Literature DB >> 27824938

Genome-Wide Identification and Analysis of MicroRNAs Involved in Witches'-Broom Phytoplasma Response in Ziziphus jujuba.

Fenjuan Shao1, Qian Zhang1, Hongwei Liu1, Shanfa Lu2, Deyou Qiu1.   

Abstract

MicroRNAs (miRNAs) play an important role in responding to biotic and abiotic stresses in plants. Jujube witches'-broom a phytoplasma disease of Ziziphus jujuba is prevalent in China and is a serious problem to the industry. However, the molecular mechanism of the disease is poorly understood. In this study, genome-wide identification and analysis of microRNAs in response to witches'-broom was performed. A total of 85 conserved miRNA unique sequences belonging to 32 miRNA families and 24 novel miRNA unique sequences, including their complementary miRNA* strands were identified from small RNA libraries derived from a uninfected and witches'-broom infected Z. jujuba plant. Differentially expressed miRNAs associated with Jujube witches'-broom disease were investigated between the two libraries, and 12 up-regulated miRNAs and 10 down- regulated miRNAs identified with more than 2 fold changes. Additionally, 40 target genes of 85 conserved miRNAs and 49 target genes of 24 novel miRNAs were predicted and their putative functions assigned. Using the modified 5'-RACE method, we confirmed that SPL and MYB were cleaved by miR156 and miR159, respectively. Our results provide insight into the molecular mechanisms of witches'-broom disease in Z. jujuba.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27824938      PMCID: PMC5100886          DOI: 10.1371/journal.pone.0166099

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Zizyphus jujuba (common name Chinese Jujube) is an economically important fruit tree species in China, belonging to the family Rhamnaceae [1]. It is widely used in traditional Chinese medicine for at least 3,000 years, because its fruit contains high vitamin C content, abundant phenolic compounds, carbohydrate, minerals, cyclic AMP and other important nutrients [1-3]. Jujube witches’-broom (JWB) disease is prevalent in China and causes serious problems to the industry [4]. It is caused by phytoplasmas which are bacteria without cell walls that were first discovered in the phloem of plants in 1967 by Yoji Doi and co-workers [5]. Phytoplasmas are transmitted by phloem-sucking leafhoppers and Chinese Jujube plants infected with phytoplasmas display a variety of symptoms, such as small leaves, yellowing, witches’-broom, phyllody, stunting, sterile flowers and finally death after a few years of infection [6, 7]. Phytoplasmas are very destructive agricultural pathogens, and have devastating effects on over 1000 plant species worldwide [8, 9]. A previous study of Mexican lime trees infected with phytoplasma identified several candidate genes and proteins that might be involved in the interaction of Mexican lime trees with the phytoplasma [10, 11]. Although some progress has been made in understanding the regulation that is involved in plant-phytoplasma interactions [12], the molecular mechanisms involved in the JWB disease and the symptoms are poorly understood [13]. In recent years, many studies have shown that small RNAs (sRNAs) have numerous roles in the development of plants, defense against viruses and transposons, chromatin modifications, responses to biotic and abiotic stresses etc. In plants, microRNAs (miRNAs) and small interfering RNAs (siRNAs) are two major classes of small RNAs [14]. miRNAs are produced from the primary miRNA transcripts with internal stem-loop structures, whereas siRNAs are derived from dsRNAs transcripts. To regulate gene expression, the generated sRNA are loaded into RNA-induced silencing complexes (RISCs) to guide and interact with homologous RNA or DNA molecules for direct RNA cleavage, translational repression or DNA methylation [15]. High-throughput sequencing provides a comprehensive means of identifying and studying the expression of small RNAs. miRNAs play an important role in disease resistance in plants [16-20], for example, a total of 87 differentially regulated miRNAs have been identified to be responsive to fungal stress in wheat [20]. However, to our best knowledge, there is no report on miRNAs associated with JWB in Z. jujuba. Understanding the molecular mechanisms of witches’-broom disease associated with miRNAs is potentially important for developing efficient methods to control the disease. With the aim of identifying miRNAs involved in JWB disease, we constructed two small RNAs libraries from the sprig leaves of uninfected wild type (ZZN) Z. jujuba plants and plants with JWB disease (ZZD). miRNAs and their targets were identified from both small RNA libraries and differentially expressed miRNAs associated with JWB disease were determined. Our results provide insight into the molecular mechanisms of JWB disease in Z. jujuba.

