Literature DB >> 27901468

Loss of Frataxin activates the iron/sphingolipid/PDK1/Mef2 pathway in mammals.

Kuchuan Chen1, Tammy Szu-Yu Ho2, Guang Lin3, Kai Li Tan1, Matthew N Rasband1,2, Hugo J Bellen1,2,3,4,5.   

Abstract

Friedreich's ataxia (FRDA) is an autosomal recessive neurodegenerative disease caused by mutations in Frataxin (FXN). Loss of FXN causes impaired mitochondrial function and iron homeostasis. An elevated production of reactive oxygen species (ROS) was previously proposed to contribute to the pathogenesis of FRDA. We recently showed that loss of frataxin homolog (fh), a Drosophila homolog of FXN, causes a ROS independent neurodegeneration in flies (Chen et al., 2016). In fh mutants, iron accumulation in the nervous system enhances the synthesis of sphingolipids, which in turn activates 3-phosphoinositide dependent protein kinase-1 (Pdk1) and myocyte enhancer factor-2 (Mef2) to trigger neurodegeneration of adult photoreceptors. Here, we show that loss of Fxn in the nervous system in mice also activates an iron/sphingolipid/PDK1/Mef2 pathway, indicating that the mechanism is evolutionarily conserved. Furthermore, sphingolipid levels and PDK1 activity are also increased in hearts of FRDA patients, suggesting that a similar pathway is affected in FRDA.

Entities:  

Keywords:  Frataxin; Friedreich's ataxia; Mef2; PDK1; human; iron; mouse; neuroscience; sphingolipid

Mesh:

Substances:

Year:  2016        PMID: 27901468      PMCID: PMC5130293          DOI: 10.7554/eLife.20732

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

FRDA is the most prevalent form of recessive cerebellar ataxia characterized by neurodegeneration and cardiomyopathy. Patients with FRDA exhibit a progressive degeneration of the dorsal root ganglia, sensory peripheral nerves, and dentate nuclei of the cerebellum. Most individuals develop several neurological symptoms at a juvenile age, but individuals with adult or late onset are occasionally reported (Koeppen, 2011). Mutations in FXN were discovered as the primary cause of FRDA (Campuzano et al., 1996). Studies of the yeast frataxin homolog identified a role for FXN in iron-sulfur cluster biosynthesis and iron homeostasis (Babcock et al., 1997; Mühlenhoff et al., 2002; Rötig et al., 1997). Loss of FXN has been shown to cause mitochondrial dysfunction in several model organisms (Anderson et al., 2005; Puccio et al., 2001; Rötig et al., 1997). Yet, whether iron accumulates in the nervous system is still under debate, as it has been reported that iron levels are not altered in the nervous system of a conditional knockout mouse model and in FRDA patients (Puccio et al., 2001; Simon et al., 2004; Solbach et al., 2014). However, in FRDA patients, iron was shown to accumulate in the dentate nuclei or in glia cells of dorsal root ganglia (Boddaert et al., 2007; Koeppen et al., 2009). In sum, the iron deposition phenotype is still controversial in mouse models and FRDA patients, and the role of iron in the pathophysiology of FRDA has not yet been determined. It has been proposed that ROS, generated by impaired mitochondrial electron transport chain complexes or iron deposition, mediate the pathogenesis in FRDA (Bayot et al., 2011; Santos et al., 2010). However, emerging evidence suggests that ROS are not elevated in several model organisms, and several clinical trials based on antioxidant therapy have shown no or limited benefit in FRDA patients (Babcock et al., 1997; Llorens et al., 2007; Macevilly and Muller, 1997; Santhera Pharmaceuticals, 2010; Seznec et al., 2005; Shidara and Hollenbeck, 2010). Hence, the pathogenesis of this disease is still poorly understood. In a recent study, we described the first fly mutant allele of frataxin homolog (fh), the fly homolog of FXN (Chen et al., 2016). We showed that loss of fh in Drosophila leads to iron accumulation in the nervous system, which in turn induces sphingolipid synthesis and ectopically activates Pdk1 and Mef2. Mef2 activation triggers the aberrant transcription of downstream target genes that causes the degeneration of fly photoreceptors (Chen et al., 2016). However, whether this pathway is also affected in vertebrates upon loss of FXN is unknown. Here, we removed the endogenous mouse Fxn gene by using an adeno-associated virus (AAV) and CRISPR/Cas9 strategy (Swiech et al., 2014). We show that the iron/sphingolipid/PDK1/Mef2 pathway is activated in mice upon loss of Fxn. Furthermore, sphingolipids and PDK1 activity are also up-regulated in hearts of FRDA patients, suggesting that this pathway is also affected in FRDA. Hence, down-regulation of this pathway provides possible new targets to interfere with disease progression.

Results

To test if the iron/sphingolipid/PDK1/Mef2 pathway is activated in vertebrates in vivo upon loss of Fxn, we reduced Fxn levels in the mouse nervous system by using the AAV and CRISPR/Cas9 system (Swiech et al., 2014). We designed two different Fxn single guide RNAs (sgRNAs) and tested their efficiency. The Fxn-sgRNAs induce lesions in the Fxn locus and reduce the levels of FXN protein when compared to the LacZ-sgRNA control in Neuro-2a cells (Figure 1—figure supplement 1A and B). To deliver LacZ- or Fxn-sgRNA into the nervous system, we injected AAV that carried sgRNA into the ventricle of Rosa26-Cas9 knock-in newborn mouse brains (Platt et al., 2014), and the efficiency of AAV infection into the cortical neurons was examined. As shown in Figure 1—figure supplement 1C, the majority of cortical neurons are infected with AAV, and the mRNA levels of Fxn in Fxn-sgRNA mice are less than 40% of the LacZ-sgRNA control mice (Figure 1—figure supplement 1D).
Figure 1—figure supplement 1.

Removal of Fxn using AAV and CRISPR/Cas9.

(A) T7 endonuclease assay to detect Cas9 induced mutations. Red arrows indicate the mismatched genomic Fxn DNA fragments which are cleaved by T7 endonuclease. (B) Immunoblot of FXN protein levels of Neuro-2a cells with LacZ- or Fxn-sgRNA expression. (C) AAV infection efficiency. AAV carrying Fxn-sgRNA with a GFP marker was delivered into the P1 mouse brain. GFP fluorescence indicates cells with AAV infection (green). Nuclei are labeled with DAPI (blue). Scale bar, 50 μm. (D) mRNA levels of Fxn in LacZ- and Fxn-sgRNA mice. Data are presented as mean ± SEM. ***, p<0.001, Student’s t-test.

