Literature DB >> 27887624

Detection and phylogenetic analysis of porcine epidemic diarrhea virus in central China based on the ORF3 gene and the S1 gene.

Yunfang Su1, Yunchao Liu2, Yumei Chen3, Baolei Zhao4, Pengchao Ji1, Guangxu Xing3, Dawei Jiang4, Chang Liu3, Yapeng Song4, Guoqiang Wang4, Dongliang Li4, Ruiguang Deng3, Gaiping Zhang5,6,7.   

Abstract

BACKGROUND: Porcine epidemic diarrhea (PED) has increased in severity in China since 2010. To investigate further the infectivity, genetic diversity and molecular epidemiology of its causative agent, the porcine epidemic diarrhea virus (PEDV), we assessed 129 clinical samples, which were the intestinal tissue of piglets with severe diarrhea, from 17 cities in central China. Both the spike (S) glycoprotein (S1, 1-789 amino acids (aa)) and the full-length ORF3 gene of 21 representative field strains from 21 farms in 11 cities were sequenced and analysed.
METHODS: PEDV was detected by reverse transcription-polymerase chain reaction (RT-PCR), and S1 and ORF3 sequences were processed by the Clustal W method via DNAMAN 8 software, and phylogenetic trees were constructed by the neighbor-joining method using MEGA 6 software.
RESULTS: The prevalence of PEDV was 92.25% and was detected in 119 of 129 samples, with 94.03% (63 of 67) of pig farms harbouring the disease. According to the phylogenetic analysis of the S1 genes, our isolates all fell into group G2 (variants) and showed a close relationship to isolates from Chinese (HN1303, CH/ZMDZY/11 and AJ1102), Korean (AD01), American (MN, IA1, IA2 and 13-019349) sources, and these isolates differed genetically from other Chinese (LZC, CH/HNZZ/2011 and SD-M) and Korean (SM98) strains as well Japanese (83-P5 and MK) strains. In addition, our isolates differed from attenuated vaccine strains, CV777 (used in China) and DR13 (used in Korea). According to our derived amino acid sequence analysis, we detected one novel variant PEDV, viz: CH/HNLY, with 4-aa insertion/deletion (RSSS/T) at position 375 and 1-aa (D) deletion at position 430 compared to the CV777 attenuated strain. These mutations were located on the receptor binding domain. Our ORF3 gene analyses showed that the prevalent PEDV isolates were variants, and the isolated strains differed genetically from the vaccine strains.
CONCLUSIONS: These findings illustrated the existence of genetic diversity among geographically distinct PEDV strains, and our study has provided an impetus to conduct further research on the PEDV receptor binding protein and on the new and efficacious vaccines design.

Entities:  

Keywords:  ORF3 gene; PEDV; Phylogenetic analysis; S1 gene; Variants

Mesh:

Substances:

Year:  2016        PMID: 27887624      PMCID: PMC5123408          DOI: 10.1186/s12985-016-0646-8

Source DB:  PubMed          Journal:  Virol J        ISSN: 1743-422X            Impact factor:   4.099