Materials and Methods

Plant materials

The Z. jujuba wild type (ZZN) and the infected plant (ZZD) with witches’-broom disease used in this experiment were grown in Beijing Olympic Park (116°40′7.43"E, 39°99′9.45"N). Sprig of Z. jujuba leaves were collected from 10-year-old plants with the permission granted by the administrative department of Olympic Park. For each sample, materials from three plants were pooled and stored in liquid nitrogen until use.

Small RNA library construction

Total RNAs were extracted from the wild type (ZZN) and the infected plant (ZZD) using Trizol RNA extraction kit (Life Technology, Beijing) according to the manufacturer’s instruction. Two small RNA samples were sequenced by Novogene (China) using Illumina HiSeq2500 system, and the raw reads generated by Illumina sequencing were submitted to the SRA database, Accession No. SRP090598.

Bioinformatics analysis of sequencing data

After removing the adapters and low-quantity sequences from the raw reads, the 18–30 nt clean reads were compared with Rfam database and the NCBI nucleotide database to removed the rRNA, tRNA, snRNA and snoRNA for further analyses. The remaining sequences in the ZZN and ZZD libraries at least ten reads were searched against miRBase 21.0 with a maximum of three mismatches allowed [21] to identify conserved miRNAs in Z. jujuba, and then the resulting sequences were screened for the presence of the characteristic hairpin structures using the program RNAfold [22]. The software Mireap (https://sourceforge.net/projects/mireap/) was used to predict novel miRNAs, which could be mapped to the Z. jujuba genome. The resulting secondary structures were then manually checked. Criteria described by Meyers et al were applied to annotate the novel miRNAs [23]. The reads of small RNAs were normalized to one million by the total number of small RNAs in each library for comparing the differential expression levels of the miRNAs in the ZZN and ZZD libraries.

Target gene prediction for miRNAs

Target genes prediction of the known and novel miRNAs was performed against assembled Z. jujuba unigenes using psRNATarget [24]. The maximum expectations of 3 and the target accessibility-allowed maximum energy to unpair the target site of 50 were applied. The functions of targets were annotated by blast analysis against the Nr protein database [25] using default parameters.

Quantitative RT-PCR

MicroRNAs expression levels were quantified using Poly (A) Tailing method, following the previously reported procedures [26]. In brief, the 1μg DNaseI treated total RNA was polyadenylated by Poly (A) polymerase at 37°C for 1 h in a 20-μL reaction mixture following the manufacturer’s directions for the Poly (A) Tailing Kit (Ambion). The all RNAs were reverse-transcribed with 200 U SuperScript™ III Reverse Transcriptase (Invitrogen) using poly (T) adapters. Zj5.8S rRNA was used as a control as previously described [27]. Gene-specific primers were listed in S1 Table.

Validation of target cleavage sites by 5’-RLM-RACE

The 5’-RLM-RACE experiments were carried out using the modified RNA ligase-mediated rapid amplification of 5’ cDNAs method as described [28,29], PCRs were carried out on mRNA isolated from Z. jujuba infected with witches’-broom disease using the GeneRacer 5’ primer and the nesting gene-specific primers (S2 Table). Nested PCRs were performed using the GeneRacer 5’ nested primer and the nested gene-specific primers (S2 Table).

Results

Overview of the small RNA sequences

Two small RNA libraries were constructed from the sprig leaves of Z. jujuba wild type (ZZN) and the infected plant (ZZD) with witches’-broom disease (Fig 1). Using the Illumina sequencing technology, a total of 14,171,805 and 11,483,382 raw reads were generated for ZZN and ZZD, respectively. After removing contaminant reads and filtering out the adapter sequences, 13,729,929 and 11,150,259 clean reads with lengths of 18 to 30nt were obtained for ZZN and ZZD, respectively (Table 1). In both libraries, most of total sRNA reads were 18- 24nt in size (Fig 2). The most abundant small RNAs in the both libraries were 21 nt sRNA, which were approximately 18.91% (ZZN) and 17.01% (ZZD) of the total sequence reads in ZZN and ZZD libraries, respectively. Whereas, the abundance of 24-nt sRNAs in ZZD library (9.34%) were higher than in ZZN library (7.78%). The 24-nt sRNAs were mainly comprised of siRNAs, suggesting it may play an important role in the regulation of the response to the phytoplasma infection in plants.
Fig 1

The Ziziphus jujuba wild type (ZZN) and the infected plant (ZZD) with witches broom disease in the field.

A. ZZN; B. ZZD.

Table 1

Statistics of small RNA sequences from ZZN and ZZD libraries.

Librarytotal readslow qualityclean readsUnique reads
ZZD114833829219111502591795277
ZZN141718059737137299291249861
Fig 2

The size distribution of the small RNAs in ZZN and ZZD libraries.

