Literature DB >> 27869600

Reemergence of St. Louis Encephalitis Virus, California, 2015.

Gregory S White, Kelly Symmes, Pu Sun, Ying Fang, Sandra Garcia, Cody Steiner, Kirk Smith, William K Reisen, Lark L Coffey.   

Abstract

St. Louis encephalitis virus infection was detected in summer 2015 in southern California after an 11-year absence, concomitant with an Arizona outbreak. Sequence comparisons showed close identity of California and Arizona isolates with 2005 Argentine isolates, suggesting introduction from South America and underscoring the value of continued arbovirus surveillance.

Entities:  

Keywords:  California; St. Louis encephalitis virus; arbovirus; arbovirus sequencing; arbovirus surveillance; bird; emerging; flavivirus; global viral spread; human pathogen; mosquito; mosquito pool testing; mosquitoborne virus; sentinel bird; vector-borne infections; viral phylogenetics; viruses

Mesh:

Year:  2016        PMID: 27869600      PMCID: PMC5189155          DOI: 10.3201/eid2212.160805

Source DB:  PubMed          Journal:  Emerg Infect Dis        ISSN: 1080-6040            Impact factor:   6.883


St. Louis encephalitis virus (SLEV; family Flaviviridae, genus Flavivirus) was recognized in California in 1937 and caused periodic epidemics in humans and equines until 1989, including a 1984 outbreak in Los Angeles (–). Even though US epidemics have not occurred since 1989, SLEV activity was documented continually in California until 2003, the year West Nile virus (WNV) activity was detected in the state. During 2003–2015, no SLEV activity was detected in California despite ongoing SLEV surveillance and a 6-fold statewide increase in mosquito pool testing in response to the invasion of WNV. The absence of SLEV activity suggested its elimination from California (,). In Arizona, SLEV has been detected less frequently than in California, with low enzootic activity reported most years during 1972–2006 (Arizona State Public Health Laboratory, unpub. data) and a single human case during 2010–2014 (). In Maricopa County, which includes Phoenix, a human SLEV outbreak during July–October 2015 resulted in 23 confirmed cases and 1 death (Arizona State Public Health Laboratory, unpub. data). Beginning in July 2015, SLEV activity was detected in mosquito pools, and sentinel chicken seroconversions were detected in the Coachella Valley in Riverside County, California. Given the reemergence of SLEV in California and Arizona in summer 2015, the purpose of this study was to describe the temporal and spatial detection of SLEV in California, compare its circulation intensity with that of WNV in California in 2015, and define the genetic relatedness of SLEV from both states to SLEV from elsewhere to infer a possible origin and pattern of spread.

The Study

Mosquito and arbovirus surveillance was conducted in the Coachella Valley in 2015 (Figure 1, panel A). SLEV RNA was first detected in a pool of Culex tarsalis mosquitoes by quantitative reverse transcription PCR on July 28, 2015, and subsequently in 37 more pools of the same species through October 6 (). The number of SLEV-positive pools peaked at 23 during the first 2 weeks of August. WNV was detected in mosquitoes during April–November 2015, with a peak in the week of June 21. Although SLEV was detected only in Cx. tarsalis pools, WNV RNA was detected in 83 Cx. quinquefasciatus pools during April 24–November 5 and in 16 Cx. tarsalis pools during May 19–September 29. During the period of co-detection of both viruses (July–November), peak minimum infection rates were higher for WNV than for SLEV.
Figure 1

St. Louis encephalitis virus (SLEV) and West Nile virus (WNV) surveillance in mosquitoes and sentinel chickens in Coachella Valley, Riverside County, California, USA, 2015. A) Vector abundance (upper panel) from the same locations in all of Riverside County at bimonthly intervals during 2010–2014 (gray line) and in 2015 (black line), and infection rates for WNV (middle) and SLEV (lower) based on maximum likelihood estimates (black lines) with 95% CI (gray shading) in female Culex tarsalis and Cx. quinquefasciatus mosquitoes collected in CO2 and gravid traps and number of sentinel chicken seroconversions. B) Geographic locations of SLEV (black) and WNV (gray) activity identified by viral RNA detection in mosquito pools (circles) or sentinel chicken seroconversions (squares), July–October 2015.

