Mike L J Jeurissen1, Sofie M A Walenbergh1, Tom Houben1, Tim Hendrikx1, Jieyi Li1, Yvonne Oligschlaeger1, Patrick J van Gorp1, Marion J J Gijbels1,2, Albert Bitorina1, Isabell Nessel1, Freddy Radtke3, Marc Vooijs1, Jan Theys1, Ronit Shiri-Sverdlov1. 1. Departments of Molecular Genetics, Pathology and Radiotherapy, School of Nutrition and Translational Research in Metabolism (NUTRIM), School for Cardiovascular Diseases (CARIM) and MAASTRO/School for Developmental Biology & Oncology (GROW), Maastricht University Medical Centre+, Maastricht, The Netherlands. 2. Experimental Vascular Biology, Department of Medical Biochemistry, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands. 3. Ecole Polytechnique Fédérale de Lausanne, School of Life Sciences, Swiss Experimental Cancer Research Institute, Lausanne, Switzerland.
Abstract
Non-alcoholic steatohepatitis (NASH) is characterized by liver steatosis and inflammation. Currently, the underlying mechanisms leading to hepatic inflammation are not fully understood and consequently, therapeutic options are poor. Non-alcoholic steatohepatitis (NASH) and atherosclerosis share the same etiology whereby macrophages play a key role in disease progression. Macrophage function can be modulated via activation of receptor-ligand binding of Notch signaling. Relevantly, global inhibition of Notch ligand Delta-Like Ligand-4 (DLL4) attenuates atherosclerosis by altering the macrophage-mediated inflammatory response. However, the specific contribution of macrophage DLL4 to hepatic inflammation is currently unknown. We hypothesized that myeloid DLL4 deficiency in low-density lipoprotein receptor knock-out (Ldlr-/-) mice reduces hepatic inflammation. Irradiated Ldlr-/- mice were transplanted (tp) with bone marrow from wild type (Wt) or DLL4f/fLysMCre+/0 (DLL4del) mice and fed either chow or high fat, high cholesterol (HFC) diet for 11 weeks. Additionally, gene expression was assessed in bone marrow-derived macrophages (BMDM) of DLL4f/fLysMCreWT and DLL4f/fLysMCre+/0 mice. In contrast to our hypothesis, inflammation was not decreased in HFC-fed DLL4del-transplanted mice. In line, in vitro, there was no difference in the expression of inflammatory genes between DLL4-deficient and wildtype bone marrow-derived macrophages. These results suggest that myeloid DLL4 deficiency does not contribute to hepatic inflammation in vivo. Since, macrophage-DLL4 expression in our model was not completely suppressed, it can't be totally excluded that complete DLL4 deletion in macrophages might lead to different results. Nevertheless, the contribution of non-myeloid Kupffer cells to notch signaling with regard to the pathogenesis of steatohepatitis is unknown and as such it is possible that, DLL4 on Kupffer cells promote the pathogenesis of steatohepatitis.
Non-alcoholic steatohepatitis (NASH) is characterized by liver steatosis and inflammation. Currently, the underlying mechanisms leading to hepatic inflammation are not fully understood and consequently, therapeutic options are poor. Non-alcoholic steatohepatitis (NASH) and atherosclerosis share the same etiology whereby macrophages play a key role in disease progression. Macrophage function can be modulated via activation of receptor-ligand binding of Notch signaling. Relevantly, global inhibition of Notch ligand Delta-Like Ligand-4 (DLL4) attenuates atherosclerosis by altering the macrophage-mediated inflammatory response. However, the specific contribution of macrophage DLL4 to hepatic inflammation is currently unknown. We hypothesized that myeloid DLL4 deficiency in low-density lipoprotein receptor knock-out (Ldlr-/-) mice reduces hepatic inflammation. Irradiated Ldlr-/- mice were transplanted (tp) with bone marrow from wild type (Wt) or DLL4f/fLysMCre+/0 (DLL4del) mice and fed either chow or high fat, high cholesterol (HFC) diet for 11 weeks. Additionally, gene expression was assessed in bone marrow-derived macrophages (BMDM) of DLL4f/fLysMCreWT and DLL4f/fLysMCre+/0 mice. In contrast to our hypothesis, inflammation was not decreased in HFC-fed DLL4del-transplanted mice. In line, in vitro, there was no difference in the expression of inflammatory genes between DLL4-deficient and wildtype bone marrow-derived macrophages. These results suggest that myeloid DLL4 deficiency does not contribute to hepatic inflammation in vivo. Since, macrophage-DLL4 expression in our model was not completely suppressed, it can't be totally excluded that complete DLL4 deletion in macrophages might lead to different results. Nevertheless, the contribution of non-myeloid Kupffer cells to notch signaling with regard to the pathogenesis of steatohepatitis is unknown and as such it is possible that, DLL4 on Kupffer cells promote the pathogenesis of steatohepatitis.