The Ziziphus jujuba wild type (ZZN) and the infected plant (ZZD) with witches broom disease in the field.

A. ZZN; B. ZZD.

Identification of conserved miRNAs in Z. jujuba

To identify the conserved miRNAs in Z. jujuba, the unique sequences with at least 10 reads in the both sRNA libraries were mapped to the Z. jujuba genome [30] with no more than 2 mismatches. All the mapped sRNA was aligned with known mature plant miRNAs in miRBase 21.0 by UEA small RNA tools [31] and a maximum of three mismatches were allowed. As a result, we identified 85 unique sequences, belonging to 32 families in the both sRNA libraries generated by Illumina sequencing (Table 2).
Table 2

The conserved miRNAs of Z. jujuba.

miRNA familymemberssequencesreads
ZZNZZD
miR1515miR1515UCAUUUUUGCGUGCAAUGAUCC165
miR156miR156aUUGACAGAAGAGAGUGAGCAC32472
miR156bUGACAGAAGAGAGUGAGCACU25225
miR156cUUGACAGAAGAUAGAGAGCAC18295
miR156dUGACAGAAGAGAGUGAGCAC221170
miR156eUUGACAGAAGAUAGAGAGCA416
miR156fUUGACAGAAGAGAGAGAGCAC3040
miR156hUGACAGAAGAGAGUGAGCACA328
miR159miR159aUUGGAUUGAAGGGAGCUCCA111
miR159bUUUGGAUUGAAGGGAGCUCU6883026691
miR159cUUUGGAUUGAAGGGAGCUCUA7228740499
miR159dUUGGAUUGAAGGGAGCUCUA1545724
miR159eCUUGGAUUGAAGGGAGCUCC3152255
miR160miR160aUGCCUGGCUCCCUGUAUGCCA85102
miR160bUGCCUGGCUCCCUGAAUGCC3718
miR160cUGCCUGGCUCCCUGUAUGCC6361
miR160dUGCCUGGCUCCCUGAAUGCCA7853
miR162miR162aUCGAUAAACCUCUGCAUCCAG62333051
miR162bUCGAUAAACCUCUGCAUCCA269
miR164miR164aUGGAGAAGCAGGGCACGUGC4415
miR164bUGGAGAAGCAGGGCACGUGCA135138
miR166miR166aUCGGACCAGGCUUCAUUCCCCC998307
miR166bGGAAUGUUGUCUGGCUCGAGG3022
miR166cUCGGACCAGGCUUCAUUCCCC5434223732
miR166dUCGGACCAGGCUUCAUUCCC340254
miR166eUCGGACCAGGCUUCAUUCCU274195
miR166fUCGGACCAGGCUUCAUUCCUC345271
miR166gUCUCGGACCAGGCUUCAUUCC5836
miR167miR167aUGAAGCUGCCAGCAUGAUCU425171
miR167bUGAAGCUGCCAGCAUGAUCUUA911348
miR167cUGAAGCUGCCAGCAUGAUCUG151656839
miR167dUGAAGCUGCCAGCAUGAUCUGG518291
miR167eUGAAGCUGCCAGCAUGAUCUAA2212
miR167fUGAAGCUGCCAGCAUGAUCUA2577993
miR167gUGAAGCUGCCAGCAUGAUCUU2768800
miR167hUGAAGCUGCCAGCAUGAUCUGA134547103
miR168miR168aUCGCUUGGUGCAGGUCGGGAA1090582
miR168bCCCGCCUUGCAUCAACUGAAU7836
miR168cUCGCUUGGUGCAGGUCGGGA8644
miR170miR170UAUUGGCCUGGUUCACUCAGA141420
miR171miR171aUUGAGCCGCGCCAAUAUCACU1135
miR171bUGAUUGAGCCGUGCCAAUAUC4692
miR172miR172AGAAUCUUGAUGAUGCUGCAU2595
miR2111miR2111UAAUCUGCAUCCUGAGGUUUA211
miR2950miR2950UUCCAUCUCUUGCACACUGGA18911
miR319miR319aUUGGACUGAAGGGAGCUCCCU46346
miR319bCUUGGACUGAAGGGAGCUCCC3747
miR319cUUUGGACUGAAGGGAGCUCCU2918
miR319dAUUGGACUGAAGGGAGCUCC5556
miR319eUUGGACUGAAGGGAGCUCCC392645
miR319fCUUGGACUGAAGGGAGCUCCU8358
miR319gUUGGACUGAAGGGAGCUCCU438479
miR384miR384UUGGCAUUCUGUCCACCUCC5282
miR390miR390CGCUAUCCAUCCUGAGUUUCA712
miR391miR391aUACGCAGGAGAGAUGACGCCG1095289
miR391bUACGCAGGAGAGAUGACGCC5629
miR394miR394UUGGCAUUCUGUCCACCUCC5282
miR395miR395aUGAAGUGUUUGGGGGAACUCC629
miR395bCUGAAGUGUUUGGGGGGACUC2275
miR396miR396aCUCAAGAAAGCUGUGGGAGA6347
miR396bUUCAAUAAAGCUGUGGGAAG6132
miR396cCACAGCUUUCUUGAACUUUCU3720
miR396dUUCCACAGCUUUCUUGAACUG145596996
miR396eUUCCACAGCUUUCUUGAACUU3975431938
miR396fUUCCACAGCUUUCUUGAACU26921631
miR396gGUUCAAUAAAGCUGUGGGAAG3633
miR396hUCCACAGCUUUCUUGAACUU1926
miR397miR397UCAUUGAGUGCAGCGUUGAUG5323
miR398miR398aUGUGUUCUCAGGUCGCCCCU31967
miR398bUGUGUUCUCAGGUCGCCCCUG114054867
miR398cUGUGUUCUCAGGUCACCCCUU607148
miR399miR399UGCCAAAGGAGAGUUGCCCUG332
miR403miR403UUAGAUUCACGCACAAACUCG204164
miR408miR408aUGCACUGCCUCUUCCCUGGCU1791671
miR408bAUGCACUGCCUCUUCCCUGGC872241
miR408cUGCACUGCCUCUUCCCUGGC814257
miR477miR477ACUCUCCCUCAAGGGCUUCU784
miR482miR482aUGCCUAUUCCUCCCAUGCCAA2929
miR482bGGAAUGGGCUGUUUGGGAUG1114
miR529miR529aAGAAGAGAGAGAGUACAGCUU15263435
miR529bAGAAGAGAGAGAGUACAGCU70128
miR530miR530UCUGCAUUUGCACCUGCACCU2317
miR6478miR6478CCGACCUUAGCUCAGUUGGU837289
miR858miR858aUUCGUUGUCUGUUCGACCUUG516124
miR858bUUCGUUGUCUGUUCGACCUGA8512
Among the 32 identified miRNA families, a total of 18 miRNA families contained several members, and seven families including miR156, miR159, miR160, miR166, miR167, miR319 and miR396, had at least four members; 13 miRNA families, namely miR170, miR172, miR384, miR390, miR397, miR399, miR403, miR477, miR530, miR1515, miR2111, and miR2950 and miR6478, had only one member. Of these families, miR159 was the most abundant, with 142988 (ZZN) and 70170 (ZZD) reads accounting for 44.3% and 40.8% of all conserved miRNAs in both libraries, respectively (Fig 3). The second most abundant miRNA family is miR396, with 57221 (ZZN) and 40723 (ZZD) reads accounting for 17.7% and 23.7% of all conserved miRNAs in both libraries. The third most abundant miRNA family was miR166 and miR167. The other conserved miRNA families showed less abundance and each had less than 0.2% of all conserved miRNA reads. This result is significantly different with other plants, suggesting differential expression of miRNAs in Z. jujuba and indicating there is significant diversity of miRNA expression in different plant species.
Fig 3