Background

Porcine epidemic diarrhoea (PED) is an acute, highly contagious disease of swine caused by the PED virus (PEDV), which leads to severe vomiting and diarrhea along with dehydration and high mortality in new-born piglets [1]. PEDV belongs to the family Coronaviridae, genus Alphacoronavirus and was first reported in England [2]. PEDV has now been reported worldwide, including in Belgium, France, Japan, Korea, Italy, Thailand, USA, Canada and Mexico [1-5] and poses severe economic burdens. Since 2010 serious PED has been detected in China [6]. PEDV is an enveloped ssRNA coronavirus with a 28 kb genome, including seven open reading frames (ORFs), a 5′ untranslated region (UTR), and a 3′ UTR with a polyadenylated tail. The seven ORFs encode four structural proteins, spike (S), envelope (E), membrane (M) and nucleocapsid (N) and three non-structural proteins, replicases 1a, 1b and ORF3 [7, 8]. The S protein contains a specific receptor binding site that is important for cell membrane fusion and virus entry and is an antigenic target for neutralising antibodies [9]. The M protein is the most abundant surface protein, and coexpression with E protein to form pseudo-particles results in interfering genic activity [10]. The N protein is highly conserved and binds to virion RNA to provide a structural basis for the helical nucleocapsid, and it is used for early diagnosis [11]. For non-structural proteins, replicases 1a and 1b are multi-functional and associated with viral genome replication [12], and the accessory ORF3 protein is thought to influence virulence [13]. The S1 domain (amino acids (aa) 21–793) contains two subdomains: NTD (aa 21–324) and CTD (aa 253–638) [14], with the latter binding to porcine aminopeptidase N (pAPN) which is important for cell membrane fusion and virus entry and it is the antigenic target of neutralising antibodies [15]. Thus, the variable S1 gene has been widely used for studies of PEDV genetic evolution and diversity [16, 17]. PEDV CV777 has three main neutralising epitopes: aa 498–637 (CO-26 K equivalent, COE gene) [18], aa 747–754 (YSNIGVCK) and aa 763–770 (LQDGQVKI) [19]. Sequence analyses indicated that the latest PEDV isolated strains in China were different from attenuated CV777 [16, 20, 21]. Multiple mutations of the S protein resulted in two PEDV genotypes, G1 and G2 (classical strains and variant strains) [16], and a recent study suggested that antigenic variation exists between G1 and G2 [22]. The variable S1 gene has been widely used for studies of PEDV genetic evolution and diversity [16, 17]. The accessory ORF3 gene is highly relevant to the virulence of PEDV as previously stated [13], and reduction in virulence is produced through cell culture adaptation [23, 24]. The ORF3 gene of attenuated vaccine isolates has a continuous deletion of 17 amino acids (aa 82–99), thus distinguishing the vaccine isolates from variant PEDV [24]. Therefore, the ORF3 gene has been the focus of molecular epidemiology PEDV studies [16, 20, 21, 25]. As aforementioned, we chose the S1 and ORF3 genes as the target genes for phylogenetic analysis. Phylogenetic analysis of variations in the S1 gene of isolates collected in China distinguished the PEDV genotypes G1 and G2, including 1a classical PEDV, 1b classical PEDV, 2a circulating PEDV and 2b circulating PEDV subgroups [26]. Based on the ORF3 gene, the phylogenetic analysis of PEDV isolates in China manifested in genotypes G1 and G2, the G2 genotype including 2a PEDV and 2b PEDV subgroups [27]. To investigate further infectivity, genetic diversity and molecular epidemiology of PEDV, we performed phylogenetic analyses based on the S1 and ORF3 genes of the latest Chinese isolates collected. In this study, 129 samples were obtained from 67 farms in 17 cities of central China, and the S1 and ORF3 genes of 21 representative field strains from 21 farms in 11 cities were sequenced and analysed.

Methods

Sample collection and cDNA synthesis

In this study, 129 intestinal tissue samples from new-born piglets suffering from severe diarrhea were collected from 67 farms in 17 cities (Zhengzhou, Kaifeng, Anyang, Hebi, Puyang, Xinxiang, Luoyang, Nanyang, Pingdingshan, Sanmenxia, Luohe, Jiaozuo, Xuchang, Yuncheng, Zhoukou, Zhumadia, and Xinyang) of central China from July 2014 to July 2015. Samples were diluted with 5 volumes of 0.9% saline (w/v), frozen and thawed three times and then clarified by centrifugation for 5 min at 3000 rpm. Three hundred microliters of the supernatants were used for RNA extraction using TRIzol, dissolved in RNase-free water and then stored at −80 °C until further use. Synthesis of the cDNA was carried out through reverse transcription as described below. A total of 13 μl of viral RNA (approximately 1 μg) was mixed with 1 μl of 10 pmol Oligo (dT) primer (TaKaRa), incubated at 70 °C for 10 min, then placed on ice for 1 min. Next, 4 μl of 5× RT buffer, 1 μl of dNTP (2.5 mM) mixture, 0.5 μl of RNase inhibitor (40 U/μl) and 0.5 μl of reverse transcriptase M-MLV (200 U/μl) were added and gently mixed. The mixture was kept at 42 °C for 1 h and the resulting cDNA stored at −20 °C until further use.