St. Louis encephalitis virus (SLEV) and West Nile virus (WNV) surveillance in mosquitoes and sentinel chickens in Coachella Valley, Riverside County, California, USA, 2015. A) Vector abundance (upper panel) from the same locations in all of Riverside County at bimonthly intervals during 2010–2014 (gray line) and in 2015 (black line), and infection rates for WNV (middle) and SLEV (lower) based on maximum likelihood estimates (black lines) with 95% CI (gray shading) in female Culex tarsalis and Cx. quinquefasciatus mosquitoes collected in CO2 and gravid traps and number of sentinel chicken seroconversions. B) Geographic locations of SLEV (black) and WNV (gray) activity identified by viral RNA detection in mosquito pools (circles) or sentinel chicken seroconversions (squares), July–October 2015. Vector abundance did not parallel peak infection rates (June for WNV and August for SLEV). Instead, vector abundance in 2015 was lower at most times than the 5-year average, calculated as the geometric mean of female Cx. tarsalis and Cx. quinquefasciatus mosquitoes collected bimonthly in traps at the same locations during 2010–2014 (). The trend of decreasing mosquito abundance in midsummer in southern California (especially in the Coachella Valley), concurrent with increasing arbovirus activity, has been well documented (). This trend most likely relates to changes in age structure, with progressively more parous female mosquitoes tested as overall vector population numbers decline. Sentinel chicken seroconversion to SLEV, detected by enzyme immunoassay and confirmed by plaque-reduction neutralization test, was detected during August 28–November 9, with a total of 9 seroconversions in 104 chickens (8.7% seropositive) (,). WNV seropositive chicken serum samples were also reported starting on August 28, but with fewer (n = 6 [5.7%] of serum specimens tested) seroconversions to WNV than to SLEV. Although most mosquito pools contained detectable RNA for only WNV or SLEV, 4 pools tested positive for both viruses. Both viruses were circulating in the summer of 2015 at the north and west shores of the Salton Sea in the Coachella Valley (Figure 1, panel B). SLEV activity was more focal than WNV activity and was limited to Cx. tarsalis mosquitoes collected in a 20-km radius near wetlands and agricultural habitats by the Salton Sea, whereas WNV activity spanned >80 km and was concentrated in Cx. quinquefasciatus mosquitoes collected in more densely populated residential habitats in the central part of the Coachella Valley. Co-circulation of both viruses in ecologically diverse habitats near the Salton Sea at the same time shows that early-season WNV activity did not preclude later SLEV circulation. Unlike California, where continual SLEV testing has been conducted since 1969, the absence of SLEV activity in mosquitoes in Arizona during 2010–2014 may have been due to a lack of recent SLEV testing. Maricopa County began testing mosquito pools for SLEV RNA during the 2015 human epidemic and then retrospectively detected SLEV in an archived WNV-positive mosquito pool from November 2014. We sequenced complete genomes of 1 SLEV isolate from California in 2015 and two isolates from Arizona in 2015, and partial genomes of the 2014 isolate from Arizona and 1 additional 2015 California isolate from reverse transcription PCR amplicons using SLEV primers (Table; GenBank accession nos. KX258460–62 [California], KX965720 [Arizona]). We further determined the phylogenetic relationships of the sequenced isolates with each other and with complete SLEV genomes from GenBank, including another 2015 Arizona isolate (strain 121B, GenBank accession no. KT823415) sequenced by the Centers for Disease Control and Prevention (Figure 2). The 2014 and 2015 California and Arizona SLEV isolates share >99% nucleotide identity with each other and also with their closest published relative, isolated from Cx. quinquefasciatus mosquitoes collected in Cordoba, Argentina, in 2005. The 2015 SLEV isolates are genetically distinct from the 2003 Imperial Valley California strain that was isolated before the 11-year absence of SLEV activity in the state. These results suggest that there was likely a single introduction of SLEV into the United States from South America (possibly Argentina) no later than November 2014, the earliest dated sample from which SLEV was isolated in Arizona, and that the virus spread in the summer of 2015 from Arizona to California. Notably, 1,710 mosquito pools representing 65,287 individual mosquitoes from the Coachella Valley were negative for SLEV during 2014.
Table

Primers used to sequence complete genomes of SLEV in study of reemergence of the virus in Arizona and California, USA, 2015*