DOI: http://dx.doi.org/10.7554/eLife.20732.003

At approximately four months of age the Fxn-sgRNA mice (mice with Fxn-sgRNA AAV injection) develop an abnormal appearance when compared to LacZ-sgRNA control mice. These include a smaller body size and a hunchback phenotype at P130 (Figure 1A). Interestingly, these features are similar to the neuronal conditional knockout mice that were previously reported (Puccio et al., 2001). In addition, the Fxn-sgRNA mice become much less mobile than their LacZ-sgRNA littermates (Videos 1 and 2). The Fxn-sgRNA mice also display an aberrant reflex when lifted by the tail as they fail to spread their hind limbs (Figure 1B). To evaluate the sensorimotor coordination, we performed a rotarod test at two different ages. At P50, we observe no difference between LacZ-sgRNA and Fxn-sgRNA mice. However, Fxn-sgRNA mice show a significant reduction of latency to fall from the rod at age of P130 (Figure 1C). Besides the deficit on the rotarod test, Fxn-sgRNA mice also show a severe impairment in the wire hang test at P130 (Figure 1D). In summary, a removal of Fxn in a substantial neuronal population in the newborn mouse brain causes a severe impairment of neuronal function.
Figure 1.

Phenotypic characterization of Fxn-sgRNA mice.

(A) Body size of LacZ- and Fxn-sgRNA mice at P130. Fxn-sgRNA mice exhibit a hunchback phenotype. (B) Hindlimb reflexes of LacZ- and Fxn-sgRNA mice at P130. (C) Rotarod test of LacZ- and Fxn-sgRNA mice at P50 (n = 5) and P130 (n = 6). (D) Wire hang test of LacZ- and Fxn-sgRNA mice at P130. n = 6. Data are presented as mean ± SEM. ***, p<0.001, Student’s t-test.

DOI: http://dx.doi.org/10.7554/eLife.20732.002

(A) T7 endonuclease assay to detect Cas9 induced mutations. Red arrows indicate the mismatched genomic Fxn DNA fragments which are cleaved by T7 endonuclease. (B) Immunoblot of FXN protein levels of Neuro-2a cells with LacZ- or Fxn-sgRNA expression. (C) AAV infection efficiency. AAV carrying Fxn-sgRNA with a GFP marker was delivered into the P1 mouse brain. GFP fluorescence indicates cells with AAV infection (green). Nuclei are labeled with DAPI (blue). Scale bar, 50 μm. (D) mRNA levels of Fxn in LacZ- and Fxn-sgRNA mice. Data are presented as mean ± SEM. ***, p<0.001, Student’s t-test.

DOI: http://dx.doi.org/10.7554/eLife.20732.003

Video 1.

LacZ- and Fxn-sgRNA mice at P130.

DOI: http://dx.doi.org/10.7554/eLife.20732.004

Video 2.

Fxn-sgRNA mice at P130.

DOI: http://dx.doi.org/10.7554/eLife.20732.005

Phenotypic characterization of Fxn-sgRNA mice.

(A) Body size of LacZ- and Fxn-sgRNA mice at P130. Fxn-sgRNA mice exhibit a hunchback phenotype. (B) Hindlimb reflexes of LacZ- and Fxn-sgRNA mice at P130. (C) Rotarod test of LacZ- and Fxn-sgRNA mice at P50 (n = 5) and P130 (n = 6). (D) Wire hang test of LacZ- and Fxn-sgRNA mice at P130. n = 6. Data are presented as mean ± SEM. ***, p<0.001, Student’s t-test. DOI: http://dx.doi.org/10.7554/eLife.20732.002

Removal of Fxn using AAV and CRISPR/Cas9.

(A) T7 endonuclease assay to detect Cas9 induced mutations. Red arrows indicate the mismatched genomic Fxn DNA fragments which are cleaved by T7 endonuclease. (B) Immunoblot of FXN protein levels of Neuro-2a cells with LacZ- or Fxn-sgRNA expression. (C) AAV infection efficiency. AAV carrying Fxn-sgRNA with a GFP marker was delivered into the P1 mouse brain. GFP fluorescence indicates cells with AAV infection (green). Nuclei are labeled with DAPI (blue). Scale bar, 50 μm. (D) mRNA levels of Fxn in LacZ- and Fxn-sgRNA mice. Data are presented as mean ± SEM. ***, p<0.001, Student’s t-test. DOI: http://dx.doi.org/10.7554/eLife.20732.003

LacZ- and Fxn-sgRNA mice at P130.

DOI: http://dx.doi.org/10.7554/eLife.20732.004

Fxn-sgRNA mice at P130.

DOI: http://dx.doi.org/10.7554/eLife.20732.005 We further characterized the neuronal phenotype by examining brain sections at P130. We observed that the activating transcription factor 3 (ATF3), a marker that is typically associated with cellular stress response and neuronal damage (Tsujino et al., 2000), is up-regulated in cortical neurons of Fxn-sgRNA mice (Figure 2A). However, no ATF3 positive cells were observed in LacZ-sgRNA mice (Figure 2A). In addition, the axon initial segments, specialized membrane regions where Na+ channels cluster to initiate action potentials (Szu-Yu Ho and Rasband, 2011), are lost in cortical neurons of Fxn-sgRNA mice. As shown in Figure 2B, the scaffolding protein required for the formation and maintenance of the axon initial segment, ankyrin-G (AnkG), is severely reduced or lost in cortical neurons in Fxn-sgRNA mice, especially in ATF3 positive neurons (Figure 2B). These data suggest that loss of Fxn in cortical neurons leads to severe neuronal injury and damage.
Figure 2.

Loss of Fxn leads to neuronal insults.

(A) Immunostaining of cerebral cortex layer I (top) to VI (bottom) of LacZ- and Fxn-sgRNA mice at P130. ATF3 is labeled in red, and nuclei are marked by Hoechst in blue. n = 3. Quantification is on the right. Scale bar, 50 μm. (B) Immunostaining of cortical neurons of LacZ- and Fxn-sgRNA mice at P130. Axon initial segments are marked by anti-AnkG antibody (green), and ATF3 is marked in red. n = 3. Quantification is on the right. Scale bar, 10 μm. Data are presented as mean ± SEM. **, p<0.01, ***, p<0.001, Student’s t-test.

DOI: http://dx.doi.org/10.7554/eLife.20732.006

Loss of Fxn leads to neuronal insults.

(A) Immunostaining of cerebral cortex layer I (top) to VI (bottom) of LacZ- and Fxn-sgRNA mice at P130. ATF3 is labeled in red, and nuclei are marked by Hoechst in blue. n = 3. Quantification is on the right. Scale bar, 50 μm. (B) Immunostaining of cortical neurons of LacZ- and Fxn-sgRNA mice at P130. Axon initial segments are marked by anti-AnkG antibody (green), and ATF3 is marked in red. n = 3. Quantification is on the right. Scale bar, 10 μm. Data are presented as mean ± SEM. **, p<0.01, ***, p<0.001, Student’s t-test. DOI: http://dx.doi.org/10.7554/eLife.20732.006 To assess if the iron/sphingolipid/PDK1/Mef2 pathway is activated in the brains of Fxn-sgRNA mice, we assessed if iron levels are increased upon loss of Fxn. To examine Fe3+ levels, we performed Perls’ staining and used 3,3'-diaminobenzidine (DAB) to enhance the signal. At P130 the DAB signal is strongly increased in brain sections of Fxn-sgRNA mice when compared to control mice (Figure 3A). To further characterize the iron distribution, we co-stain iron with neuronal and glia markers in the same brain sections. Since strong DAB signal interferes with the fluorescence, we chose the cortex region with relatively weak DAB deposits of Fxn-sgRNA mice. Interestingly, the majority of DAB signals are co-localized with a neuronal marker but not glial markers, suggesting that Fe3+ accumulates in neurons, although there are some weak diffuse signals distributed outside of the cell body (Figure 3 and Figure 3—figure supplement 1). These data show that Fe3+ accumulates in the nervous system upon loss of Fxn. The fact that we observed an obvious Fe3+ accumulation, whereas previous reports did not, is likely due to the use of DAB to enhance the Perls' Prussian blue staining, as we did not observe any signal with Perls' Prussian blue staining alone (Figure 3—figure supplement 2A).
Figure 3.