Number of reads for the conserved miRNA families.

Identification of novel miRNAs in Z. jujuba

We used criteria described by Meyers et al [23] to identify novel miRNAs. As a result, we identified 24 novel miRNA sequences with a characteristic stem-loop precursor (Table 3). These novel miRNAs were given names designated as ‘zju-miRn plus number’. Among these novel miRNAs, 14 miRNA had miRNA* sequences, the other 10 had no miRNA* sequences. The length of the predicted novel miRNA precursors varied from 60 to 364 nt, and the average minimum free energy (MFE) value varied from -22 to -111.8 kcal/mol. Most of the novel miRNAs were 21 nt long and had uracil (U) as their first nucleotide. The structures of 24 novel miRNA precursors are shown in S1 Fig. Most of them showed differential expression in both libraries. For instance, the mature miRNA reads varied from 0 to 12561, and the miRNA* reads varied from 0 to 8024. The reads for most of these novel miRNA*s were less than their corresponding mature miRNAs except zju-miRn15* in both libraries. To investigate whether these 24 novel miRNA sequences were conserved across plant species, we used them as query sequences to search against the plant mature miRNAs in miRBase 21.0 by Blastn [32]. The results showed that no perfect matches were found, suggesting that these novel miRNA sequences were not broadly conserved in plants.
Table 3

The novel miRNAs identified in Z. jujuba.