Clinical samples detection

Primers used in this study were designed to target the conserved regions of the S gene and were synthesised by Sangon Biotech. The primers are listed in Table 1. For the PCR reactions, 1 μl of cDNA, 10 μl ExTaq DNA polymerase (TAKARA), 1 μl of each primer (10 pmol) and RNase-free water in a total volume of 20 μl. The amplification was carried out as follows: 95 °C for 5 min, followed by 33 cycles of 95 °C for 1 min, 57 °C for 1 min and 72 °C for 1 min and finally 72 °C for 10 min. The products were examined by electrophoresis using a 1.0% agarose gel.
Table 1

Primers used in this study

Primer nameNucleotide sequence, 5′-3′Size(bp)Primer locationa
PEDV-FTTTATTCTGTCACGCCAT1972,2709–22,726
PEDV-RAGATTTACAAACACCTATGTTA22,884–22,905
S1U1-FGGTAAGTTGCTAGTGCGTAA146120,570–20,589
S1U1-RCAGGATCATCACAATAAAGAA22,010–22,030
S1U2-FTTTCTGGACCATAGCATC111721,939–21,956
S1U2-RAGCACAATCAACACTAAC23,038–23,055
ORF3-FTCCTAGACTTCAACCTTACG83324,741–24,760
ORF3-RGGTGACAAGTGAAGCACAGA25,551–25,570

aIn relation to the genome of PEDV CV777 strain (AF353511)

Primers used in this study aIn relation to the genome of PEDV CV777 strain (AF353511)

Sequencing of the S1 and ORF3 genes

The S1 and ORF3 genes of 21 representative field strains from 21 farms in 11 cities (Kaifeng, Anyang, Hebi, Puyang, Xinxiang, Luoyang, Nanyang, Sanmenxia, Xuchang, Yuncheng and Zhumadian) were amplified by PCR. To obtain the complete S1 (1–789 aa) sequence, four primers (S1U1F, S1U1R, S1U2F and S1U2R) were designed and synthesised as previously described [28-30] according to Table 1, and the length of the final fragment was 2367 bp. The full-length ORF3 gene was obtained using previously published primers, and the length of the PCR product was 833 bp [31]. PCR products were purified, subcloned into pMD19-T and transformed using DH5α competent cells. The reagents were purchased from TaKaRa. Triplicate recombinant DNA positive clones from each PEDV isolate were sequenced by Sangon Biotech, China.

Multiple sequence alignments and phylogenetic analysis

The complete S1 gene (2367 bp) was obtained through the sequence matching of S1U1 and S1U2 with flanking sequences removed. Sequences of S1 and ORF3 were processed by the Clustal W method through the DNAMAN 8 software, and phylogenetic trees were constructed by the neighbor-joining method using MEGA 6 software. Bootstrap values were indicated for each node from 1000 replicates. In addition, 37 reference strains (Table 2) were chosen from Genbank for inclusion in the phylogenetic analysis.
Table 2