Loss of Fxn leads to an activation of the iron/sphingolipid/PDK1/Mef2 pathway.

(A) Perls’ blue staining with DAB enhancement of the cerebral cortex layer I (top) to VI (bottom) of LacZ- and Fxn-sgRNA mice at P130. n = 3. Scale bar, 100 and 10 μm. (B) RPA and RPAC staining of mouse cortical neurons of LacZ- and Fxn-sgRNA mice at P60. RPA and RPAC fluorescence is in red, and nuclei are labeled by DAPI in green. n = 3. Scale bar: 20 µm. (C) Immunoblot of PDK1 phosphorylation levels of brains of LacZ- and Fxn-sgRNA mice at P60. (D) mRNA levels of Mef2 downstream targets of LacZ- and Fxn-sgRNA mice at P60. n = 3. Data are presented as mean ± SEM. *, p<0.05. **, p<0.01, Student’s t-test.

DOI: http://dx.doi.org/10.7554/eLife.20732.007

Perls’/DAB staining with neuronal and glial markers of the cerebral cortex of LacZ- and Fxn-sgRNA mice at P130. Neurons are marked by NeuroTrace (red), astrocytes are marked by anti-GFAP antibody (green), and microglia are marked by anti-Iba1 antibody (cyan). DAB signals are marked by circles in other images. Scale bar: 12 µm.

DOI: http://dx.doi.org/10.7554/eLife.20732.008

(A) Perls’ blue staining without DAB enhancement of cerebral cortex layer I (top) to VI (bottom) of LacZ- and Fxn-sgRNA mice at P130. Scale bar: 100 µm. (B) Immunoblot of 4-HNE levels in brain tissues of LacZ- and Fxn-sgRNA mice at P130. (C) Immunoblot of PDK1 levels in brain tissues of LacZ- and Fxn-sgRNA mice at P60.

DOI: http://dx.doi.org/10.7554/eLife.20732.009

Figure 3—figure supplement 1.

Fe3+ distribution in brains of LacZ- and Fxn-sgRNA mice.

Perls’/DAB staining with neuronal and glial markers of the cerebral cortex of LacZ- and Fxn-sgRNA mice at P130. Neurons are marked by NeuroTrace (red), astrocytes are marked by anti-GFAP antibody (green), and microglia are marked by anti-Iba1 antibody (cyan). DAB signals are marked by circles in other images. Scale bar: 12 µm.

DOI: http://dx.doi.org/10.7554/eLife.20732.008

Figure 3—figure supplement 2.

Fe3+ staining and immunoblot of LacZ- and Fxn-sgRNA mice.

(A) Perls’ blue staining without DAB enhancement of cerebral cortex layer I (top) to VI (bottom) of LacZ- and Fxn-sgRNA mice at P130. Scale bar: 100 µm. (B) Immunoblot of 4-HNE levels in brain tissues of LacZ- and Fxn-sgRNA mice at P130. (C) Immunoblot of PDK1 levels in brain tissues of LacZ- and Fxn-sgRNA mice at P60.

DOI: http://dx.doi.org/10.7554/eLife.20732.009

Loss of Fxn leads to an activation of the iron/sphingolipid/PDK1/Mef2 pathway.

(A) Perls’ blue staining with DAB enhancement of the cerebral cortex layer I (top) to VI (bottom) of LacZ- and Fxn-sgRNA mice at P130. n = 3. Scale bar, 100 and 10 μm. (B) RPA and RPAC staining of mouse cortical neurons of LacZ- and Fxn-sgRNA mice at P60. RPA and RPAC fluorescence is in red, and nuclei are labeled by DAPI in green. n = 3. Scale bar: 20 µm. (C) Immunoblot of PDK1 phosphorylation levels of brains of LacZ- and Fxn-sgRNA mice at P60. (D) mRNA levels of Mef2 downstream targets of LacZ- and Fxn-sgRNA mice at P60. n = 3. Data are presented as mean ± SEM. *, p<0.05. **, p<0.01, Student’s t-test. DOI: http://dx.doi.org/10.7554/eLife.20732.007

Fe3+ distribution in brains of LacZ- and Fxn-sgRNA mice.

Perls’/DAB staining with neuronal and glial markers of the cerebral cortex of LacZ- and Fxn-sgRNA mice at P130. Neurons are marked by NeuroTrace (red), astrocytes are marked by anti-GFAP antibody (green), and microglia are marked by anti-Iba1 antibody (cyan). DAB signals are marked by circles in other images. Scale bar: 12 µm. DOI: http://dx.doi.org/10.7554/eLife.20732.008

Fe3+ staining and immunoblot of LacZ- and Fxn-sgRNA mice.

