing Ca2+ availability.Sildenafil has an anti-proliferative effect on smooth muscle cells by decreasing TRPC1 expression and extracellular Ca2+ entry.[20, 47] In the present study, however, sildenafil had a proliferative effect on skeletal myoblasts with no change in TRPC1 expression. In addition, unlike the relaxation effect of sildenafil on smooth muscle cells,[20, 21, 22] sildenafil induced greater contraction in skeletal muscle myotubes by enhancing Ca2+ movement in this study. Therefore, sildenafil effects in skeletal muscle could be the opposite of what occurs in smooth muscle. Sildenafil lowers blood pressure by dilating blood vessels,[20, 21, 22] it improves skeletal muscle oxygenation during exercise in patients with intermittent claudication,[29] and it ameliorates skeletal muscle fatigue in a mouseDMD model and in healthy men.[23, 24]
Authors: John Wharton; Julian W Strange; Gigi M O Møller; Ellena J Growcott; Xiaohui Ren; Angela P Franklyn; Stephen C Phillips; Martin R Wilkins Journal: Am J Respir Crit Care Med Date: 2005-04-07 Impact factor: 21.405
Authors: Chang Seok Lee; Dimitra K Georgiou; Adan Dagnino-Acosta; Jianjun Xu; Iskander I Ismailov; Mark Knoblauch; Tanner O Monroe; RuiRui Ji; Amy D Hanna; Aditya D Joshi; Cheng Long; Joshua Oakes; Ted Tran; Benjamin T Corona; Sabina Lorca; Christopher P Ingalls; Vihang A Narkar; Johanna T Lanner; J Henri Bayle; William J Durham; Susan L Hamilton Journal: J Biol Chem Date: 2014-07-22 Impact factor: 5.157
Authors: Mi Ri Oh; Keon Jin Lee; Mei Huang; Jin Ock Kim; Do Han Kim; Chung-Hyun Cho; Eun Hui Lee Journal: Sci Rep Date: 2017-12-20 Impact factor: 4.379
Authors: Jun Hee Choi; Mei Huang; Changdo Hyun; Mi Ri Oh; Keon Jin Lee; Chung-Hyun Cho; Eun Hui Lee Journal: Sci Rep Date: 2019-12-16 Impact factor: 4.379