NameSequence(5'-3')LocationLength ofMFEmiRNA readsmiRNA* reads
precursors(nt)(kcal/mol)ZZNZZDZZNZZD
zju-miRn1ACTGTCGCGGGAGAGATGGCTCgi|699272003|gb|JREP01027427.1|:2299–220496-36.4461120
zju-miRn2CGGTGTGCAAGAAATGGAATAgi|699280098|gb|JREP01019335.1|:30687–3062068-30.0516110
zju-miRn3AATTCCGGCGATGGCGACTGCgi|699293024|gb|JREP01006409.1|:14748–1481265-37.120430
zju-miRn4TTTCTACGTCCGGCGCAACATGTTgi|699277485|gb|JREP01021948.1|:39003–3909189-31.347401
zju-miRn5TGGATCTTGTTCGATGGCACTgi|699281215|gb|JREP01018218.1|:26882–26968107-44125616701507235
zju-miRn6TGCCTGGCTCCCTGTATGCCgi|699278012|gb|JREP01021421.1|:2374–245784-47.51100
zju-miRn7TATGATGCGGACGGTCCTCATgi|699270789|gb|JREP01028641.1|:12613–12776164-73.281000
zju-miRn8TCGTGTTCGGGTTAGGCATTTgi|699270875|gb|JREP01028555.1|:4772–484877-29.65410010
zju-miRn9TCCTCAGTAGCTCAGTGGTAgi|699273880|gb|JREP01025552.1|:9956–10142187-59.2775500
zju-miRn10TGGGGAATGCCATGTAGACTTGgi|699287923|gb|JREP01011510.1|:31269–3134779-30.410300
zju-miRn11ACAGGCGGTGGATCAAATATGAATgi|699283153|gb|JREP01016280.1|:34764–3470560-346233884123
zju-miRn12TTACAAGGTCGGTTGCATGGCgi|699274146|gb|JREP01025287.1|:19052–19415364-111.881000
zju-miRn13TGTTCCTGCACAGATTCTCCCgi|699278034|gb|JREP01021399.1|:11–9282-43.892554231
zju-miRn14TGGATCTTGTTCGACAGCACTgi|699291620|gb|JREP01007813.1|:1267–1375109-45473986012
zju-miRn15TTGGCGTGAGAGACTTGGTAGgi|699297613|gb|JREP01001820.1|:3185–3308124-42.2478457828024
zju-miRn16TTAGTGATCCTCCGGAAGATCgi|699288201|gb|JREP01011232.1|:20386–20161226-73.3349055763
zju-miRn17TTAGATGGCCATCAACGAACAgi|699277419|gb|JREP01022014.1|:763–68580-34.722249243
zju-miRn18TATGGTGCGGACGGTCTTCATgi|699290074|gb|JREP01009359.1|:3643–3786145-78.12012110
zju-miRn19TATGGTGCGGACGATCCTCATgi|699274854|gb|JREP01024579.1|:3620–3784165-70.3301800
zju-miRn21TCAAATGATGAGTATGGATTgi|699276408|gb|JREP01023025.1|:4365–4715351-79.7498600
zju-miRn22TTTGCTTTGGAATCATTCTGgi|699280203|gb|JREP01019230.1|:26219–26333115-31.1152900
zju-miRn23TTTTCACCTCTTCTGGACGGGgi|699280638|gb|JREP01018795.1|:9272–935483-2241200
zju-miRn24TCCAGGAAGCTGTTTCTCATgi|699285304|gb|JREP01014129.1|:6565–6729165-35.501200
zju-miRn25TCTATGGTGAGGACGGTCCAgi|699292052|gb|JREP01007381.1|:20187–20358172-77.8049150

Targets of conserved and novel miRNAs in Z. jujuba

To better understand the functions of identified miRNAs, we performed a target search of identified miRNAs against the jujube transcriptome unigenes using psRNATarget with penalty scores of 2.5 [24]. As a result, we identified a total of 150 unigenes from 65,534 assembled Z. jujuba unigenes to be targets of 32 conserved miRNA families (Table 4). Since the direction of unigenes could not be determined, we manually checked the direction of the predicted targets. Finally, we have identified 40 targets of 32 conserved miRNA families with penalty scores of 2.5.
Table 4

The predicted conserved miRNAs targets of Z. jujuba.