NASH is characterized by an increase in fat accumulation (steatosis) and inflammation in the liver. The prevalence of steatosis is estimated to be ranging from 84% to 96% whereas in this population the prevalence of NASH is ranging from 25% to 55% [1]. Although steatosis is a rather benign and reversible condition, the presence of inflammation is the key feature of NASH, which can lead to further disease progression and eventually lead to liver cirrhosis [2, 3]. The exact mechanisms leading to hepatic inflammation are unknown and more insights are needed in order to discover novel therapeutic strategies.Current research recognizes the critical role of Notch signaling in the context of immune cells [4]. Notch signaling occurs upon interaction of Notch receptors (e.g. Notch-1, -2, -3 or -4) on signal receiving cells and their membrane ligands (e.g. Jagged-1 (J1), Jagged-2 (J2), Delta-Like Ligand-1 (DLL1), Delta-Like Ligand-3 (DLL3) or Delta-Like Ligand-4 (DLL4)) on signal sending cells. Notch signaling has been implicated in the innate and adaptive immunity, which play an important role in various metabolic disorders [4-7]. An increasing amount of evidence point towards the existence of a shared inflammatory etiology between NASH and atherosclerosis with a central role for macrophages [8]. Fukuda et al. showed that global inhibition of DLL4 ameliorates atherosclerosis by altering macrophage-induced inflammatory responses, suggesting the importance of DLL4 on macrophage-mediated vascular inflammation [9, 10]. In NASH, Kupffer cells (KCs), the resident macrophages of the liver, play a central role in the initiation of hepatic inflammation and disease progression [8, 11, 12]. Relevantly, it was shown that Notch downstream targets are positively correlated with steatosis and inflammation in a cohort of non-alcoholic fatty liver disease (NAFLD) patients [13]. Furthermore, hepatic Notch activation lead to lipogenic gene expression and steatosis in chow fed mice whereas (DLL4)-Notch signaling promotes a fatty liver [9, 10, 14].So far, the exact contribution DLL4-Notch in macrophages has not been investigated in the context of NASH. We hypothesized that myeloid DLL4 deficiency in low-density lipoprotein receptor knock-out (Ldlr) mice reduces hepatic inflammation. To test this hypothesis, bone marrow of wild-type (Wt) or myeloid DLL4-deficient (DLL4del) mice was transplanted (-tp) into lethally irradiated Ldlr recipient mice and were fed chow or HFC for 11 weeks after a recovery period of 9 weeks. In contrast to our expectations, myeloid deletion of DLL4 did not reduce hepatic inflammation. These results suggest that myeloid DLL4 deficiency does not contribute to hepatic inflammation in vivo. Since, macrophage-DLL4 expression in our model was not completely suppressed, it can’t be totally excluded that complete DLL4 deletion in macrophages might lead to different results. Nevertheless, the contribution of non-myeloid Kupffer cells to notch signaling with regard to the pathogenesis of steatohepatitis is unknown and as such it is possible that, DLL4 on Kupffer cells promote the pathogenesis of steatohepatitis.
Materials and Methods
Mice, bone marrow transplantation and diet
All animals were housed under standard conditions and had access to food and water ad libitum. The animal experiments were approved by the committee for Animal Welfare of Maastricht University and were performed according to Dutch regulations. The DLL4flox/flox mice were kindly donated by Prof. Freddy Radtke [15], and crossbred with LysMCre mice [16] to generate the myeloid DLL4 specific knock-out mice. Ldlrmice were obtained from in-house breeding. To generate the myeloid DLL4 deficient Ldlrmice, bone marrow transplantation was performed. Ldlrmice received one week before and four weeks after irradiation antibiotic water containing 100 mg/l neomycin (Gibco, Breda, the Netherlands) and 6*104 U/l polymycin B Sulphate (Gibco, Breda, the Netherlands). One day before and on the day of the transplantation Ldlrmice were lethally irradiated with 6 Gray of γ-radiation, thus receiving 12 Gray in total. Lethally irradiated Ldlrmice were then injected with 1*107 bone marrow cells donated from DLL4f/fLysMCreWT (Wt) or DLL4f/fLysMCre+/0 (DLL4del) mice. In order the fully ensure bone marrow replacement mice had a nine week recovery period. After nine weeks of recovery, transplanted (-tp) mice received either a chow (Wt-tp: n = 12, DLL4del-tp: n = 12) or HFC (Wt-tp: n = 20, DLL4del-tp: n = 20) diet, containing 21% butter and 0.2% cholesterol (diet 1635; Scientific Animal Food and Engineering, Villemoissonsur-Orge, France) for 11 weeks. Blood was collected form the tail vein at the end of the experiment and mice were sacrificed afterwards. Liver tissue was harvested and snap-frozen in liquid nitrogen or fixed in 4% formaldehyde/PBS.