(A) Perls’ blue staining without DAB enhancement of cerebral cortex layer I (top) to VI (bottom) of LacZ- and Fxn-sgRNA mice at P130. Scale bar: 100 µm. (B) Immunoblot of 4-HNE levels in brain tissues of LacZ- and Fxn-sgRNA mice at P130. (C) Immunoblot of PDK1 levels in brain tissues of LacZ- and Fxn-sgRNA mice at P60. DOI: http://dx.doi.org/10.7554/eLife.20732.009 We next assessed Fe2+ levels by using RPA (Petrat et al., 2002). RPA is a cell-permeable fluorescent dye that selectively accumulates in mitochondria, and its fluorescence is stoichiometrically quenched by Fe2+ (Petrat et al., 2002). Interestingly, we observed Fe2+ accumulation in the brain of Fxn-sgRNA mice at P60, a time point at which we did not observe behavioral defects in the Fxn-sgRNA mice. As shown in Figure 3B, the RPA fluorescence is quenched in cells of cortical layer IV and V of Fxn-sgRNA mice when compared to LacZ-sgRNA controls, indicating an accumulation of Fe2+ in the nervous system upon loss of Fxn. As a negative control, we used RPAC, a dye that is structurally very similar to RPA but is insensitive to Fe2+ mediated fluorescence quenching. RPAC is present at similar levels in both Fxn-sgRNA and LacZ-sgRNA brains (Figure 3B), suggesting that the decreased fluorescence of RPA in Fxn-sgRNA mice is not due to impaired dye uptake but due to Fe2+ quenching. It was previously proposed that iron deposition triggers free radical production via Fenton’s reaction. We therefore measured oxidative stress by examining the levels of 4-hydroxynonenal (4-HNE), a major product of lipid peroxidation (Ayala et al., 2014). However, we did not observe an increase of 4-HNE in Fxn-sgRNA brain tissues (Figure 3—figure supplement 2B), consistent with previous observations in flies (Chen et al., 2016). We next determined if iron triggers the activation of the PDK1/Mef2 pathway in Fxn-sgRNA mice. Phosphorylation of S241 in the PDK1 activation loop is required for its activity (Casamayor et al., 1999). We observed an increase in phosphorylation levels of S241 in Fxn-sgRNA mice compared to the LacZ-sgRNA mice at P60, prior to the onset of symptoms (Figure 3C and Figure 3—figure supplement 2C). To assess if Mef2 is activated in Fxn-sgRNA mice, we determined the mRNA levels of several validated Mef2 downstream targets (Anderson et al., 2004; Ewen et al., 2011; Potthoff et al., 2007; Woronicz et al., 1995). As shown in Figure 3D, many, but not all, transcripts are up-regulated 1.5–3 fold in Fxn-sgRNA mice at P60. This is consistent with previous findings that only about half of Mef2 targets are up-regulated (to 2–3 fold) when Mef2A is overexpressed (Ewen et al., 2011). In summary, these results provide evidence that the PDK1/Mef2 pathway is activated in the vertebrate nervous system upon loss of Fxn prior to the onset of phenotypes that are observed about two months later. Last, we tested if the same pathway is also activated in FRDA patients. As we were unable to obtain cerebella and dorsal root ganglia of patients, we used heart samples that were previously shown to accumulate Fe3+ (Bradley et al., 2000; Koeppen, 2011). We first investigated the sphingolipid levels in frozen heart tissues of five controls and six FRDA patients. As shown in Figure 4A, a substantial fraction of the sphingolipids are increased in FRDA patients when compared to controls, including short chain ceramides (C14-C18), different dihydroceramides, dihydrosphingosines, dihydrosphingosine-1-phosphate, and sphingosine. Finally, we tested if PDK1 activity is also increased in FRDA patients. The phosphorylation levels of S241 in PDK1 are elevated in FRDA patients when compared to controls (Figure 4B). Note that patient six showed no obvious increase in PDK1 phosphorylation when compared to the other patients. This patient had relatively mild symptoms and a later onset of disease (age 18) than other patients (ages 4 to 9). The age of death was also much later in patient 6 (age 67) compared to the other patients (age 25–37). Similarly, the increased levels of sphingolipids in patient six are also less pronounced than other patients. In sum, these data suggest that the iron/sphingolipid/PDK1/Mef2 pathway is activated in FRDA patients and that it may contribute to the pathogenesis of FRDA.
Figure 4.

Sphingolipid levels and PDK1 activity are increased in heart tissues of FRDA patients.

(A) Sphingolipid profiling of heart tissues from controls (n = 5) and FRDA patients (n = 6). Data are presented as mean ± SEM. (B) Immunoblot of PDK1 phosphorylation levels of heart tissues from controls (n = 5) and FRDA patients (n = 6). Box plot of PDK1 phosphorylation is on the right.

DOI: http://dx.doi.org/10.7554/eLife.20732.010

Sphingolipid levels and PDK1 activity are increased in heart tissues of FRDA patients.

(A) Sphingolipid profiling of heart tissues from controls (n = 5) and FRDA patients (n = 6). Data are presented as mean ± SEM. (B) Immunoblot of PDK1 phosphorylation levels of heart tissues from controls (n = 5) and FRDA patients (n = 6). Box plot of PDK1 phosphorylation is on the right. DOI: http://dx.doi.org/10.7554/eLife.20732.010

Discussion

Here we show that removal of Fxn in the central nervous system using AAV and CRISPR/Cas9 causes behavioral and neurological phenotypes in mice. This new FXN mouse model exhibits several similar phenotypes to the previous neuronal conditional knockout mouse model, including smaller body size, hunchback phenotype, impaired locomotion, and shortened life span (Puccio et al., 2001). By using RPA and Perls'/DAB stainings, more sensitive iron staining assays than Perls’ Prussian blue staining alone, we found that Fe2+ and Fe3+ levels are increased in the cerebral cortex of Fxn-sgRNA mice, and the activities of PDK1 and Mef2 are up-regulated, suggesting that the iron/sphingolipid/PDK1/Mef2 pathway, previously identified in fly fh mutants, is also activated in Fxn-sgRNA mice. Importantly, sphingolipids and PDK1 activity are also up-regulated in the hearts of FRDA patients, indicating that a similar pathway is also activated and may contribute to the pathogenic mechanism of FRDA. Iron toxicity has been long considered as a possible pathogenic contributor of FRDA. However, the iron accumulation phenotypes have never been reported in the nervous system in an inducible conditional knockout mouse model (Martelli and Puccio, 2014; Puccio et al., 2001; Simon et al., 2004). We provide the first direct evidence that both Fe2+ and Fe3+ accumulate in the brain upon loss of Fxn. In addition, we noticed that irons are not only deposited inside the neuronal cell body but also present in the extracellular space. For example, DAB staining showed a diffuse pattern in and surrounding the neuronal cell body (Figure 3A and Figure 3—figure supplement 1), and the RPA fluorescence is similarly reduced in the extracellular space (Figure 3B), suggesting that iron accumulation occurs both intracellularly and extracellularly. It is worth noting that the iron/sphingolipid/PDK1/Mef2 pathway is conserved from yeast to fly (Chen et al., 2016; Lee et al., 2012), and that this pathway is also activated in Fxn-sgRNA mice and the hearts of FRDA patients. Interestingly, genetic variations at the 5’UTR of Mef2C that promote Mef2C transcription are associated with hypertrophic cardiomyopathy (Alonso-Montes et al., 2012). In addition, overexpression of Mef2A or Mef2C causes cell sarcomeric disorganization and elongation in cultured cardiomyocytes (Xu et al., 2006). These data suggest that an activation of iron/sphingolipid/PDK1/Mef2 pathway may play a role in the induction of cardiomyopathy in FRDA patients. Inhibition of this pathway may not only suppress neurodegeneration, but also prevent or delay cardiomyopathy, the major cause of lethality in FRDA. In sum, this pathway may provide us with therapeutic targets based on antisense oligonucleotide strategies (Ackermann et al., 2012), an option that should be explored.

Materials and methods

sgRNA design

sgRNAs were designed using the CRISPR Design Tool (http://crispr.mit.edu). Control sgRNA sequence was designed to target lacZ gene from Escherichia coli (Swiech et al., 2014): TGCGAATACGCCCACGCGAT. Fxn-sgRNA sequences targeting the 5’ end of the Fxn gene locus were used: Fxn sgRNA-1, AGGGAACCGATCGTAACCTG and Fxn sgRNA-2, TTCGGAGGTCGCGCAGCCGT. sgRNAs DNA duplex were subcloned into the AAV-SpGuide vector (Addgene) (Swiech et al., 2014). To test sgRNA efficiency in genome editing, AAV-SpCas9 (Addgene) and AAV-sgRNA constructs were co-transfected into Neuro-2a cells. Cells were harvested 48 hr after transfection and the genomic DNA was extracted. A ~1 Kb fragment containing the Fxn sgRNA sequence was PCR amplified with the following primers, Fxn_F: 5’-CACCAGCGATCTTCAGAATCACC-3’ and Fxn-R: 5’-GGAGGCAGGAGGATCACAGG-3’. PCR products were then re-hybridized and cleaved by T7 endonuclease (NEB). Fragmented PCR products were then analyzed by 2% agarose gel. To test sgRNA efficiency in Fxn protein levels, AAV-SpCas9 (Addgene) and AAV-sgRNA constructs were co-transfected into Neuro-2a cells. As anti-FXN antibody cannot recognize the endogenous FXN proteins, we co-transfected Fxn-cDNA construct into Neuro-2a cells to allow FXN overexpression. Cells were then harvested and the FXN protein levels were analyzed by immunoblotting.