miRNATarget geneTarget gene annotation
miR1515comp41442_c0_seq1glycoside hydrolase
miR156acomp40466_c0_seq3PREDICTED: squamosa promoter-binding-like protein 12-like
miR156bcomp36565_c2_seq1PREDICTED: squamosa promoter-binding-like protein 13A-like
miR156ccomp36565_c2_seq1PREDICTED: squamosa promoter-binding-like protein 13A-like
miR156fcomp42825_c0_seq1squamosa promoter binding-like protein
miR159acomp34167_c1_seq3PREDICTED: transcription factor GAMYB-like
miR160acomp39955_c2_seq9Auxin response factor
miR164acomp33975_c1_seq1NAC domain protein NAC1
miR164acomp33455_c0_seq1PREDICTED: NAC domain-containing protein 100-like
miR166acomp37537_c2_seq1PREDICTED: homeobox-leucine zipper protein REVOLUTA
miR171bcomp16216_c0_seq1PREDICTED: cytokinin hydroxylase
miR171bcomp41445_c7_seq1PREDICTED: scarecrow-like protein 6-like
miR172comp30896_c1_seq1PREDICTED: ethylene-responsive transcription factor RAP2-7-like
miR2111acomp33728_c0_seq1Cell division protein ftsZ, putative
miR2950acomp38329_c0_seq1PREDICTED: DEAD-box ATP-dependent RNA helicase 46-like
miR319bcomp28710_c0_seq1PREDICTED: probable E3 ubiquitin-protein ligase ARI7-like
miR319dcomp34167_c1_seq3PREDICTED: transcription factor GAMYB-like
miR394comp32572_c0_seq1zinc finger, C2H2, LYAR-type protein
miR395acomp38415_c5_seq4nucleic acid binding protein, putative
miR395bcomp13922_c0_seq1PREDICTED: L-gulonolactone oxidase-like
miR395bcomp28089_c0_seq1PREDICTED: probable serine/threonine-protein kinase Cx32
miR396acomp11572_c0_seq1DNA-dependent RNA polymerase II second largest subunit
miR396acomp20253_c0_seq1putative rna-dependent rna polymerase protein
miR396bcomp10489_c0_seq1PREDICTED: DUF246 domain-containing protein
miR396bcomp15448_c0_seq1ribosomal protein L13A
miR396ccomp40813_c0_seq2PREDICTED: putative calcium-transporting ATPase 13
miR396ccomp41603_c3_seq4PREDICTED: ribonuclease 3-like protein 2-like
miR396dcomp33509_c0_seq1Growth-regulating factor
miR396dcomp37447_c0_seq15PREDICTED: growth-regulating factor 1-like
miR396dcomp18240_c0_seq1PREDICTED: growth-regulating factor 8-like
miR397comp36338_c0_seq1laccase 1b
miR398ccomp35319_c0_seq1PREDICTED: pollen-specific protein SF3-like
miR399comp38254_c1_seq1PREDICTED: probable ubiquitin-conjugating enzyme E2 24-like
miR477comp57357_c0_seq1DELLA protein GAI1, putative
miR477comp44262_c0_seq1PREDICTED: germin-like protein subfamily 1 member 1-like
miR482acomp40948_c0_seq8NBS type disease resistance protein
miR529acomp42121_c0_seq1Disease resistance protein RPM1
miR530comp39924_c5_seq4acetyl-CoA carboxylase BCCP subunit
miR858acomp23909_c0_seq1GHMYB10
miR858bcomp47693_c0_seq1NBS-LRR disease-resistance protein scn3r1
The putative functions of the predicted target genes were diverse, most of the target genes were transcription factors, disease resistant genes or the key enzyme genes involved in development, disease resistance or metabolism. Most targets of conserved miRNAs in Z. jujuba were the same to those reported miRNAs in other plant species, such as squamosa promoter binding-like protein genes targeted by miR156, transcription factor GAMYB-like gene regulated by miR159, auxin response factor gene regulated by miR160, NAC-domain protein gene, homeobox-leucine zipper protein gene, AP2 domain-containing protein gene, growth regulating factor gene, laccase gene and MYB gene targeted by miR164, miR166, miR172, miR396, miR397, and miR858, respectively (Table 4). Using the same approach, we predicted 49 targets for 24 novel miRNA genes (Table 5). The number of predicted targets varied from 1 to 4 per miRNA. Many of the predicted targets are associated with metabolism, signal transduction and development. We found that four ubiquitin carboxyl-terminal hydrolase 5-like genes were the targets of miRn7, miRn18, miRn19 and miRn24, respectively, and two serine/threonine protein kinase genes were the targets of miRn5 and miRn14. This phenomenon that one gene can be targeted by more than one miRNAs also have been found in other plant species [27].
Table 5