NameSequence, 5′ → 3′Location of primer binding site at 5′ nucleotide on SLEV 2005 isolate CbAr4005†
2300FGGATTACACAGGGACTACTTGG2339
2300RTCTGTATGCTCTCCCACATTAAG2672
2700FCCTGAAGAAGCTGGAAGATGAG2786
2700RCGCTTTCAATAACGCCATCAC3175
5700FGGTGATTCAGCTAAACAGGAAGA5753
5700RGTGATTGCCATGGGTCCATTA5936
800FCAATCCTGGATATGCCCTAGTT852
800RACGGTCCACAACATCTCTTT1241
9000FCCAAAGTTCTGGGAAATGGTTG8981
9000RCATAGGAATTCTCACGGCTCAT9189
F1GAGCGGAGAGGAAACAGATTT17
F10CGGAGCTGTGACTCTTGATTT4976
F11AGGCCGTATTGGGAGAAATC5981
F12CACGACGCAGTATGTGAACT7099
F13GGAGTGGACGTGTTCCATAA8069
F15GAGTGAACACCATGCCAAATC9099
F16TGGTAGGAGGAGTGCTGTAA10393
F2GGAGAAGTCATGGCTGGTAAA1584
F3CCCTGGAGTGAAGGAGAAATAAC3276
F4GGGTTCCCAACTACCAAGTTTA5431
F7GGTTGAGTGGCTAAGGAAGAA9635
F8CATTCTTGGCGGGTTTGTTC3796
F9GCAATAGCTGGGCTGATGTA4315
R1CGCTGGTCGCTAGAAAGATTAG2488
R10CGGAGCTGTGACTCTTGATTT5418
R12CAGATAGCCCTGCTTCCTTTAG9099
R2AGCACACAAGATGGGAAGAG3985
R3GAAGCTGGTGATCCACTCATAC5651
R4ACGATTCCGTCTTTCCTGTATG7761
R5GCCCACTCCTGTTCTGTTTATC8417
R6CATCCTGCTCCTGGTGAAAT9924
R7CCTGTCTTTCCAGGTGTCAATA3185
R8GGGATTGACCGTAACCAATCT2023

*SLEV, St. Louis encephalitis virus.
†GenBank accession no. FJ753286.2.

Figure 2

St. Louis encephalitis virus phylogeny with 2015 California (USA CA) and 2014 and 2015 Arizona (USA AZ) genomes (black circles). Complete nucleotide genomes (except for isolate 2282, which included only the E gene) were compared by using a neighbor-joining algorithm and 1,000 bootstrap replicates (support numbers at nodes) by using MEGA 7 (). Isolates are named according to location, year of isolation, strain name for 2014 and 2015 isolates, and GenBank accession number. Scale bar indicates nucleotide substitutions per site.

*SLEV, St. Louis encephalitis virus.
†GenBank accession no. FJ753286.2. St. Louis encephalitis virus phylogeny with 2015 California (USA CA) and 2014 and 2015 Arizona (USA AZ) genomes (black circles). Complete nucleotide genomes (except for isolate 2282, which included only the E gene) were compared by using a neighbor-joining algorithm and 1,000 bootstrap replicates (support numbers at nodes) by using MEGA 7 (). Isolates are named according to location, year of isolation, strain name for 2014 and 2015 isolates, and GenBank accession number. Scale bar indicates nucleotide substitutions per site. Because human SLEV viremia levels are low and insufficient to infect mosquitoes, the virus may have been introduced into the United States from South or Central America by a viremic migratory bird or possibly by an infected mosquito exploiting human transportation (). Earlier US SLEV strains from Tennessee and Texas isolated in 1974 and 2001, respectively, are most closely related to 1969 and 1978 Guatemalan strains (Figure 2). A similar ancestral topology of Brazil and Peru strains from the 1970s to the 2003 California isolate also suggests movement from South to North America. The Salton Sea and associated habitats possess diverse avifauna and may serve as a resting point for SLEV-infected migratory birds that traverse the Pacific flyway (). Alternately, SLEV may have come from elsewhere in the United States after being introduced from South or Central America, but sequences from US states reporting SLEV activity in recent years are not publicly available. In the case of east-to-west movement across the United States, postnesting birds may have mediated spread by way of agricultural areas of northern Mexico. However, it is unknown whether SLEV is active in Mexico or the Imperial Valley, which lies between Phoenix and the Coachella Valley, because surveillance is not performed in those regions. Our findings highlight how mosquitoborne viruses are emerging and reemerging to establish autochthonous transmission, including SLEV in southern California that produced severe and fatal human disease in 2015 in Arizona (). Prospective surveillance can identify viruses circulating in mosquitoes even in the absence of human cases of infection, as in Coachella Valley in 2015, and may provide an early warning of future outbreaks.
  10 in total