AAV production and purification

AAV vectors were produced at the Gene Vector Core, Baylor College of Medicine. Dulbecco’s modified Eagle’s medium (DMEM) with high glucose (4.5 g/l) and antibiotic-antimycotic were purchased from GenDEPOT (Katy, TX), and fetal bovine serum (FBS) was purchased from Sigma (St. Louis, MO). HEK293T cells were grown in DMEM supplemented with 10% FBS and 1x antibiotic-antimycotic. DJ/8 Rep-Cap plasmid (Grimm et al., 2008) was purchased from Cell Biolabs (San Diego, CA). AAVs were packaged by three plasmids transfection (transfer vector, DJ/8, and helper plasmid) using iMFectin Poly DNA Transfection Reagent (GenDEPOT). In brief, 80–90% confluent HEK293T cells in a 15 cm dish were split into 6×15 cm dish one day before transfection. Next day, the media was removed and replaced with 9 ml of fresh DMEM/5% FBS. 24 µl of iMFectin reagent were diluted to 0.5 ml by DMEM and then added to 0.5 ml of DMEM containing 4 µg of helper plasmid, 2 µg of DJ/8 and 2 µg of transfer vector. The transfection mixture was vortexed for 10 s and incubated for 15 min at room temperature before overlay on HEK293T cells without removing media. After 4 hr, 10 ml of DMEM/5% FBS were added and cells were incubated in humidified CO2 incubator. AAV purification was performed by the method developed by Ayuso et al (Ayuso et al., 2010) with modifications. Three days after transfection, cells were collected by centrifugation at 2500 x g for 10 min. Cell culture supernatant was retained for subsequent precipitation. The cell pellet was re-suspended in 1 ml of 50 mM Tris pH8.0 containing 5 mM MgCl2 and 0.15 M NaCl per plate, lysed by adding 0.1 vol of 5% sodium deoxycholate at room temperature for 30 min and then incubated with 10 µg/ml of DNase I and RNase A for 1 hr at 37°C. Cell lysates were clarified by centrifugation at 5000 x g for 10 min at 4°C. Cell culture supernatant was incubated with 10 µg/ml of DNase I and RNase A for 1 hr at 37°C and then incubated at 4°C overnight after addition of a stock solution of 40% polyethylene glycol (PEG) 8000 containing 2.5 M NaCl to final concentration of 8% PEG. AAV in cell culture supernatant was collected by centrifugation at 2500 x g for 30 min. The pellets containing AAV were re-suspended in a minimal volume of HBS (50 mM HEPES, 0.15 M NaCl, 1% Sarcosyl, 20 mM EDTA, pH8.0). Cell associated and secreted AAVs were combined for the subsequent iodixanol density centrifugation (Zolotukhin et al., 1999). AAVs were dialyzed against phosphate buffered saline without Mg2+ and Ca2+ and the titer was determined by real time PCR using vector specific primers (Ljungberg et al., 2012).

AAV injection into the neonatal mouse brain

Rosa26-Cas9 knockin mice (Gt(ROSA)26Sor, Stock No. 024858, the Jackson Laboratory, gift from Huda Zoghbi) were used for AAV injection. P1 neonates were cryo-anesthesized at 0°C for 3 min before injection. AAVDJ-8 carrying Fxn-sgRNA or control LacZ-sgRNA (2 × 1014 gc/ml) was injected into the ventricles using a pulled glass needle. After injection, pups were laid on a warm pad until recovery. The brains were dissected at P60 and P130 after virus injection. All mouse work and procedures were approved by the Animal Care and Use Committee at Baylor College of Medicine and were performed in accordance with the guidelines of the U.S. National Institutes of Health (animal protocol: an-4634).

Behavior test

LacZ- and Fxn-sgRNA mice were subjected to accelerating rotarod and wire hang tests as previously described (Zhang et al., 2013).

Iron staining

To detect Fe2+ levels of AAV injected mouse brain, the brains were dissected and embedded into 2.5% low-melting agarose (Sigma-Aldrich). The 100 μm brain sections were acquired by a vibratome (1000 Classic; Warner Instruments) and transferred into 24 well plate with ice-cold artificial cerebrospinal fluid (ACSF) (125 mM NaCl, 2.5 mM KCl, 1 mM MgCl2 6H2O, 1.25 mM NaH2PO4, 2 mM CaCl2.2H2O, 25 mM NaHCO3, 25 mM Glucose, pH 7.4). The brain sections were then incubated with 10 µM RPA or RPAC (Squarix Biotechnology) in ACSF for 20 min at room temperature in the dark. The samples were washed subsequently three times by ACSF. To detect Fe3+ levels, brains were dissected and fixed in 4% paraformaldehyde for 1 hr on ice followed by immersion in 20% sucrose overnight at 4°C. Brains were then sectioned using a freezing stage Microtome (Microm KS 34, Thermo Scientific) and spread out on glass coverslips. Brain slices were then incubated with Perls’ solution (1% K4Fe(CN)6 and 1% HCl in 0.4% Triton-PBS) for 10 min. After three quick washes in 0.4% Triton-PBS, samples were incubated for 5 min with DAB solution (10 mg DAB with 0.07% H2O2 in 0.4% Triton-PBS) to enhance the signal. The brains were then quickly washed three times with 0.4% Triton-PBS and mounted. The images were obtained with an Axio-imager Z1 microscope (Carl Zeiss) fitted with an AxioCam digital camera (Carl Zeiss). The images were analyzed by ZEN 2012 (Carl Zeiss).

Immunofluorescence staining

For mouse brain staining, brains were dissected and fixed in 4% paraformaldehyde for 1 hr on ice followed by immersion in 20% sucrose overnight at 4°C. Brains were then sectioned using a freezing stage Microtome (Microm KS 34, Thermo Scientific) and spread out on glass coverslips for immunostaining. The antibodies were used at the following concentrations: mouse anti-AnkG (N106/36, N106/20) (UC Davis/NIH), 1:200; rabbit anti-ATF3 (Santa Cruz) (RRID:AB_2058590), 1:500; chicken anti-GFP (ab13970, abcam) (RRID:AB_300798), 1:1000; rabbit anti-Iba1 (019–19741, Wako), 1:250; chicken anti-GFAP (ab4674, abcam) (RRID:AB_304558), 1:500; NeuroTrace (Thermo Scientific), 1:200; Alexa 488-, Cy3-, or Cy5-conjugated secondary antibodies (Jackson ImmunoResearch), 1:250. Samples were then mounted in Vectashield (Vector Laboratories) before being analyzed under a confocal microscope. The images were obtained with an Axio-imager Z1 microscope (Carl Zeiss) fitted with an AxioCam digital camera (Carl Zeiss). The images were analyzed by ZEN 2012 (Carl Zeiss).

