| Literature DB >> 27872880 |
Christelle Bahlawane1, Martine Schmitz1, Elisabeth Letellier1, Karthik Arumugam2, Nathalie Nicot3, Petr V Nazarov3, Serge Haan1.
Abstract
The present data are related to the article entitled "Insights into ligand stimulation effects on gastro-intestinal stromal tumors signaling" (C. Bahlawane, M. Schmitz, E. Letellier, K. Arumugam, N. Nicot, P.V. Nazarov, S. Haan, 2016) [1]. Constitutive and ligand-derived signaling pathways mediated by KIT and PDGFRA mutated proteins found in gastrointestinal stromal tumors (GIST) were compared. Expression of mutant proteins was induced by doxycycline in an isogenic background (Hek293 cells). Kit was identified by FACS at the cell surface and found to be quickly degraded or internalized upon SCF stimulation for both Kit Wild type and Kit mutant counterparts. Investigation of the main activated pathways in GIST unraveled a new feature specific for oncogenic KIT mutants, namely their ability to be further activated by Kit ligand, the stem cell factor (scf). We were also able to identify the MAPK pathway as the most prominent target for a common inhibition of PDGFRA and KIT oncogenic signaling. Western blotting and micro-array analysis were applied to analyze the capacities of the mutant to induce an effective STATs response. Among all Kit mutants, only Kit Ex11 deletion mutant was able to elicit an effective STATs response whereas all PDGFRA were able to do so.Entities:
Keywords: Gastro-intestinal stromal tumours; MAPK; PD0325901; PDGFRα; PI3K; Stem cell factor; c-KIT
Year: 2016 PMID: 27872880 PMCID: PMC5107687 DOI: 10.1016/j.dib.2016.10.026
Source DB: PubMed Journal: Data Brief ISSN: 2352-3409
Fig. 1KIT RNA and protein expression levels in the stable transfected cells. (a) KIT mRNA expression level as assessed by qPCR in Hek293 cells expressing KIT WT, KIT Ex11, KIT Ex9 and KIT V559D 14 h after induction with doxycycline (5 ng/ml). SCF was added at 100 ng/ml for the time of induction. Data represent the means of 3–6 biological replicates and are normalized using Genorm following the MIQE guidelines [2]. (b) Western blot analysis indicating KIT expression level as well as phosphorylation status in Hek293 cells expressing KIT WT, KIT Ex11, KIT Ex9 and KIT V559D 14 h after induction with doxycycline (5 ng/ml). SCF was added at 100 ng/ml for the time of induction or 5 min before cell harvesting as indicated on the figure. Representative data of 3 biological replicates. STAT5 is used as loading control.
Fig. 2Effect of ligand stimulation on KIT expression at the cell surface.
Mean Fluorescence Intensity (MFI) of Kit staining in the different Kit mutants.
| MFI | Kit WT | Kit V559D | Kit Ex9 | Kit ex11 | ||||
|---|---|---|---|---|---|---|---|---|
| −SCF | +SCF | −SCF | +SCF | −SCF | +SCF | −SCF | +SCF | |
| Surface | 2099 | 111 | 172 | 11 | 1435 | 284 | 562 | 222 |
| Overall expression | 2122 | 642 | 374 | 319 | 2106 | 1355 | 1008 | 852 |
Fig. 3Effect of ligand stimulation on downstream signaling in GIST mutants. (a) Western blot analysis indicating the phosphorylation status of KIT/PDGFRα, STAT5, Akt and Erk in Hek293 cells expressing PDGFRα WT, PDGFRα V561D, KIT WT, KIT Ex11, KIT Ex9 and KIT V559D after PDGFAA or SCF addition. Representative blots of 3 biological replicates. Tubulin is used as loading control. (b) Quantification of the signal intensities from the western blots shown in a. Data were calibrated using the sample “KIT WT non-stimulated” (background level), except for PDGFRA phosphorylation where PDGFRa WT non-stimulated was used. Each dot represents the mean of biological triplicates and the error bars the standard error of the mean. From left to right, bars represent the signal intensities after ligand addition (1st bars correspond to no ligand, 15 and 60 min after ligand addition are marked for better visibility).