Bone marrow efficiency
In order to determine of the chimerism in the transplanted mice, we used donor bone marrow which has an LdlrWT origin, whereas recipient bone marrow an Ldlr origin. Genomic DNA was isolated using the PureLink® Genomic DNA (K182002; ThermoFisher Scientific). A standard curve was generated by mixing DNA from Ldlr and Ldlr bone marrow cells at different ratios. Chimerism was determined by quantifying the amount of Ldlr DNA in samples from 70 μL peripheral blood. To standardize for the amount of input DNA, the non-relevant p50 gene was quantified. Samples were assayed in duplicate on a 7900HT real-time PCR system by using 25 ng DNA, SensiMix™ Sybr & Fluorescein kit (QT615-05, Bioline), according to the manufacturer's instructions.Ldlr specific primers are forward 5′-GCTGCAACTCATCCATATGCA-3′ and reverse 5′GGAGTTGTTGACCTCGACTCTAGAG-3. Forward and reverse p50-specific primers are 5′ACCTGGGAATACTTCATGTGACTAA-3′ and 5′ACACCAGAAGTCCAGGATTATAGC-3′, respectively. A standard curve was generated by plotting the mean threshold cycle (Ct) ΔCt (Ct p50—Ct Ldlr-/-) against the logarithm of the percentage Ldlr and calculation of a regression line. Chimerism was calculated from the percentage of Ldlr DNA in the blood samples (representing the remaining recipient bone marrow), determined by applying the mean ΔCt of the sample to the standard curve. Efficiency of the bone marrow transplantation in both groups was approximately 99% (data not shown).
Plasma/Liver lipid measurements
Plasma cholesterol and triglycerides were measured via enzymatic colorimetric assay according to the manufacturer protocol (Cholesterol Liquicolor CHOD_PAD; Human #10028, Instruchemie, Delfzijl) (Sigma Triglyceride (GPO Trinder) kit (Sigma Tr0100)). Absorbance was measured with the BioRad Benchmark Plate Reader (170-6750XTU; Bio-Rad, Hercules, CA). To measure liver cholesterol and triglycerides, liver homogenates were made. About 40–50 mg of frozen liver tissue was homogenized in 1 ml SET buffer (250 mM Sucrose, 2 mM EDTA, 10 mMTris) with 1 mm glass beads (art. 11079110) on the max setting of the Biospec Mini Bead Beater-1. Afterwards, samples underwent two freeze-thaw cycles for complete cell destruction. To optimize cell destruction, samples were taken through a 25Gx5/8” needle several times and a final thaw cycle was added. Total protein content was measured via bicinchoninic acid (BCA) assay (23225; Pierce, Rockford, IL). Liver cholesterol and triglycerides were measured via enzymatic colorimetric assay (Cholesterol Liquicolor CHOD_PAD; Human #10028, Instruchemie, Delfzijl) (Triglyceride Liquicolor CHOD_PAD; Human #10724, Instruchemie, Delfzijl)
Liver histology
Livers of Wt-tp and DLL4del-tp mice were embedded in paraffin and sections of 4 μm thick were cut. H&E staining was performed according to the manufacturer’s protocol. Slides were scored for steatosis and liver cell injury (e.g. necrosis, inflammation, bile duct formation) by an experienced mouse pathologist (MJJG). For immunohistological stainings, frozen mouse liver tissue was cryo-embedded in Tissue-Tek®
(Sakura Finetek Europe B.V., Alphen aan den Rijn, The Netherlands) and sections of 7 μm thick were cut. For immunohistological stainings, cryosections of the liver were dried and fixated in dry acetone for 15 min. To block endogenous peroxidase activity, sections were incubated with 3% H2O2 solution for about 5 min. Tissue sections were also treated with Avidin/Biotin solution (Vector; SP2001) for 30 min. Afterwards, sections were incubated for 1 hour at room temperature (RT) with primary antibody for infiltrated macrophages (MAC-1; MAB1124; clone M1/70; 1:500) or Neutrophils (NIMP-1; rat anti-mouseLy6-C, supernatant; clone: NIMP-R14, 1:100). Subsequently, tissue sections were incubated with secondary antibody (Rabbit anti-Rat IgG Biotin (6180–08), SouthernBiotech, Birmingham, AL, USA) for 1 hour at RT. To amplify the signal, sections were incubated for 30 min in Peroxidase Vectastain Elite ABC solution (Vector Laboratories, PK-6100, Peterborough, United Kingdom). For detection of the secondary antibody, the Peroxidase Substrate kit AEC (Vector Laboratories, SK-4200, Peterborough, United Kingdom) was used. Slides were counterstained with heamatoxylin. Pictures were taken with a Nikon digital camera DMX1200 and ACT-1 v2.63 software (Nikon Instruments Europe, Amstelveen, The Netherlands). Immune cells were counted in 6 microscopical views (original magnification, 200x) and were noted as cells/square millimeter.
Kupffer cell isolation
Whole liver (n = 4) of each experimental group were digested individually in digestion buffer (33.9 μg/ml Liberase TM, 0.002% DNaseI) for 20 min at 37°C. The digested liver solution was further disrupted by pushing it through a 100 μm cell strainer using wash buffer (PBS, 1% FCS and 2.5 mM EDTA). Cells were then centrifuged at 1500 rpm for 10 min at 4°C. Pellet was resuspended in wash buffer, removal of hepatocytes was accomplished by one low-spin centrifugation step at 300 rpm for 3 min. Supernatant, which was lysed from red blood cells, was collected and centrifuged. Next, Kupffer cells were isolated from the supernatant by using magnetic beads coated with a macrophage-specific monoclonal antibody (F4/80-APC, 1 μl/80x106 cells) (Biolegend) and incubated for 20 min at 4°C. Afterwards, cells were washed and incubated with anti-APC microbeads (200 μl/100x106 cells) (Militenyi Biotec, Auburn, CA) for 20 min at 4°C in the dark. After washing, samples were run into LS columns, put on a Quadro MACS magnet (Militenyi Biotec, Auburn, CA) and rinsed with wash buffer. Positively selected cells were flushed using wash buffer and collected for further analysis.