The predicted novel miRNAs targets of Z. jujuba.

miRNATarget geneTarget gene annotation
zju-miRn1comp18278_c0_seq1adenylate cyclase
zju-miRn2comp45157_c0_seq1PREDICTED: BAG family molecular chaperone regulator 3-like
zju-miRn2comp37427_c0_seq12PREDICTED: uncharacterized lipoprotein syc1174_c-like
zju-miRn2comp40764_c4_seq145nucleic acid binding protein, putative
zju-miRn2comp40676_c1_seq5cellulose synthase
zju-miRn3comp38877_c0_seq7PREDICTED: methylmalonate-semialdehyde dehydrogenase
zju-miRn4comp32382_c1_seq1Tigger transposable element-derived protein 6
zju-miRn4comp40514_c0_seq2AP-1 complex subunit gamma-2, putative
zju-miRn4comp31728_c0_seq1PREDICTED: major allergen Pru ar 1-like
zju-miRn5comp41887_c1_seq80serine/threonine protein kinase
zju-miRn5comp35892_c1_seq2PREDICTED: ethylene-responsive transcription factor ERF015-like
zju-miRn6comp33310_c2_seq1putative auxin response factor ARF16
zju-miRn6comp39955_c2_seq9Auxin response factor, putative
zju-miRn7comp41963_c4_seq2PREDICTED: ubiquitin carboxyl-terminal hydrolase 5-like
zju-miRn8comp35801_c1_seq2PREDICTED: uncharacterized LOC101216743
zju-miRn9comp40169_c0_seq1sieve element occlusion
zju-miRn9comp41105_c1_seq1family 5 glycoside hydrolase
zju-miRn10comp27249_c0_seq1PREDICTED: xyloglucan galactosyltransferase KATAMARI1-like
zju-miRn10comp41841_c2_seq3PREDICTED: leucine-rich repeat receptor protein kinase EXS-like
zju-miRn11comp20342_c0_seq1PREDICTED: DNA helicase INO80-like
zju-miRn11comp42075_c1_seq3PREDICTED: beta-galactosidase-like
zju-miRn12comp37762_c0_seq1clathrin, heavy polypeptide
zju-miRn13comp33278_c0_seq4sentrin/sumo-specific protease, putative
zju-miRn14comp41887_c1_seq80serine/threonine protein kinase
zju-miRn14comp32418_c0_seq3PREDICTED: tetratricopeptide repeat protein 27 homolog
zju-miRn15comp16621_c0_seq1short chain dehydrogenase/reductase
zju-miRn15comp35884_c2_seq3glutathione peroxidase
zju-miRn15comp52942_c0_seq1ubiquitination network signaling protein
zju-miRn15comp57387_c0_seq1GDP-mannose 4,6-dehydratase
zju-miRn16comp40793_c0_seq280 kD MCM3-associated protein, putative
zju-miRn17comp37942_c0_seq1PREDICTED: SPX domain-containing membrane protein At4g22990
zju-miRn17comp40255_c1_seq15PREDICTED: dual specificity protein kinase pyk1-like
zju-miRn18comp41963_c4_seq2PREDICTED: ubiquitin carboxyl-terminal hydrolase 5-like
zju-miRn19comp41963_c4_seq2PREDICTED: ubiquitin carboxyl-terminal hydrolase 5-like
zju-miRn20comp34156_c0_seq2WRKY transcription factor, putative
zju-miRn20comp37782_c0_seq8PREDICTED: E3 ubiquitin-protein ligase XBAT33
zju-miRn20comp39627_c0_seq3PREDICTED: mitochondrial carnitine/acylcarnitine carrier-like protein-like
zju-miRn20comp41133_c0_seq1PREDICTED: pyruvate, phosphate dikinase, chloroplastic-like
zju-miRn21comp32995_c0_seq1NIPA2 protein
zju-miRn22comp35463_c0_seq1PREDICTED: DNL-type zinc finger protein-like
zju-miRn22comp37131_c0_seq3PREDICTED: O-glucosyltransferase rumi-like
zju-miRn22comp55704_c0_seq1S-adenosylmethionine-dependent methyltransferase, putative
zju-miRn23comp37189_c0_seq1trehalose-6-phosphate synthase, putative
zju-miRn23comp37224_c0_seq11PREDICTED: ubiquitin carboxyl-terminal hydrolase 22-like
zju-miRn23comp41601_c5_seq8PREDICTED: poly(U)-binding-splicing factor PUF60-B-like isoform 1
zju-miRn23comp41632_c0_seq4Pre-mRNA-processing factor
zju-miRn24comp36352_c0_seq1PREDICTED: probable galactinol—sucrose galactosyltransferase 2-like
zju-miRn24comp37648_c0_seq1PREDICTED: tyrosine—tRNA ligase-like
zju-miRn24comp41963_c4_seq2PREDICTED: ubiquitin carboxyl-terminal hydrolase 5-like