Immunoblot

For the Neuro-2a cells (RRID:CVCL_0470), cells were harvested and lysed in ice-cold RIPA buffer (50 mM Tris-HCl, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS, 50 mM NaF, 1 mM Na3VO4, 10% Glycerol, protease inhibitor Cocktail (Roche)) 48 hr after transfection. The samples were then centrifuged at 16,100 ×g for 10 min to remove nuclei and debris. For the brain tissues, mouse brains were dissected, frozen on dry ice and homogenized as previously described (Ho et al., 2014). Briefly, brains were homogenized in ice-cold homogenization buffer (0.32 M sucrose, 5 mM sodium phosphate, pH 7.2, 1 mM NaF, 1 mM Na3VO4, and protease inhibitors). The homogenates were centrifuged at 700×g for 10 min at 4°C to remove nuclei and debris. The supernatant was then centrifuged at 27,200×g for 90 min at 4°C, and the pellet was resuspended in homogenization buffer (3 ml/g of brain). Protein concentrations were measured using a Bradford assay (Bio-Rad). The samples were resolved by SDS-PAGE, transferred to nitrocellulose membrane, and immunoblotted with the following primary antibodies: rabbit anti-PDK1 (Cel Signaling) (RRID:AB_2236832); rabbit anti-p-PDK1 (Cell Signaling) (RRID:AB_2161134); mouse anti-actin (ICN Biomedicals) (RRID:AB_2336056); rabbit anti-FXN (Santa Cruz) (RRID:AB_2110677); rabbit anti-4-HNE (abcam). Secondary antibodies were from Rockland Immunochemicals. Images were acquired and analyzed with Odyssey CLx Infrared Imaging System (LI-COR Biotechnology).

Mass spectrometry

Sphingolipid profiling of human heart tissues was performed by the Lipidomics Core at the Medical University of South Carolina as previously described (Chen et al., 2016).

Reverse transcription–quantitative polymerase chain reaction (PCR)

Total RNA from mouse brains were extracted by Trizol RNA Isolation Reagents (Thermo Fisher Scientific, Sugar Land, Texas) following the manufacturer’s instructions. The cDNA was synthesized by High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Real-time PCR was performed using iQ SYBR Green Supermix (Bio-Rad) in a thermal cycler (iCycler; Bio-Rad Laboratories). The data were collected and analyzed using the optical module (iQ5; Bio-Rad Laboratories). The following primer pairs are used (5’to 3’): Gapdh forward (control primer), AGGTCGGTGTGAACGGATTTG; Gapdh reverse (control primer), TGTAGACCATGTAGTTGAGGTCA; Ank2 forward, AGATTACTGTGCAGCATAACAGG; Fxn forward, GCTGGAGGGAACCGATCGTA; Fxn reverse, TTCCTCAAATGCACCACGCAG; Ank2 reverse, TGGTTGTAAAGGAAACACACTCA; Dtnbp1 forward, TTAGCAGGTATGAGGATGCGT; Dtnbp1 reverse, GGTGCAGCAAATGGTTCTCTAC; Fhl2 forward, ATGACTGAACGCTTTGACTGC; Fhl2 reverse, CGATGGGTGTTCCACACTCC; Pdlim1 forward, TCGATGGGGAAGATACCAGCA; Pdlim1 reverse, TCTGTTCAGACCTGGATACTGTG; Pdlim5 forward, AGCAGCAAAATGGTAACCCTG; Pdlim5 reverse, CGTGAAGGGGTATCTTTTCCTTT; Sgca forward, GCAGCAGTAACTTGGATACCTC, Sgca reverse, AAAGGATGCACAAACACACGA; Sgcb forward, AGCACAACAGCAATTTCAAAGC, Sgcb reverse, AGGAGGACGATCACGCAGAT; Tcap forward, GATGCGCCTGGGTATCCTC; Tcap reverse, GATCGAGACAGGGTACGGC; Hrc forward, CAACCGATGTACCGAATGTGA; Hrc reverse, GGTAGCAGAATTGACAGTGCTG; Nr4a1 forward, TTGAGTTCGGCAAGCCTACC, Nr4a1 reverse, GTGTACCCGTCCATGAAGGTG; Myom1 forward, GCACGACCATGAGCCACTAC; Myom1 reverse, ACCCTTGAGAATGCCGGGA; Myom2 forward, AAAAGACACAAGCACTTTGACCA; Myom2 reverse, TGGGAGGATGACTGGGTGG.

Control and FRDA patient heart specimens

Frozen heart specimens of FRDA patients were obtained from Dr. Arnulf Koeppen, Veterans Affairs (VA) Medical Center, Albany, NY, USA. Our receipt and analyses of these postmortem tissues was conducted with the approval of the Institutional Review Board at Baylor College of Medicine (protocol H-32191). Table 1 shows clinical and genetic data of six patients with FRDA. Five frozen normal control heart specimens were obtained from National Disease Research Interchange, Philadelphia, PA, USA.
Table 1.

Clinical and genetic data of 6 FRDA patients.

DOI: http://dx.doi.org/10.7554/eLife.20732.011

No.

Gender

Age of onset

Age of death

GAA1

GAA2

1

M

8

27

700

1070

2

M

4

37

674

674

3

F

5

25

800

1100

4

F

9

26

690

850

5

M

7

35

750

1100

6

F

18

67

621

766

The sizes for two GAA trinucleotide repeat expansions in the first intron of FXN in FRDA patients are shown with the smaller expansion designated GAA1 and the larger expansion designated GAA2.