Reference strains used in this study

Reference strainsCountriesS gene(nt)ORF3 gene(nt)Accession no.
CV777Belgium,19782367675AF353511.1
CV777 attenuatedChina, 19982364276KT323979.1
DR13/virulentKorea,19992367675JQ023161.1
CH/ZMDZY/11China,20112376675KC196276.1
LZCChina/Gansu,<20062367675EF185992.1
SM98Korea,19982379675GU937797.1
MNUSA,20132376675KF468752.1
IA1USA,20132376675KF468753.1
IA2USA,20132376675KF468754.1
DR13/attenuatedKorea,20032364276JQ023162
SD-MChina/Shandong,20122364276JX560761
GD-AChina/Guangdong,20122376675JX112709
CH/SChina/Shanghai,19862367675JN547228
TC PC177-P2USA,20131785675KM392229
BJ-2011-1China/Beijing,20112376675JN825712
AH2012China/Anhui,20122376675KC210145
AJ1102China/Hubei,20112376675JX188454
83P-5Japan19832364AB548621
CH/JX-1/2013China/Jiangxi,20132376675KF760557
CH/JX-2/2013China/Jiangxi,20132376675KJ526096
Brl/87France, 19872367Z25483
HN1303China/Luoyang,20132376KR080551
CH/FCH-01China,2013675KF476054(O)
CH/JCHChina,2013675KF476059(O)
CH/KF-01China,2013675KF476051(O)
CH/XIP-03China,2013675KF476058(O)
13-019349USA,20132376675KF267450.1
Chinju99Korea,2009675EU792474.1(O)
CH/HLJHH-2/2011China,2012675JQ305099.1(O)
MKJapan,20132367675AB548624.1(cS)
AD01Korea,20132376KC879280.1(cS)
CH/HNZZ/2011China,20112364JN601050(S1)
CH/FJXM-1/2012China,20122376JX070671
MYG-1/JPN/2014Japan,20141794LC063838.1
TTR-2/JPN/2014Japan,2014252LC063828.1
OH851USA,20142367675KJ399978.1
SH/2015/124China,20152376675KU710245.1(S1), KU641672.1(ORF3)
Reference strains used in this study

Results

PEDV detection

PEDV were detected by PCR on 94.03% (63 of 67) pig farms in 17 cities, and 92.25% (119 of 129) of samples were positive for PEDV in clinical diseased samples.

Phylogenetic analysis of the S1 gene

According to the phylogenetic analysis of the S1 gene, 21 PEDV isolates in this study (Table 3) were all subtype G2 and were distributed in two subgroups: 2a circulating PEDV and 2b circulating PEDV (Fig. 1a). Our isolates showed a close relationship to some isolates from China (CH/ZMDZY/11, HN1303, AJ1102, et al.), Korea (AD01) and American (MN, IA1, IA2, 13–019349); however, our isolates differed from isolates collected previously from China (LZC, CH/HNZZ/2011, and SD-M), Korea (SM98), Japan (83-P5 and MK) and the vaccine strain CV777-attenuated (used in China) and DR13 (used in Korea) which showed similar to the phylogenetic trees based on the sequences of amino acid (see Additional file 1: Figure S1). According to the sequences of S1 genes processed by DNAMAN 8 software, our isolates exhibited 92.1–92.7% nucleotide identity and 89.7–91.2% amino acid identity compared with the CV777 strain. Meanwhile, our isolates exhibited 91.4–92.0% nucleotide identity and 89.1–90.7% amino acid identity compared with the CV777 attenuated strain.
Table 3

The PEDV field strains used in this study

Field strainsOriginS gene(nt)Accession no.ORF3 gene(nt)Accession no.
CH/HNHB-1Hebi, Henan2376KU977480675KU977501
CH/HNHB-2Hebi, Henan2376KU977481675KU977502
CH/HNHB-3Hebi, Henan2376KU977482675KU977503
CH/HNHB-4Hebi, Henan2376KU977483675KU977504
CH/HNHB-5Hebi, Henan2376KU977484675KU977505
CH/HNHB-6Hebi, Henan2376KU977485675KU977506
CH/HNHB-7Hebi, Henan2376KU977486675KU977507
CH/HNKF-1Kaifeng, Henan2376KU977487675KU977508
CH/HNKF-2Kaifeng, Henan2376KU977488675KU977509
CH/HNKF-3Kaifeng, Henan2376KU977489675KU977510
CH/HNSMXSanmenxia, Henan2376KU977490675KU977511
CH/SXYCYuncheng, Shanxi2376KU977491675KU977512
CH/HNXCXuchang, Henan2376KU977492675KU977513
CH/HNXXXinxiang, Henan2376KU977493675KU977514
CH/HNAYAnyang, Henan2376KU977494675KU977515
CH/HNNY-1Nanyang, Henan2376KU977495675KU977516
CH/HNNY-2Nanyang, Henan2376KU977496675KU977517
CH/HNNY-3Nanyang, Henan2376KU977497675KU977518
CH/HNZMDZhumadian, Henan2376KU977498675KU977519
CH/HNLYLuoyang, Henan2382KU977499675KU977520
CH/HNPYPuyang, Henan2376KU977500675KU977521
Fig. 1