Fig. 4Activation of STAT species by GIST mutants. (a) Nuclear translocation of STAT species. Nuclear extracts were prepared as previously done [4], diluted in 4 times Laemmli buffer and subjected to Western blot analysis. Phosphorylation status of STAT5, STAT3 and STAT1 is shown for nuclear extract prepared from Hek293 cells expressing KIT WT, KIT Ex11, KIT Ex9 and KIT V559D. (b) Induction of known STAT target genes by GIST mutants. Gene expression level of known STAT target genes, previously identified to be induced in PDGFRA GIST mutants [3], was retrieved from micro-array data and presented as heat map. Grey boxes indicate that the genes are not part of the DEG list for the corresponding mutant (FDR>0.05 or AbsFC<0.5). The intensity of the red color corresponds to the value of the ratio to the background (Hek293 KIT WT non-stimulated for KIT WT and mutants and Hek293 PDGFRα non-stimulated for PDGFRα mutants). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article) .
KIT Ex11 deletion mutant specific DEG, with FDR<0.05 and absolute logFC>0.5.
| ACER2 | CCNYL1 | EYA1 | IRX4 | LOC401321 | NKX3-1 | RN5S217 | SNORA10 | UTRN |
| ADAMTS20 | CD109 | FAHD1 | ITGA2 | LOC642838 | NLRP1 | RN5S335 | SNORA16B | VRK3 |
| ADCK3 | CD3EAP | FAM46A | JAM2 | LOC645166 | NOA1 | RND2 | SNORA2A | WDR63 |
| ADCY1 | CD68 | FAM47A | JMY | LPAL2 | NR1D2 | RNF167 | SNORD111 | WDR77 |
| AKAP8 | CDC25B | FAM59A | KCNA3 | LPCAT2 | NRN1 | RNFT1 | SNORD126 | WWP2 |
| ALDH1L2 | CDT1 | FAM64A | KDELR1 | LPHN3 | OLIG2 | RNU2-7P | SNORD3C | ZC3H6 |
| ALG12 | CES3 | FAM83B | KDELR3 | LPPR4 | PABPC1L | RNU7-6P | SNORD60 | ZFP14 |
| AMIGO2 | CHEK2 | FBXO32 | KIAA0355 | LRFN1 | PAMR1 | RPL13P5 | SNORD71 | ZNF140 |
| ANKRD18DP | CITED1 | FLJ44342 | KIAA1430 | LURAP1L | PAQR4 | RYR2 | SNORD91A | ZNF17 |
| ANKRD20A12P | CKMT1A | FLJ45248 | KIAA1609 | LYSMD2 | PARK2 | SAMD15 | SRCRB4D | ZNF239 |
| ANKRD20A5P | CNN2 | FRAT2 | KLF11 | MALAT1 | PARM1 | SCARA5 | TAS2R31 | ZNF280B |
| ANKRD27 | CNTNAP3B | GALNT6 | KLHL24 | MCL1 | PARP14 | SCARNA21 | TBX15 | ZNF296 |
| ARHGAP20 | CPEB4 | GGA2 | KLHL36 | MCM5 | PARP4 | SEMA6A | TCF25 | ZNF347 |
| ARHGAP35 | CPPED1 | GLTSCR2 | KLRAP1 | MDM2 | PBX1 | SERPINB1 | TFAP4 | ZNF485 |
| ARHGEF1 | CRKL | GRAMD4 | LCMT1 | MED12L | PCDH7 | SGK1 | THOC6 | ZNF502 |
| ARNT2 | CRYBB2P1 | GSPT2 | LIG4 | MGARP | PDP1 | SGSM3 | TIGD4 | ZNF574 |
| ASRGL1 | CSDA | GYPC | LIN37 | MGST1 | PDPR | SHKBP1 | TMEM143 | ZNF581 |
| BACE1-AS | CYP2S1 | GYS1 | LINC00282 | MIR22HG | PHKB | SHMT2 | TMEM159 | ZNF70 |
| BBIP1 | CYP4×1 | H2BFXP | LNP1 | MIR3143 | PKIA | SLC35B2 | TMEM185B | ZNF738 |
| BCL6 | DDTL | HIST1H2BG | LOC100130776 | MIR338 | PLA2G7 | SLC44A2 | TMEM238 | ZNF836 |