RNA isolation and quantitative polymerase chain reaction
Total RNA was isolated from frozen mouse liver and Kupffer cells as described previously [17, 18]. To isolate total RNA from BMDM, FavorPrep™ Blood/Culture cell total RNA purification mini kit (FABRK001, Favorgen, Vienna, Switzerland) was used. First-strand complementary DNA (cDNA) was made from 500 ng total RNA of each mouse according to the manufacturer’s protocol (iScript
cDNA Synthesis Kit (170–8891), Bio-Rad, Veenendaal, The Netherlands). As for total RNA of isolated Kupffer cells, approximately 50 ng of total RNA was used. Relative quantitative gene expressions of inflammatory markers were measured by quantitative PCR on an SDS 7900HT by using SensiMix SYBR HIROX (Cat No QT605-05 Bioline, London, United Kingdom) and 10 ng of cDNA template. For normalization, the geometric mean of two references genes were used (Cyclophillin A and ribosomal protein S12). Primers sets were developed with Primer Express version 2.0 (Applied Biosystems) using default settings. The primer sequences can be found in Table 1. Data from qPCR were analyzed with the LinRegPCR, Analysis of RT PCR data, Version 2015.3 [19-21].
Table 1
Primer sequences.
Gene
Primer forward
Primer reverse
Cyclophillin A
TTCCTCCTTTCACAGAATTATTCCA
CCGCCAGTGCCATTATGG
S12
GGAAGGCATAGCTGCTGGAGGTGT
CCTTCGATGACATCCTTGGCCTGA
Abca1
CCCAGAGCAAAAAGCGACTC
GGTCATCATCACTTTGGTCCTTG
Abcg1
TCGGACGCTGTGCGTTTT
CCCACAAATGTCGCAACCT
Cd36
GCCAAGCTATTGCGACATGA
AAAAGAATCTCAATGTCCGAGACTTT
LXRα
CAACAGTGTAACAGGCGCT
TGCAATGGGCCAAGGC
Notch-1
AGGACCTCATCAACTCACACGC
TCTTTGTTAGCCCCGTTCTTCAG
Notch-2
CCGTGTTGACTTCTGCTCTCTCAC
CCTACTACCCTTGGCATCCTTTG
Notch-3
TCTCAGACTGGTCCGAATCCAC
ACACTTGCCTCTTGGGGGTAAC
Notch-4
ATGCGAGGAAGATACGGAGTGG
TCGGAATGTTGGAGGCAGAAC
Dll1
CTACTACGGAGAGGGCTGCT
CCAGGGTTGCACACTTTCTC
Dll4
ACAACTTGTCGGACTTCCAG
CAGCTCCTTCTTCTGGTTTG
Jagged-1
ATCGTGCTGCCTTTCAGTTT
ACTGTCAGGTTGAACGGTGTC
Jagged-2
GTCGTCATCCCCTTCCAGT
CTCCTCATTCGGGGTGGTAT
Hey1
GAAACTTGAGTTCGGCTCTAGG
GCTTAGCAGATCCTTGCTCCAT
Hes1
AGGCGGACATTCTGGAAATG
CGGTACTTCCCCAGCACACTT
Tnf-α
CATCTTCTCAAAATTCGAGTGACAA
TGGGAGTAGACAAGGTACAACCC
Itgam
ACTTTCAGAAGATGAAGGAGTTTGTCT
TGTGATCTTGGGCTAGGGTTTC
Icam
CTACCATCACCGTGTATTCGTTTC
CGGTGCTCCACCATCCA
Cell culture
Bone marrow was isolated from hind limbs of DLL4f/fLysMCreWT (Wt; n = 3) and DLL4f/fLysMCre+/0 (DLL4del; n = 3) mice. In short, the femur and tibiae were flushed with cold PBS. Bone marrow cells were cultured for 8 days in RPMI1640 cell culture medium (10% Fetal Calf Serum (FCS) (Bodinco BV, Alkmaar, The Netherlands), 1% penicillin/streptomycin, 1% L-Glutamine, 20mM HEPES) (GIBCO by Life technologies, Bleiswijk, the Netherlands) supplemented with 20% LCM (L929 cell conditioned medium which contains M-CSF) to differentiate into BMDM. All cells were cultured at 37°C in the presence of 5% CO2 atmosphere. Cells were seeded in a 24-wells plate (Greiner, 662102, Alphen a/d Rijn) (350,000 cells/well) and stimulated for 4 hours with LPS (100 ng/ml). For experiments with immobilized DLL4, cells were coated overnight with recombinant DLL4 (1 μg/ml; R&D Systems) and 0.2% gelatin in PBS at 4°C. Wells were rinsed once with PBS before plating Wt BMDM (350.000 cells/well) followed by 4 hrs incubation at 37°C. Tumor necrosis factor alpha (TNFα) protein was measured via ELISA (88-7324-88; Affymetrix, eBioscience, Vienna, Austria) according to the manufacturer’s protocol.