Clinical and genetic data of 6 FRDA patients. DOI: http://dx.doi.org/10.7554/eLife.20732.011 No. Gender Age of onset Age of death GAA1 GAA2 1 M 8 27 700 1070 2 M 4 37 674 674 3 F 5 25 800 1100 4 F 9 26 690 850 5 M 7 35 750 1100 6 F 18 67 621 766 The sizes for two GAA trinucleotide repeat expansions in the first intron of FXN in FRDA patients are shown with the smaller expansion designated GAA1 and the larger expansion designated GAA2. In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included. Thank you for submitting your article "Loss of Frataxin activates the iron/sphingolipid/PDK1/Mef2 pathway in mammals" for consideration by eLife. Your article has been favorably evaluated by a Senior Editor and three reviewers, one of whom is a member of our Board of Reviewing Editors. The following individual involved in review of your submission has agreed to reveal his identity: Bingwei Lu (Reviewer #2). The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission. Summary: This is a short manuscript submitted as a Research Advance that builds upon a recent publication in eLife. The earlier eLife paper characterized the phenotype caused by loss of function of Drosophila Frataxin. The fly mutant showed iron accumulation in the nervous system and activation of a pathway that involves Pdk1 and Mef2 that triggered degeneration, but contrary to expectations, no evidence of ROS. In the current paper, the authors build upon this story by examining the consequence of FXN loss of function in young mice. They validate a sgRNA from mouse FXN in vitro, then use AAV-mediated intraventricular delivery to P0 Rosa26-Cas9 mice, and this results in knockdown of endogenous FXN as assessed by mRNA levels. At P130 the knockdown mice are small, kyphotic, and perform poorly on hanging wire and rotarod. Histologically, the cortices show upregulation of ATF3 and loss of AnkG, as well as deposition of Fe2+ and Fe3+. No elevation of 4-HNE was detected, suggesting no major oxidative stress. Elevated levels of phosphorylated PDK1 and modestly elevated levels of several mRNAs purported to be downstream of Mef2 were detected. Sphingolipid levels in the mice were not examined. Examination of postmortem heart tissue from several FRDA patients showed increased sphingolipid levels and increased levels of phosphorylated PDK1. As may be surmised from the longer-than-usual review period, the editors and reviewers engaged in considerable discussion regarding your submission. This included not only discussion of the data in your submission bit also the definition of an eLife Research Advance. We feel that this new work adds significantly to the message of the original paper. Nevertheless, the data in the research advance still needs to be as solid and persuasive as any other data published in eLife. For this manuscript we believe there are 4 concerns that need to be addressed: 1) Is the methodology used to detect Fe accumulation sound? As the authors' point out, there is a discrepancy between the identification of Fe3+ deposition in this paper and the absence of this finding in a prior conditional knockout (Puccio et al.). The authors suggest that their assay is more sensitive because they amplify the signal with DAB. Is there precedent for this or can they validate this purported increased sensitivity? Can they show this works in tissue from one of the other models to corroborate? 2) Are there regional vulnerabilities to FXN loss within the brain of knockdown mice? In Friedreich's ataxia the loss of FXN most profoundly impacts dorsal root ganglia, spinocerebellar tracts, lateral corticospinal tracts, and posterior columns. The current paper examines only the cortex. Why? 3) A principal conclusion of the earlier paper is that FXN loss resulted in iron accumulation and consequential induction of sphingolipid synthesis, and that this pathway is relevant to the observed degeneration. These FXN knockdown mice exhibit degeneration, but whether this is preceded by increased sphingolipid synthesis is not addressed. 4) The conclusion that the iron/ sphingolipid/ PDK1/Mef2 pathway is operative in this degeneration would be strengthened by examined with cellular resolution by histology, and there was evidence of iron accumulation in the same neurons that show reduced FXN expression (or at least GFP signal), and that these neurons show activation of PDK1/Mef2. Some of these questions may be addressed in the text, but we anticipate that others will require additional experiments. Since these additional experiments are largely histological in nature, we expect that they should not take long, assuming the lab has tissue available. If a few more weeks than the official guideline of 2 months is required please let us know. […] As may be surmised from the longer-than-usual review period, the editors and reviewers engaged in considerable discussion regarding your submission. This included not only discussion of the data in your submission bit also the definition of an eLife Research Advance. We feel that this new work adds significantly to the message of the original paper. Nevertheless, the data in the research advance still needs to be as solid and persuasive as any other data published in eLife. For this manuscript we believe there are 4 concerns that need to be addressed: 1) Is the methodology used to detect Fe accumulation sound? As the authors' point out, there is a discrepancy between the identification of Fe Using Perls’ staining with DAB enhancement is a classical protocol to detect ferric irons, and the protocol was first described in 1980 (Nguyen-Legros et al., 1980). The method has been used in several animal models and tissues, including fly (Kosmidis et al., 2012), zebrafish (Lumsden et al., 2007), and mouse (van Duijn et al., 2013). We have validated the sensitivity by comparing the signals with either Perls’ staining alone or Perls’/DAB staining (Figure 3A and Figure 3—figure supplement 2A), and we only observed an obvious increase in signal in the brain sections by using Perls’/DAB staining. The data clearly show that the Perls’/DAB staining is a more sensitive method to detect ferric irons. We described this method in our previous paper as well and show its application in third instar larval brains. Finally, we were not able to obtain the published Fxn conditional knock-out mice produced by Helen Puccio and colleagues after 5 requests and several phone calls. Therefore, we cannot test Perls’/DAB staining in that mouse model. 2) Are there regional vulnerabilities to FXN loss within the brain of knockdown mice? In Friedreich's ataxia the loss of FXN most profoundly impacts dorsal root ganglia, spinocerebellar tracts, lateral corticospinal tracts, and posterior columns. The current paper examines only the cortex. Why? The primary affected areas in Friedrich’s ataxia patients are the dorsal root ganglia, the dentate nucleus, and the areas mentioned above. Since we are not able to obtain the Fxn conditional knock out mouse, we resorted to injections of the Fxn-sgRNA cloned in AAV into the Rosa26-Cas9 neonatal animals (Kim et al., 2014). The virus spreads into the brain and infected neurons efficiently in cerebral cortex but poorly in the cerebellum and the virus did not reach the dorsal root ganglia. Hence, we choose the cerebral cortex for phenotypic analysis. 3) A principal conclusion of the earlier paper is that FXN loss resulted in iron accumulation and consequential induction of sphingolipid synthesis, and that this pathway is relevant to the observed degeneration. These FXN knockdown mice exhibit degeneration, but whether this is preceded by increased sphingolipid synthesis is not addressed. Since iron, PDK1, and Mef2 activities are obviously increased in mice at P60 (Figure 3B, C, and D), and based on the yeast and fly data, it seems very likely that the iron/sphingolipid/PDK1/Mef2 pathway is activated at P60, before the mice exhibit behavioral defects at P130. In addition, the patient heart samples show increased sphingolipids, further supporting our hypothesis. We recently obtained sphingolipid analyses of single LacZ-sgRNA and Fxn-sgRNA mice at P60 after waiting for many months for the results. The levels of several sphingolipid species are indeed increased, consistent with our other data (see Author response image 1). We did not integrate these data as we feel we need at least 3 samples for a proper analysis. Unfortunately, we currently do not have any mouse brain samples as they were used for all other assays and histochemical stainings. We can re-inject the virus and perform sphingolipid analysis, but it will take at least 5 months to get the data (3 months for mice and 2-3 month for the sphingolipid mass spectrometry). However, given that we already published the pathway in flies and that the hearts of patients show this up-regulation, we feel that we have compelling evidence that this pathway is evolutionarily conserved.
Author response image 1.

Sphingolipid levels of LacZ- and Fxn-sgRNA mice.

DOI: http://dx.doi.org/10.7554/eLife.20732.012

If the reviewers feel that we should include the data, we are willing to integrate the sphingolipid lipid data at P60 in the manuscript as supplemental data with the caveat that they are only based on a single animal.

Sphingolipid levels of LacZ- and Fxn-sgRNA mice.

DOI: http://dx.doi.org/10.7554/eLife.20732.012 4) The conclusion that the iron/ sphingolipid/ PDK1/Mef2 pathway is operative in this degeneration would be strengthened by examined with cellular resolution by histology, and there was evidence of iron accumulation in the same neurons that show reduced FXN expression (or at least GFP signal), and that these neurons show activation of PDK1/Mef2. We agree that examining the phenotype at the single cell resolution will provide us with more and better information about the mechanism. Unfortunately, there is no anti-FXN antibody nor are there anti- phosphorylated PDK1 antibodies available for immunostaining to detect the endogenous FXN levels or PDK1 phosphorylation levels. The anti-FXN antibody produced by Helen Puccio was not made available upon repeated requests and the available commercial antibodies only work for immunoblots. There are also no reagents available to examine Mef2 activity by immunostaining. However, we performed experiments with some formerly made brain sections and examined the iron distribution in the Fxn- sgRNA mice. We found that the DAB signal only co-localized with a neuronal marker and not with glial markers (for astrocytes and microglia), suggesting that iron mostly accumulates in neuronal cells. These data have now been incorporated (Figure 3—figure supplement 1A).
  41 in total

1.  Defects in mitochondrial axonal transport and membrane potential without increased reactive oxygen species production in a Drosophila model of Friedreich ataxia.