a Phylogenetic analysis of the S1 nucleotide sequences of 21 PEDV isolates, including the reference strains. b Phylogenetic analysis of the ORF3 nucleotide sequences of 21 PEDV isolates, including the reference strains. The trees were constructed by the neighbor-joining method in MEGA 6 software. Bootstrap values were indicated for each node from 1000 replicates. The names of the strains, years and places of isolation and GenBank accession numbers proposed are shown in Tables 2 and 3. ‘●’ indicates the strains in this study

The PEDV field strains used in this study a Phylogenetic analysis of the S1 nucleotide sequences of 21 PEDV isolates, including the reference strains. b Phylogenetic analysis of the ORF3 nucleotide sequences of 21 PEDV isolates, including the reference strains. The trees were constructed by the neighbor-joining method in MEGA 6 software. Bootstrap values were indicated for each node from 1000 replicates. The names of the strains, years and places of isolation and GenBank accession numbers proposed are shown in Tables 2 and 3. ‘●’ indicates the strains in this study According to the predicted amino acid sequence of S1 genes in this study, we found one novel PEDV variant, CH/HNLY, that had 4-aa substitution at position 375, RSSS375T and a single deletion at position 430 (Fig. 2). Correspondingly, at the nucleotide level, CH/HNLY had 9-nt (GGTCGTCGT) insertion between positions 1123 (A) and 1124 (T) and 3-nt (GAT) deletion between positions 1283 (C) and 1287 (G).
Fig. 2

CV777/attenuated as the reference strain and the amino acid sequence of CH/HNLY, with 4-aa insertion/deletion (RSSS/T) at position 375 and 1-aa (D) deletion at position 430 (CV777 attenuated strain accession number: KT323979.1) are indicated

CV777/attenuated as the reference strain and the amino acid sequence of CH/HNLY, with 4-aa insertion/deletion (RSSS/T) at position 375 and 1-aa (D) deletion at position 430 (CV777 attenuated strain accession number: KT323979.1) are indicated We also examined the three major epitope regions, viz : aa 498–637, aa 747–754 and aa 763–770. The sequences at aa 747–754 were conserved between the latest Chinese PEDV isolates and CV777 attenuated strain, however the sequences at positions 498–637 and 763–770 were variable (Table 4).
Table 4

Analysis of amino acid mutations in epitopes domains of field strains and the CV777 attenuated vaccine strain (aa 498–637, aa 747–754 and aa 763–770 located in CV777 attenuated)

Strains499500514516520522526530543548561572583587590593604607608611632634636751762763765766768
CV777 attenuatedTLSAHGITRTSKKSLGESGFQVDGPLDGV
CV777LSVALEISY
CH/ZMDZY/11SRTSNSESS
CH/HNHB-1DSSSESS
CH/HNHB-2, CH/HNHB-5ASSSDSESS
CH/HNHB-3PSSSESSD
CH/HNHB-4ASSNSESS
CH/HNHB-6, CH/HNHB-7ASSSDESS
CH/HNKF-1, CH/HNLYSSSESS
CH/HNKF-2SSYSESS
CH/HNKF-3SSYPSESS
CH/HNSMXSTSEGSS
CH/SXYCSASSESS
CH/HNXCSSSVSS
CH/HNXXSSSVESS
CH/HNAYASYSSELSS
CH/HNNY-1, CH/HNNY-2, CH/HNNY-3,SYSSESS
CH/HNZMDSSHSVESSA
CH/HNPYASYSSELSS
Analysis of amino acid mutations in epitopes domains of field strains and the CV777 attenuated vaccine strain (aa 498–637, aa 747–754 and aa 763–770 located in CV777 attenuated)