Western blot
BMDM of Wt and DLL4delmice were lysed in RIPA buffer (50 mM Tris-HCL pH 7.5, 150 mM NaCl, 0.5% Sodium deoxycholate, 1% Triton X-100, 0.1% SDS) supplemented with protease and phosphatase inhibitor mixture. For making liver homogenates, about 40–50 mg of frozen liver tissue was homogenized in 1 ml RIPA About 40–50 mg of frozen liver tissue was homogenized in 1 ml SET buffer (250 mM Sucrose, 2 mM EDTA, 10 mMTris) with 1 mm glass beads (art. 11079110) on the max setting of the Biospec Mini Bead Beater-1. To optimize cell destruction, samples were taken through a 25Gx5/8” needle several times and a final thaw cycle was added. Total protein content was measured via bicinchoninic acid (BCA) assay (23225; Pierce, Rockford, IL). For western blot analysis, equal amounts of protein (30 μg) were loaded on the gel. After SDS/PAGE electrophoresis, protein was transferred on nitrocellulose membrane (Biorad). The membrane was blockade with 5% non-fat dry milk for 1 hr at room temperature. Afterwards, the membrane was incubated overnight at 4°C with primary antibody against DLL4 (0.3 ug/ml, ab183532, Cambridge, United Kingdom) or β-actin (1:1000 dilution, Cell Signaling Technology, Danvers, MA, USA) which was us as a reference protein. Detection was performed according to its primary antibody using anti-goat (Santa Cruz) or anti-rabbit (Cell Signaling) horse-radish peroxidase (HRP)-conjugated secondary antibodies, followed by chemiluminescence.
Statistical analysis
Significant differences between the experimental groups were analyzed with the two-way ANOVA followed by a Tukey post-hoc test using the IBM® SPSS Statistics program (Version 22.0.0.). In vitro results were analyzed for significant differences with the two-tailed unpaired t-test using GraphPad Prism (Version 5.03). Outliers were determined via the Grubbs’ Test. Data were expressed as the mean ±SEM and considered significant at p < 0.05. *, ** and *** indicate p < 0.05, 0.01 and 0.001 resp.
Results
Myeloid DLL4 deficiency has no effect on plasma and liver lipid levels
To investigate the effect of myeloid DLL4 deficiency on the health status of Wt-tp and DLL4del-tp mice, relative weight gain and liver/body weight ratio were determined. As expected, upon HFC, both the relative weight gain and liver/body weight ratio were increased compared to chow. No differences were observed between Wt-tp and DLL4del-tp mice (Fig 1A and 1B). To determine the extent of liver damage, the liver enzyme alanine aminotransferase (ALT) was measured. Upon HFC feeding, ALT levels were increased in Wt-tp and DLL4del-tp mice compared to chow, but levels remained similar between both groups (Fig 1C). Next, we investigated the effect of myeloid DLL4 on plasma and liver lipid levels. Upon HFC feeding, cholesterol and triglyceride levels were increased in Wt-tp and DLL4del-tp mice. However, no significant differences were observed between both groups in both plasma and liver (Fig 2A–2D). To further determine the effects of myeloid DLL4 deficiency on cholesterol metabolism, gene expression of ATP-binding cassette subfamily A member 1 (Abca1), ATP-binding cassette subfamily G member 1 (Abcg1), Liver X receptor alpha (Lxrα) and Cluster of Differentiation 36 (Cd36) were analyzed in the livers of Wt-tp and DLL4del-tp mice. Gene expression of Abca1 and Cd36 were significantly upregulated in the livers of Wt-tp and DLL4del-tp mice on an HFC diet compared to chow-fed mice. Similar hepatic mRNA levels were detected between Wt-tp and DLL4del-tp mice when fed chow or HFC (Fig 2E). Altogether, these data suggest that myeloid DLL4 signaling has no effect on lipid metabolism.
Fig 1
Body and liver weights of Wt-tp and DLL4del-tp mice.
(A) Relative weight gain was calculated from the body weights of Wt-tp and DLL4del-tp mice. (B) Relative liver/total body ratio was measured from the liver and body weights of Wt-tp and DLL4del-tp mice. (C) Plasma ALT levels were measured of Wt-tp and DLL4del-tp mice. All data are represented as mean +/- SEM. Data are significant at * p< 0.05, ** p< 0.01, *** p< 0.001. Significance is compared to the chow group of the respective genotype.
Fig 2
Lipid level measurements in Wt-tp and DLL4del-tp mice.
(A-D) Cholesterol and triglyceride levels were measured in plasma and in the liver of Wt-tp and DLL4del-tp mice. (E). Gene expression of Abca1, Abcg1, Cd36 and Lxrα were measured in the liver of Wt-tp and DLL4del-tp mice. All data are represented as mean +/- SEM. Data are significant at * p< 0.05, ** p< 0.01, *** p< 0.001. Significance is compared to the chow group of the respective genotype.
Body and liver weights of Wt-tp and DLL4del-tp mice.
(A) Relative weight gain was calculated from the body weights of Wt-tp and DLL4del-tp mice. (B) Relative liver/total body ratio was measured from the liver and body weights of Wt-tp and DLL4del-tp mice. (C) Plasma ALT levels were measured of Wt-tp and DLL4del-tp mice. All data are represented as mean +/- SEM. Data are significant at * p< 0.05, ** p< 0.01, *** p< 0.001. Significance is compared to the chow group of the respective genotype.