1.  Persistent West Nile virus transmission and the apparent displacement St. Louis encephalitis virus in southeastern California, 2003-2006.

Authors:  William K Reisen; Hugh D Lothrop; Sarah S Wheeler; Marc Kennsington; Arturo Gutierrez; Ying Fang; Sandra Garcia; Branka Lothrop
Journal:  J Med Entomol       Date:  2008-05       Impact factor: 2.278

2.  Viruses of Equine and of St. Louis Encephalitis in Relationship to Human Infections in California, 1937-1938.

Authors:  B F Howitt
Journal:  Am J Public Health Nations Health       Date:  1939-10

3.  MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets.

Authors:  Sudhir Kumar; Glen Stecher; Koichiro Tamura
Journal:  Mol Biol Evol       Date:  2016-03-22       Impact factor: 16.240

4.  Previous infection with West Nile or St. Louis encephalitis viruses provides cross protection during reinfection in house finches.

Authors:  Ying Fang; William K Reisen
Journal:  Am J Trop Med Hyg       Date:  2006-09       Impact factor: 2.345

5.  High throughput quantitative colorimetric microneutralization assay for the confirmation and differentiation of West Nile Virus and St. Louis encephalitis virus.

Authors:  Michael Taketa-Graham; Jaime L Powell Pereira; Elizabeth Baylis; Cynthia Cossen; Leopoldo Oceguera; Peter Patiris; Robert Chiles; Carl V Hanson; Bagher Forghani; BagHer Forghani
Journal:  Am J Trop Med Hyg       Date:  2010-03       Impact factor: 2.345

6.  Migratory birds and the dispersal of arboviruses in California.

Authors:  William K Reisen; Sarah S Wheeler; Sandra Garcia; Ying Fang
Journal:  Am J Trop Med Hyg       Date:  2010-10       Impact factor: 2.345

7.  Ecological observations on the 1989 outbreak of St. Louis encephalitis virus in the southern San Joaquin Valley of California.

Authors:  W K Reisen; R P Meyer; M M Milby; S B Presser; R W Emmons; J L Hardy; W C Reeves
Journal:  J Med Entomol       Date:  1992-05       Impact factor: 2.278

8.  Concurrent Outbreaks of St. Louis Encephalitis Virus and West Nile Virus Disease - Arizona, 2015.

Authors:  Heather Venkat; Elisabeth Krow-Lucal; Morgan Hennessey; Jefferson Jones; Laura Adams; Marc Fischer; Tammy Sylvester; Craig Levy; Kirk Smith; Lydia Plante; Kenneth Komatsu; J Erin Staples; Susan Hills
Journal:  MMWR Morb Mortal Wkly Rep       Date:  2015-12-11       Impact factor: 17.586

9.  Multiplex qRT-PCR for the Detection of Western Equine Encephalomyelitis, St. Louis Encephalitis, and West Nile Viral RNA in Mosquito Pools (Diptera: Culicidae).

Authors:  Aaron C Brault; Ying Fang; William K Reisen
Journal:  J Med Entomol       Date:  2015-03-18       Impact factor: 2.278

10.  Serologic diagnosis of West Nile and St. Louis encephalitis virus infections in domestic chickens.

Authors:  Peter J Patiris; Leopoldo F Oceguera; George W Peck; Robert E Chiles; William K Reisen; Carl V Hanson
Journal:  Am J Trop Med Hyg       Date:  2008-03       Impact factor: 2.345

  10 in total
  17 in total

1.  Evaluation of Argentinean Bird Species as Amplifying Hosts for St. Louis Encephalitis Virus (Flavivirus, Flaviviridae).