Phylogenetic analysis of the ORF3 gene

According to the analysis of the ORF3 genes, 21 PEDV isolates in this study (Table 3) were all subtype G2 and were distributed in subgroup G2b which showed similar to the phylogenetic trees based on the sequences of amino acid (see Additional file 2: Figure S2); in addition, our strains showed a close relationship to published isolates and genetically differed from the vaccine strains which were all subtype G1 (Fig. 1b), indicating that the prevailing PEDV strains were mostly variants. According to the sequences of ORF3 genes processed by DNAMAN 8 software, our isolates exhibited 95.9–96.9% nucleotide identity and 93.8–96.4% amino acid identity compared with the CV777 strain. Meanwhile, our isolates exhibited 91.3–93.1% nucleotide identity and 84.6–89% amino acid identity compared with the CV777 attenuated strain.

Discussion

Previous studies found that 79.66% of pig farms in 29 provinces to be positive for the presence of PEDV, with 72.27% of samples confirmed as PEDV-positive [16]. In the present study, 94.03% (63 of 67) of pig farms in 17 cities, 92.25% (119 of 129) samples, were PEDV-positive, indicating a high prevalence of PEDV in clinical diseased samples. The S gene might correlate with PEDV pathogenicity [4]. The S1 domain of the S protein is the major target for PEDV vaccine development [32]. Our previous report suggested that the amino acid changes in the S1 domain might be associated with a change in antigenicity [20]. Extensive variation of the S protein has been reported earlier [17, 33]. In this study, we found that in the three major epitope regions, the amino acid sequence at aa 748–755 was conserved, whereas aa 499–638 and aa 764–771 were variable. Accordingly, within the S1 domain of the S protein, the series of single amino acid substitutions found were: S516A, S548T, S593G, E632Q, S763L and S765D. These changes were found in the strain CH/ZMDZY/11 that was previously isolated in central China [34]. However, as shown in Table 4, there were other single aa mutations, suggesting that the gene encoding the antigenic domain of S1 may constantly vary. According to the phylogenetic analysis, our isolates were all subtype G2 (Fig. 1a) and mostly further divided into two subgroups, 2a circulating PEDV and 2b circulating PEDV. We have shown that the S1 domain of isolates differed genetically from the classical PEDV, but the isolates were similar to previously reported isolates from eastern, north western and southern China [35-37], which might be the reason why the currently existing vaccine is inefficient. In this study, we detected one novel PEDV variant, CH/HNLY, with mutations at positions 375 and 430 (RSSS375T and deletion at aa 430D), which are located on the receptor binding domain (aa 253–638) for pAPN [15, 38]. The phylogenetic analysis of nucleotide variation demonstrated that CH/HNLY was related to 2b circulating PEDV. It was reported that the classical PEDV exhibited weaker sugar-binding activity compared with the field isolate variant [39]. Reports have also found amino acid substitutions in the receptor-binding region [27]. Whether or not these changes affect the biological functions of PEDV will require further investigation. The ORF3 gene is highly relevant to the virulence of PEDV [23, 40], since it regulates virus production [13]. The ORF3 genes of the PEDV isolates in this study and other isolates did not show the large deletion characteristic of the vaccine CV777 strain. According to the phylogenetic analysis of ORF3, the 21 PEDV isolates in this study were divided into subtype G2 (Fig. 1b). The ORF3 gene analysis not only suggested that the isolates in central China were not only vaccine-unrelated, but the presence of multiple, distinct mutations indicated there is widespread diversity in this virulence gene. However, further studies are needed to clarify whether the virulence is change among these PEDV strains. Phylogenetic analysis of both the S1 and ORF3 genes showed that our isolates exhibited high similarity to variant reference strains and differed from CV777. Phylogenetic analysis of ORF3 did not reveal differences between our isolates and partial classical PEDV strains which was similar to other report [27]. Further studies are required to clarify the biological functions among PEDV phylogenetic groups.