Lipid level measurements in Wt-tp and DLL4del-tp mice.
(A-D) Cholesterol and triglyceride levels were measured in plasma and in the liver of Wt-tp and DLL4del-tp mice. (E). Gene expression of Abca1, Abcg1, Cd36 and Lxrα were measured in the liver of Wt-tp and DLL4del-tp mice. All data are represented as mean +/- SEM. Data are significant at * p< 0.05, ** p< 0.01, *** p< 0.001. Significance is compared to the chow group of the respective genotype.
Hepatic inflammation is not changed in myeloid DLL4-deficient mice
To investigate that DLL4 is knocked down specifically in myeloid cells, we first determined DLL4 expression in whole livers of Wt- and DLL4del–tp mice. We found that Dll4 expression both on mRNA and protein level in whole livers was similar between Wt-tp and DLL4del-tp mice (Fig 3A and 3C, respectively). Next, protein expression of DLL4 was assessed in Wt and DLL4del BMDM. In line with our gene expression data regarding DLL4 in Kupffer cells (Fig 3D), DLL4 protein expression was reduced in DLL4del BMDM compared to Wt BMDM (Fig 3B). Altogether, these data indicate that DLL4 deficiency is selective for myeloid cells. To determine the effect on myeloid DLL4 deficiency on Notch signaling, the expression of Notch target genes was investigated in the livers of Wt-tp and DLL4del-tp mice. Gene expression analysis of the downstream targets of DLL4, Hairy/enhance of split-1 (Hes1) and Hairy/enhancer-of-split related with YRPW motif protein 1 (Hey1), was analyzed. Upon HFC feeding, Hey1 and Hes1 expression was increased in Wt-tp and DLL4del-tp mice, indicative for increased Notch signaling activation. However, no changes in Hey1 and Hes1 were observed between both groups (Fig 3F and 3G). Additionally, Hes1 gene expression in KCs of Wt-tp and DLL4del-tp mice on chow and HFC diet was determined. No differences were observed in Hes1 gene expression between KCs of Wt and DLL4del-tp mice (Fig 3E). Next, gene expression of Notch-receptors and ligands were measured in the livers of Wt-tp and DLL4del-tp mice. Upon HFC, gene expression of Notch-1, Notch-3, and Jagged-1 was increased compared to chow-fed mice in both Wt-tp and DLL4del-tp mice, whereas Dll1 gene expression was reduced. However, no differences were observed between Wt-tp and DLL4del-tp mice in either the chow or HFC group (S1 Fig). Similar findings were observed in BMDM of Wt and DLL4delmice; upon LPS stimulation, the expression of Notch-1, Notch-2 and Dll1 was increased in both Wt and DLL4del BMDM, whereas Jagged-2 gene expression was reduced compared to non-stimulated conditions. No differences in Notch ligands and receptors were observed between Wt and DLL4del BMDM (S2 Fig). Altogether, these findings suggest that hematopoietic deletion of DLL4 is not associated with changes in the expression of other Notch receptors or ligands. Next, to investigate whether myeloid DLL4 deficiency lowers hepatic inflammation, immunohistological stainings and gene expression analysis were performed on liver tissue of Wt-tp and DLL4del-tp mice. First, we performed an H&E staining on liver sections of Wt-tp and DLL4del-tp mice. These sections were scored for steatosis and liver cell injury (e.g. necrosis, inflammation, bile duct formation) by an experienced mouse pathologist in a blinded manner. Histological analysis revealed that, upon an HFC diet, steatosis and liver cell injury was pronounced in both Wt-tp and DLL4del-tp mice. These findings were also supported by ALAT plasma levels, which is a marker for liver injury (Fig 1C). In line with our previously obtained results, no differences were observed between the two genotypes (S3 Fig). These data further support the conclusion that myeloid DLL4 deficiency does not affect liver steatosis and hepatic inflammation. Additionally, liver sections were stained for infiltrated macrophages (MAC-1 staining) and neutrophils (NIMP staining). Upon HFC feeding, infiltrated macrophages were increased in Wt-tp and DLL4del-tp mice compared to chow-fed mice. Similar effects were observed for neutrophils. However, no differences were observed between the two genotypes in the chow- and HFC-fed group for infiltrated macrophages and neutrophils (Fig 4A–4C). Moreover, gene expression levels of Tnfα, Integrin Alpha M (Itgam) and Intercellular Adhesion Molecule 1 (Icam) were similar between Wt-tp and DLL4del-tp mice (Fig 4D). To determine foam cell formation a CD68 staining was performed on livers of Wt-tp and DLL4del-tp mice. There were no differences in foam cell formation between Wt-tp and DLL4del-tp HFC fed mice (data not shown). Overall, these results suggest that myeloid DLL4 deficiency does not lower hepatic inflammation.
Fig 3
Hepatic gene and protein expression analysis of DLL4 and its downstream targets.