Authors:  Yujiro Shidara; Peter J Hollenbeck
Journal:  J Neurosci       Date:  2010-08-25       Impact factor: 6.167

2.  RNAi-mediated suppression of the mitochondrial iron chaperone, frataxin, in Drosophila.

Authors:  Peter R Anderson; Kim Kirby; Arthur J Hilliker; John P Phillips
Journal:  Hum Mol Genet       Date:  2005-10-03       Impact factor: 6.150

3.  Causative role of oxidative stress in a Drosophila model of Friedreich ataxia.

Authors:  José V Llorens; Juan A Navarro; Maria J Martínez-Sebastián; Mary K Baylies; S Schneuwly; José A Botella; Maria D Moltó
Journal:  FASEB J       Date:  2006-12-13       Impact factor: 5.191

4.  Phosphorylation of Ser-241 is essential for the activity of 3-phosphoinositide-dependent protein kinase-1: identification of five sites of phosphorylation in vivo.

Authors:  A Casamayor; N A Morrice; D R Alessi
Journal:  Biochem J       Date:  1999-09-01       Impact factor: 3.857

Review 5.  Friedreich's ataxia: pathology, pathogenesis, and molecular genetics.

Authors:  Arnulf H Koeppen
Journal:  J Neurol Sci       Date:  2011-04-15       Impact factor: 3.181

6.  New polymorphisms in human MEF2C gene as potential modifier of hypertrophic cardiomyopathy.

Authors:  Cristina Alonso-Montes; Manuel Naves-Diaz; Jose Luis Fernandez-Martin; Julian Rodriguez-Reguero; Cesar Moris; Eliecer Coto; Jorge B Cannata-Andia; Isabel Rodriguez
Journal:  Mol Biol Rep       Date:  2012-06-21       Impact factor: 2.316

7.  Sphingolipid signaling mediates iron toxicity.

Authors:  Yueh-Jung Lee; Xinhe Huang; Janette Kropat; Anthony Henras; Sabeeha S Merchant; Robert C Dickson; Guillaume F Chanfreau
Journal:  Cell Metab       Date:  2012-07-03       Impact factor: 27.287

8.  Regulation of skeletal muscle sarcomere integrity and postnatal muscle function by Mef2c.

Authors:  Matthew J Potthoff; Michael A Arnold; John McAnally; James A Richardson; Rhonda Bassel-Duby; Eric N Olson
Journal:  Mol Cell Biol       Date:  2007-09-17       Impact factor: 4.272

9.  Myocyte enhancer factors 2A and 2C induce dilated cardiomyopathy in transgenic mice.

Authors:  Jian Xu; Nanling L Gong; Ilona Bodi; Bruce J Aronow; Peter H Backx; Jeffery D Molkentin
Journal:  J Biol Chem       Date:  2006-02-09       Impact factor: 5.157

10.  Regulation of the Nur77 orphan steroid receptor in activation-induced apoptosis.

Authors:  J D Woronicz; A Lina; B J Calnan; S Szychowski; L Cheng; A Winoto
Journal:  Mol Cell Biol       Date:  1995-11       Impact factor: 4.272

View more
  24 in total

1.  Rapid and Complete Reversal of Sensory Ataxia by Gene Therapy in a Novel Model of Friedreich Ataxia.

Authors:  Françoise Piguet; Charline de Montigny; Nadège Vaucamps; Laurence Reutenauer; Aurélie Eisenmann; Hélène Puccio
Journal:  Mol Ther       Date:  2018-05-28       Impact factor: 11.454

2.  MARRVEL: Integration of Human and Model Organism Genetic Resources to Facilitate Functional Annotation of the Human Genome.

Authors:  Julia Wang; Rami Al-Ouran; Yanhui Hu; Seon-Young Kim; Ying-Wooi Wan; Michael F Wangler; Shinya Yamamoto; Hsiao-Tuan Chao; Aram Comjean; Stephanie E Mohr; Norbert Perrimon; Zhandong Liu; Hugo J Bellen
Journal:  Am J Hum Genet       Date:  2017-05-11       Impact factor: 11.025

3.  Inducible and reversible phenotypes in a novel mouse model of Friedreich's Ataxia.

Authors:  Vijayendran Chandran; Kun Gao; Vivek Swarup; Revital Versano; Hongmei Dong; Maria C Jordan; Daniel H Geschwind
Journal:  Elife       Date:  2017-12-19       Impact factor: 8.140

4.  Transcriptional profiling of isogenic Friedreich ataxia neurons and effect of an HDAC inhibitor on disease signatures.

Authors:  Jiun-I Lai; Daniel Nachun; Lina Petrosyan; Benjamin Throesch; Erica Campau; Fuying Gao; Kristin K Baldwin; Giovanni Coppola; Joel M Gottesfeld; Elisabetta Soragni
Journal:  J Biol Chem       Date:  2018-12-14       Impact factor: 5.157

Review 5.  Pathways to neurodegeneration: lessons learnt from unbiased genetic screens in Drosophila.

Authors:  Neha Singhal; Manish Jaiswal
Journal:  J Genet       Date:  2018-07       Impact factor: 1.166

Review 6.  Building dialogues between clinical and biomedical research through cross-species collaborations.

Authors:  Hsiao-Tuan Chao; Lucy Liu; Hugo J Bellen
Journal:  Semin Cell Dev Biol       Date:  2017-06-01       Impact factor: 7.727

Review 7.  Redox Mechanisms in Neurodegeneration: From Disease Outcomes to Therapeutic Opportunities.

Authors:  Juan I Sbodio; Solomon H Snyder; Bindu D Paul
Journal:  Antioxid Redox Signal       Date:  2018-05-04       Impact factor: 8.401

8.  Progress in understanding Friedreich's ataxia using human induced pluripotent stem cells.

Authors:  Anna M Schreiber; Julia O Misiorek; Jill S Napierala; Marek Napierala
Journal:  Expert Opin Orphan Drugs       Date:  2019-01-09       Impact factor: 0.694

Review 9.  Drosophila melanogaster Models of Metal-Related Human Diseases and Metal Toxicity.

Authors:  Pablo Calap-Quintana; Javier González-Fernández; Noelia Sebastiá-Ortega; José Vicente Llorens; María Dolores Moltó
Journal:  Int J Mol Sci       Date:  2017-07-06       Impact factor: 5.923

Review 10.  MEF2 signaling and human diseases.

Authors:  Xiao Chen; Bing Gao; Murugavel Ponnusamy; Zhijuan Lin; Jia Liu
Journal:  Oncotarget       Date:  2017-12-04
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.