Conclusions

In conclusion, our study highlighted the present landscape of PEDV in central China, and the isolated strains in this study were all variable and genetically diverse. These findings make it clear that a new vaccine is required to control this disease. In addition, the discovery of a novel strain, CH/HNLY, provides an avenue for future investigations into the biological functions of PEDV.
  39 in total

1.  Epidemic of diarrhoea caused by porcine epidemic diarrhoea virus in Italy.

Authors:  P Martelli; A Lavazza; A D Nigrelli; G Merialdi; L G Alborali; M B Pensaert
Journal:  Vet Rec       Date:  2008-03-08       Impact factor: 2.695

2.  Viral disease affects U.S. pigs: porcine epidemic diarrhea found in at least 11 states.

Authors:  Greg Cima
Journal:  J Am Vet Med Assoc       Date:  2013-07-01       Impact factor: 1.936

3.  Differential detection of transmissible gastroenteritis virus and porcine epidemic diarrhea virus by duplex RT-PCR.

Authors:  S Y Kim; D S Song; B K Park
Journal:  J Vet Diagn Invest       Date:  2001-11       Impact factor: 1.279

4.  Multiplex reverse transcription-PCR for rapid differential detection of porcine epidemic diarrhea virus, transmissible gastroenteritis virus, and porcine group A rotavirus.

Authors:  Dae S Song; Bo K Kang; Jin S Oh; Gun W Ha; Jeong S Yang; Hyoung J Moon; Yong-Suk Jang; Bong K Park
Journal:  J Vet Diagn Invest       Date:  2006-05       Impact factor: 1.279

Review 5.  Receptor recognition mechanisms of coronaviruses: a decade of structural studies.

Authors:  Fang Li
Journal:  J Virol       Date:  2014-11-26       Impact factor: 5.103

6.  Coronavirus pseudoparticles formed with recombinant M and E proteins induce alpha interferon synthesis by leukocytes.

Authors:  P Baudoux; C Carrat; L Besnardeau; B Charley; H Laude
Journal:  J Virol       Date:  1998-11       Impact factor: 5.103

7.  Chinese-like strain of porcine epidemic diarrhea virus, Thailand.

Authors:  Suphasawatt Puranaveja; Pariwat Poolperm; Preeda Lertwatcharasarakul; Sawang Kesdaengsakonwut; Alongkot Boonsoongnern; Kitcha Urairong; Pravina Kitikoon; Porjit Choojai; Roongtham Kedkovid; Komkrich Teankum; Roongroje Thanawongnuwech
Journal:  Emerg Infect Dis       Date:  2009-07       Impact factor: 6.883

8.  Phylogenetic analysis of porcine epidemic diarrhea virus (PEDV) field strains in central China based on the ORF3 gene and the main neutralization epitopes.

Authors:  Renfeng Li; Songlin Qiao; Yanyan Yang; Yunfang Su; Pu Zhao; Enmin Zhou; Gaiping Zhang
Journal:  Arch Virol       Date:  2013-11-30       Impact factor: 2.574

9.  Cell culture isolation and sequence analysis of genetically diverse US porcine epidemic diarrhea virus strains including a novel strain with a large deletion in the spike gene.

Authors:  Tomoichiro Oka; Linda J Saif; Douglas Marthaler; Malak A Esseili; Tea Meulia; Chun-Ming Lin; Anastasia N Vlasova; Kwonil Jung; Yan Zhang; Qiuhong Wang
Journal:  Vet Microbiol       Date:  2014-08-27       Impact factor: 3.293

10.  Molecular characterization and phylogenetic analysis of porcine epidemic diarrhea virus (PEDV) samples from field cases in Fujian, China.

Authors:  Xi Chen; Jinxian Yang; Fusong Yu; Junqing Ge; Tianlong Lin; Tieying Song
Journal:  Virus Genes       Date:  2012-07-29       Impact factor: 2.332

View more
  10 in total

1.  The Seasonal and Stage-Specific Expression Patterns of HMGB2 Suggest Its Key Role in Spermatogenesis in the Chinese Soft-Shelled Turtle (Pelodiscus sinensis).

Authors:  Wei Li; Junxian Zhu; Luo Lei; Chen Chen; Xiaoli Liu; Yakun Wang; Xiaoyou Hong; Lingyun Yu; Hongyan Xu; Xinping Zhu
Journal:  Biochem Genet       Date:  2022-05-12       Impact factor: 1.890

2.  Epidemic and genetic characterization of porcine epidemic diarrhea virus strains circulating in the regions around Hunan, China, during 2017-2018.