Authors:  Adrián Díaz; Fernando S Flores; Agustín I Quaglia; Marta S Contigiani
Journal:  Am J Trop Med Hyg       Date:  2018-05-10       Impact factor: 2.345

2.  St. Louis Encephalitis Virus Disease in the United States, 2003-2017.

Authors:  Emily J Curren; Nicole P Lindsey; Marc Fischer; Susan L Hills
Journal:  Am J Trop Med Hyg       Date:  2018-10       Impact factor: 2.345

3.  Diagnosis of Fatal Human Case of St. Louis Encephalitis Virus Infection by Metagenomic Sequencing, California, 2016.

Authors:  Charles Y Chiu; Lark L Coffey; Jamie Murkey; Kelly Symmes; Hannah A Sample; Michael R Wilson; Samia N Naccache; Shaun Arevalo; Sneha Somasekar; Scot Federman; Doug Stryke; Paul Vespa; Gary Schiller; Sharon Messenger; Romney Humphries; Steve Miller; Jeffrey D Klausner
Journal:  Emerg Infect Dis       Date:  2017-10       Impact factor: 6.883

Review 4.  Emerging arboviruses: Why today?

Authors:  Ernest Gould; John Pettersson; Stephen Higgs; Remi Charrel; Xavier de Lamballerie
Journal:  One Health       Date:  2017-07-01

5.  West Nile and St. Louis encephalitis viral genetic determinants of avian host competence.

Authors:  Payal D Maharaj; Angela M Bosco-Lauth; Stanley A Langevin; Michael Anishchenko; Richard A Bowen; William K Reisen; Aaron C Brault
Journal:  PLoS Negl Trop Dis       Date:  2018-02-15

6.  Movement of St. Louis encephalitis virus in the Western United States, 2014- 2018.

Authors:  Daniele M Swetnam; Jackson B Stuart; Katherine Young; Payal D Maharaj; Ying Fang; Sandra Garcia; Christopher M Barker; Kirk Smith; Marvin S Godsey; Harry M Savage; Vonnita Barton; Bethany G Bolling; Nisha Duggal; Aaron C Brault; Lark L Coffey
Journal:  PLoS Negl Trop Dis       Date:  2020-06-10

7.  St. Louis Encephalitis Virus in the Southwestern United States: A Phylogeographic Case for a Multi-Variant Introduction Event.

Authors:  Chase L Ridenour; Jill Cocking; Samuel Poidmore; Daryn Erickson; Breezy Brock; Michael Valentine; Chandler C Roe; Steven J Young; Jennifer A Henke; Kim Y Hung; Jeremy Wittie; Elene Stefanakos; Chris Sumner; Martha Ruedas; Vivek Raman; Nicole Seaton; William Bendik; Heidie M Hornstra O'Neill; Krystal Sheridan; Heather Centner; Darrin Lemmer; Viacheslav Fofanov; Kirk Smith; James Will; John Townsend; Jeffrey T Foster; Paul S Keim; David M Engelthaler; Crystal M Hepp
Journal:  Front Genet       Date:  2021-06-08       Impact factor: 4.772

8.  Neuronal Degeneration in Mice Induced by an Epidemic Strain of Saint Louis Encephalitis Virus Isolated in Argentina.

Authors:  María E Rivarola; Soledad de Olmos; Guillermo Albrieu-Llinás; Laura B Tauro; Melisa Gorosito-Serrán; Brenda S Konigheim; Marta S Contigiani; Adriana Gruppi
Journal:  Front Microbiol       Date:  2018-06-07       Impact factor: 5.640

9.  Reemergence of St. Louis Encephalitis Virus in the Americas.

Authors:  Adrián Diaz; Lark L Coffey; Nathan Burkett-Cadena; Jonathan F Day
Journal:  Emerg Infect Dis       Date:  2018-12       Impact factor: 6.883

10.  Scented Sugar Baits Enhance Detection of St. Louis Encephalitis and West Nile Viruses in Mosquitoes in Suburban California.

Authors:  Cody D Steiner; Kasen K Riemersma; Jackson B Stuart; Anil Singapuri; Hugh D Lothrop; Lark L Coffey
Journal:  J Med Entomol       Date:  2018-08-29       Impact factor: 2.278

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.