(A) Gene expression of Dll4 in the livers of Wt-tp and DLL4del-tp mice. (B-C) DLL4 protein expression in BMDM and livers of mice, respectively. (D-E) Gene expression analysis of Dll4 and Hes1 in isolated KCs from Wt-tp and DLL4del-tp mice. (F-G) Gene expression of Hey1 and Hes1 in the livers of Wt-tp and DLL4del-tp mice. All data are represented as mean +/- SEM. Data are significant at * p< 0.05, ** p< 0.01, *** p< 0.001. Significance is compared to the chow group of the respective genotype.
Fig 4
Hepatic inflammation in Wt-tp and DLL4del-tp mice.
(A) Representative pictures of the MAC-1 staining on the livers of Wt-tp and DLL4del-tp mice. Original magnification: 200x. (B-C) Quantification of the MAC-1 and NIMP staining for infiltrated macrophages and amount of neutrophils, respectively. (D) Gene expression of Tnfα, Itgam and Icam were measured in the livers of Wt-tp and DLL4del-tp mice. All data are represented as mean +/- SEM. Data are significant at * p< 0.05, ** p< 0.01, *** p< 0.001. Significance is compared to the chow group of the respective genotype.
Hepatic gene and protein expression analysis of DLL4 and its downstream targets.
(A) Gene expression of Dll4 in the livers of Wt-tp and DLL4del-tp mice. (B-C) DLL4 protein expression in BMDM and livers of mice, respectively. (D-E) Gene expression analysis of Dll4 and Hes1 in isolated KCs from Wt-tp and DLL4del-tp mice. (F-G) Gene expression of Hey1 and Hes1 in the livers of Wt-tp and DLL4del-tp mice. All data are represented as mean +/- SEM. Data are significant at * p< 0.05, ** p< 0.01, *** p< 0.001. Significance is compared to the chow group of the respective genotype.
Hepatic inflammation in Wt-tp and DLL4del-tp mice.
(A) Representative pictures of the MAC-1 staining on the livers of Wt-tp and DLL4del-tp mice. Original magnification: 200x. (B-C) Quantification of the MAC-1 and NIMP staining for infiltrated macrophages and amount of neutrophils, respectively. (D) Gene expression of Tnfα, Itgam and Icam were measured in the livers of Wt-tp and DLL4del-tp mice. All data are represented as mean +/- SEM. Data are significant at * p< 0.05, ** p< 0.01, *** p< 0.001. Significance is compared to the chow group of the respective genotype.
DLL4 deficiency does not affect inflammatory gene expression in bone marrow-derived macrophages
As we did not observe differences on hepatic inflammation in vivo, we next investigated whether bone marrow-derived macrophages (BMDM) of myeloid DLL4-deficientmice are less susceptible for inflammation. Bone marrow from DLL4f/fLysMCreWt (Wt) and DLL4f/fLysMCre+/0 (DLL4del) was isolated and differentiated to BMDM followed by an LPS stimulus. As expected, DLL4del BMDM showed a significant reduction of DLL4 expression when compared to Wt macrophages (Fig 5A). However, no significant differences in TNFα cytokine production, Tnfα and Itgam expression were detected when compared to Wt BMDM upon LPS stimulation (Fig 5B–5D). While the differences between the groups for Dll4 and Itgam gene expression remain similar in the condition without LPS, TNFα cytokine production was not detectable. Tnfα gene expression levels were increased significantly in Wt and DLL4del BMDM due to the LPS stimulus. These data show that DLL4del BMDM can contribute to inflammation to the same extent as compared to Wt BMDM. To investigate the relative contribution of DLL4 to LPS-induced inflammation, DLL4 was immobilized in culture plates, where it acts as an inflammatory stimulus on Wt BMDM in the absence of LPS. Upon DLL4 stimulation, gene expression of Tnfα was significantly increased. A similar trend was observed in TNFα cytokine production. However, in the absence of LPS, the levels of TNFα cytokine production are extremely low (±1.5–3.0 pg/ml) (Fig 5E). These data suggest a minor role for myeloid DLL4 in triggering inflammation.
Fig 5
Inflammatory response of bone marrow-derived macrophages from Wt and DLL4del mice.
(A) Gene expression of Dll4 was measured in BMDM of Wt and DLL4del mice. (B-C) Gene expression of Tnfα and Itgam were measured in BMDM of Wt and DLL4del mice. (D) TNFα cytokine production was measured in BMDM of Wt and DLL4del mice. (E) Wt BMDM stimulated with immobilized recombinant DLL4. All data are represented as mean +/- SEM. Data are significant at * p< 0.05, ** p< 0.01, *** p< 0.001. Significance is compared to Wt BMDM.
Inflammatory response of bone marrow-derived macrophages from Wt and DLL4del mice.
(A) Gene expression of Dll4 was measured in BMDM of Wt and DLL4delmice. (B-C) Gene expression of Tnfα and Itgam were measured in BMDM of Wt and DLL4delmice. (D) TNFα cytokine production was measured in BMDM of Wt and DLL4delmice. (E) Wt BMDM stimulated with immobilized recombinant DLL4. All data are represented as mean +/- SEM. Data are significant at * p< 0.05, ** p< 0.01, *** p< 0.001. Significance is compared to Wt BMDM.