| BEX5 | DEDD2 | HIST1H3A | LOC100132439 | MIR3671 | PLXNA2 | SLC45A3 | TNFRSF10D | ZSCAN12P1 |
| BRD2-IT1 | DLC1 | HIST1H3H | LOC100133985 | MIR4263 | PMFBP1 | SLC6A6 | TNFRSF13C | |
| BZW1 | DMRTA1 | HLA-DRB5 | LOC100272228 | MIR4324 | PPP1R13L | SLC7A6OS | TNRC6B | |
| C10orf10 | DYNLL2 | HSDL1 | LOC100287628 | MIR4530 | PPP1R14C | SLC8A1 | TOM1 | |
| C10orf25 | EBF3 | IER5 | LOC100288018 | MIR4773-2 | PROX1 | SLC9A1 | TP53I13 | |
| C19orf54 | ECH1 | IFITM3 | LOC100288520 | MIR548A2 | PRPH | SLC9A2 | TRBV23OR9-2 | |
| C22orf13 | EID3 | IGHD2-21 | LOC100507299 | MRI1 | PRR12 | SLC9A9 | TRBV6-9 | |
| C2orf77 | EIF1 | IL11 | LOC147670 | MTRF1L | PSEN2 | SMOC1 | TRPC1 | |
| CABIN1 | ELAC1 | ILDR2 | LOC147727 | MTSS1 | RAB39B | SMPD1 | TRPS1 | |
| CABLES1 | EMR2 | IMPA2 | LOC284648 | NFIX | RBL2 | SNAR-D | TSC2 | |
| CAMLG | EPHX4 | INPP5D | LOC399815 | NIPSNAP1 | RHBDF1 | SNAR-H | TSSK3 | |
| CAP2 | EPS15L1 | IQCH | LOC400927 | NIPSNAP3A | RN5S180 | SNN | TXNDC17 |
Fig. 5Synergistic assessment for PD0325901 and XL184 inhibitors in GIST882.
Fig. 6Imatinib effect on MAPK gene expression level over time.
primers used for qPCR analysis.
| Targeted gene | Primers sequences |
| GAPDH | gtccttccacgataccaaagt |
| atgagaagtatgacaacagcct | |
| HPRT | tggacaggactgaacgtctt |
| gagcacacagagggctacaa | |
| PPIA/cycloA | cagacaaggtcccaaagaca |
| ccattatggcgtgtgaagtc | |
| Tubulin | agatcggtgccaagttctg |
| ccacctgtggcttcattgta | |
| ETV4 | gcccctcgactctgaagat |
| tggaaatcaggaacaaactgc | |
| ETV5 | atccccgattatactttgacg |
| agaagggtgaccaggaactg | |
| Kit | acaaagagcaaatccatccc |
| tgtaggtcagaatcatcacaataat | |
| egr1 | agtggtttggctggggtaa |
| ctacgagcacctgaccgc | |
| sprty2 | ttgcacatcgcagaaagaag |
| ggtcactccagcaggcttag | |
| sprty4 | gggagccactgagaacagag |
| tggctcctaaatccatcctg |
| Subject area | Cancer Research |
| More specific subject area | Signal transduction AND Receptor Tyrosine Kinases |
| Type of data | Western blot; qPCR, FACS, micro-array, Computational modeling |
| How data was acquired | Fusion-FX7 chemiluminescence detection device (Vilber) for Western blotting, |
| CLARIOstar microplate reader (BMG LABTECH) for fluorescence measurements of cell viability | |
| GeneChip Human Gene ST 2.0 arrays (Affymetrix) for micro-array | |
| FACS CantoII Instrument (Becton Dickinson, Heidelberg, Germany) for flow cytometry | |
| Model building and refinement with CHARMM | |
| Experimental features | KIT and PDGFRA mutants were expressed in hek293 cell lines upon doxycycline addition |
| Experiments were performed with/without ligand induction | |
| Data source location | LIH, Luxembourg and university of Luxembourg, Luxembourg |
| Data accessibility | Data are available in the article, and at ArrayExpress E-MTAB-4548 |