Authors:  Lei Tan; Yalan Li; Jiayi He; Yi Hu; Xiong Cai; Wei Liu; Tanbing Liu; Jiaoshun Wang; Zhoumian Li; Xiaoming Yuan; Yang Zhan; Lingchen Yang; Zhibang Deng; Naidong Wang; Yi Yang; Aibing Wang
Journal:  Arch Virol       Date:  2020-02-13       Impact factor: 2.574

3.  Molecular Characterization of Porcine Epidemic Diarrhea Virus and Its New Genetic Classification Based on the Nucleocapsid Gene.

Authors:  Sung-Jae Kim; Van-Giap Nguyen; Thi-My-Le Huynh; Yong-Ho Park; Bong-Kyun Park; Hee-Chun Chung
Journal:  Viruses       Date:  2020-07-23       Impact factor: 5.048

4.  Isolation and recombinant analysis of variants of porcine epidemic diarrhea virus strains from Beijing, China.

Authors:  Peng Wang; Jinyan Zhu; Xinze Liu; Jiaojiao Guo; Xuejia Gu; Wenke Ruan
Journal:  Virusdisease       Date:  2019-02-09

5.  Genome-wide analysis of differentially expressed genes and the modulation of PEDV infection in Vero E6 cells.

Authors:  Hewei Zhang; Qinfang Liu; Weiwei Su; Jianke Wang; Yaru Sun; Junfeng Zhang; Ke Shang; Zhenhai Chen; Shipeng Cheng; Hua Wu
Journal:  Microb Pathog       Date:  2018-02-03       Impact factor: 3.738

6.  Changes in the spike and nucleocapsid protein of porcine epidemic diarrhea virus strain in Vietnam-a molecular potential for the vaccine development?

Authors:  Thach Xuan Tran; Nguyen T K Lien; Ha T Thu; Nguyen Dinh Duy; Bui T T Duong; Dong Van Quyen
Journal:  PeerJ       Date:  2021-10-18       Impact factor: 2.984

Review 7.  Prevention and Control of Porcine Epidemic Diarrhea: The Development of Recombination-Resistant Live Attenuated Vaccines.

Authors:  Xiaoyu Niu; Qiuhong Wang
Journal:  Viruses       Date:  2022-06-16       Impact factor: 5.818

8.  Visual detection and differentiation of porcine epidemic diarrhea virus wild-type strains and attenuated vaccine strains using CRISPR/Cas13a-based lateral flow strip.

Authors:  Dongdong Yin; Lei Yin; Hao Guo; Jieru Wang; Xuehuai Shen; Ruihong Zhao; Xiaocheng Pan; Yin Dai
Journal:  Front Cell Infect Microbiol       Date:  2022-09-13       Impact factor: 6.073

9.  Single Chain Fragment Variable (scFv) Antibodies Targeting the Spike Protein of Porcine Epidemic Diarrhea Virus Provide Protection against Viral Infection in Piglets.

Authors:  Fanqing Zhang; Yuxue Chen; Yong Ke; Lei Zhang; Bo Zhang; Liang Yang; Jianguo Zhu
Journal:  Viruses       Date:  2019-01-14       Impact factor: 5.048

10.  Porcine epidemic diarrhea virus ORF3 protein causes endoplasmic reticulum stress to facilitate autophagy.

Authors:  Dehua Zou; Jiaxin Xu; Xulai Duan; Xin Xu; Pengfei Li; Lixin Cheng; Liang Zheng; Xingzhi Li; Yating Zhang; Xianhe Wang; Xuening Wu; Yujiang Shen; Xiangyu Yao; Jiaqi Wei; Lili Yao; Liyang Li; Baifen Song; Jinzhu Ma; Xinyang Liu; Zhijun Wu; Hua Zhang; Hongwei Cao
Journal:  Vet Microbiol       Date:  2019-07-08       Impact factor: 3.293

  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.