Discussion
Notch signaling is involved in various metabolic diseases [7, 9, 13, 22] and has been described as an essential modulator for inflammation and macrophage function [7, 23–27]. While many Notch ligands have been investigated thoroughly, in the current study, we investigated for the first time the contribution of myeloid DLL4 in the context of hepatic inflammation.Macrophage activation is essential for atherosclerotic plaque development [28-31] and recent studies have implicated Notch signaling in this process [9, 23, 32]. These studies showed that DLL4 ligand-expressing macrophages are found in humanatherosclerotic lesions and that pro-inflammatory stimuli can increase DLL4 expression in macrophages [23]. Furthermore, it has been shown in vivo that plaque progression was reduced in apolipoprotein E-deficientmice after treatment with a γ-secretase, in order to inhibit Notch signaling [32]. Taken into account the prominent role of Notch signaling in atherosclerosis, and since NASH and atherosclerosis share similar disease mechanisms [8], the results obtained in the current study were unexpected. In contrast to our results, global inhibition of DLL4 using specific antibodies resulted in a reduction in plaque development and decreased fat accumulation in Ldlrmice. Next to that, they showed that F4/80 gene expression in the liver was reduced in these mice [9, 10], while our result showed no differences in hepatic inflammation. In vitro data from our group and others demonstrated the pro-inflammatory role of DLL4 on macrophages. However, data regarding the role of DLL4 on cells other than macrophages is lacking. In our experimental design, the DLL4 deletion is restricted to myeloid cells. In contrast, Fukuda et al. used a global inhibition of DLL4 (via anti-DLL4 antibodies) [9]. It is therefore possible that in vivo, the contribution of DLL4 on myeloid cells is minor and cells other than macrophages contribute to the inflammatory response, as observed by Hoebe et al. [33]. For example, when stromal cells, that express DLL4, were co-cultured with macrophages, the inflammatory response was increased, compared to stromal cells without DLL4 co-incubated with macrophages [23]. These data demonstrate the contribution of other DLL4-expressing cells to inflammation. In line, there is evidence that Notch receptors can be activated through other Notch ligands [34-37]. Furthermore, Notch-1, -2 and -3 are highly expressed on monocytes and macrophages and in vitro studies have shown that these cells can undergo cytokine specific apoptosis by interaction of DLL1 which could influence the macrophage inflammatory response [23, 25, 38]. Next to that, it can be speculated that DLL4-expressing hepatocytes may also affect myeloid DLL4-Notch signaling, as myeloid DLL4 signaling is mediated through all four Notch receptors [23, 39, 40]. Additionally, DLL4 induces Notch-1, -2, -3 cleavages [41]. As such it is likely that, macrophages in DLL4del-tp mice could still be activated via hepatic DLL4. Interestingly, Koga et al, showed that Ldlr hyperlipidemic mice showed high levels of soluble DLL4 in the plasma compared to Wt mice [42]. Fung et al, already showed that soluble DLL4 is able to activate Notch signaling in macrophages [23]. Based on these observations it can be suggested that in our model hepatocytes could still be functioning as suitable donor for DLL4 activation as they still express DLL4.In conclusion, our data suggest that the inhibition of one single Notch-ligand in the myeloid linage is not sufficient to overcome hepatic inflammation. Nevertheless, since the macrophage-Dll4 expression in our model was not completely suppressed, it can’t be totally excluded that complete DLL4 deletion in macrophages might lead to different results. Furthermore, there is a possibility that Kupffer cell isolation using magnetic beads may contain other cells such as endothelial cells, which could explain for these findings. Finally, the contribution of non-myeloid Kupffer cells to notch signaling with regard to the pathogenesis of steatohepatitis is unknown and as such it is possible that, DLL4 on Kupffer cells promote the pathogenesis of steatohepatitis. Therefore, further research should emphasize on the effects of complete DLL4 deletion in myeloid cells and the contribution of non-myeloid cells to DLL4-Notch signaling.
Gene expression of Notch receptors/ligands in the livers of Wt-tp and DLL4del-tp mice.
(TIF)Click here for additional data file.
Gene expression of Notch receptors/ligands in BMDM from Wt and DLL4del mice.
(TIF)Click here for additional data file.
Representative pictures of H&E staining on the livers of Wt-tp and DLL4del-tp mice.
Authors: Eva Monsalve; Almudena Ruiz-García; Victoriano Baladrón; María José Ruiz-Hidalgo; Beatriz Sánchez-Solana; Samuel Rivero; José J García-Ramírez; Antonio Rubio; Jorge Laborda; María José M Díaz-Guerra Journal: Eur J Immunol Date: 2009-09 Impact factor: 5.532
Authors: Erik Fung; Sai-Man Timothy Tang; James P Canner; Kunio Morishige; Joseph F Arboleda-Velasquez; Angelo A Cardoso; Nadia Carlesso; Jon C Aster; Masanori Aikawa Journal: Circulation Date: 2007-05-28 Impact factor: 29.690
Authors: Veerle Bieghs; Fons Verheyen; Patrick J van Gorp; Tim Hendrikx; Kristiaan Wouters; Dieter Lütjohann; Marion J J Gijbels; Maria Febbraio; Christoph J Binder; Marten H Hofker; Ronit Shiri-Sverdlov Journal: PLoS One Date: 2012-03-28 Impact factor: 3.240