Differentially expressed miRNAs in response to witches’-broom phytoplasma

To further identify the functions of miRNAs in Z. jujuba involved in response to phytoplasma infection, we normalized the expression levels of miRNAs and compared the expression levels of the miRNAs in the ZZN and ZZD libraries. As a result, we identified 85 conserved miRNA sequences and 24 novel miRNA sequences, 12 miRNA sequences were up-regulated more than 2 fold in the infected sprig leaves, including miR156a, miR156b, miR156c, miR156d, miR156e, miR156h, miR159e, miR319a, miR395a, miR395b, zju-miRn23 and zju-miRn24. Conversely, 10 miRNA sequences were down- regulated more than 2 fold in the infected plant (S3 Table), including miR159a, miR172, miR2111, miR2950, miR399, miR477, miR858b, zju-miRn2, zju-miRn8 and zju-miRn16. Among them, the most abundant up-regulated miRNAs were miR156a, but the most abundant down- regulated miRNA was miR172. Interestingly, in miR159 family, miR159e was up-regulated in the infected sprig leaves, whereas miR159a was down-regulated. In addition, most conserved and novel miRNAs were detected in both libraries, except zju-miRn23 and zju-miRn24 which were only detected in the ZZD library. This suggests that these two novel miRNAs may be related to response to phytoplasma infection. To validate the sequencing data and confirm the differential expression of the miRNAs, we performed poly(A) qRT-PCR on 9 miRNAs (miR156a, miR156c, miR156d, miR156h, miR159a, miR172, miR2111, miR399 and miR477) which were up-regulated or down- regulated more than 2 fold in the infected sprig leaves. The results revealed that miR156a, miR156c, miR156h and miR156d were up-regulated in the infected sprig leaves, whereas miR159a, miR172, miR2111, miR399 and miR477 were down- regulated in the infected sprig leaves. The results indicated that these 9 miRNAs had the same expression patterns compared with the sequencing data (Fig 4). These results imply that the phytoplasma responsive miRNAs in the regulation of biological processes involved in witches’-broom diseases.
Fig 4

qRT-PCR validation of the differentially expressed miRNAs.

Fold changes of the differentially expressed miRNAs are shown. miRNAs were analyzed using the poly(T) adaptor RT-PCR method. The levels in ZZN were arbitrarily set to 1. Error bars represent the standard deviations of three technical PCR replicates.

qRT-PCR validation of the differentially expressed miRNAs.

Fold changes of the differentially expressed miRNAs are shown. miRNAs were analyzed using the poly(T) adaptor RT-PCR method. The levels in ZZN were arbitrarily set to 1. Error bars represent the standard deviations of three technical PCR replicates.

Experimental validation of Z. jujuba miRNAs targets

To confirm whether the five differentially expressed miRNAs (miR156, miR159, miR172, miR2111 and miR477) could cleave the predicted targets, we isolated RNAs from the sprig leaves of Z. jujuba wild type (ZZN) and the infected plant (ZZD) with witches’-broom disease, pooled together and performed the modified 5’-RNA ligase-mediated (RLM)-RACE experiment to validate the cleavage sites. The 5’-RACE products revealed that 2 SPL geners and 1 MYB gene are indeed the targets of Z. jujuba miR156 and miR159, respectively (Fig 5). This is consistent with the results from other plants [33, 34], suggesting the functional conservation of miR156 and miR159.
Fig 5

Experimental validation of the miRNA targets.

Cleavage sites were determined by the modified 5’RNA ligase-mediated RACE. Heavy black lines represent unigenes. miRNA complementary sites with the nucleotide positions of SPL and MYB cDNAs are indicated. Vertical arrows indicate the 5’ termini of miRNA-guided cleavage products, as identified by 5’-RACE, with the frequency of clones shown.

Experimental validation of the miRNA targets.

Cleavage sites were determined by the modified 5’RNA ligase-mediated RACE. Heavy black lines represent unigenes. miRNA complementary sites with the nucleotide positions of SPL and MYB cDNAs are indicated. Vertical arrows indicate the 5’ termini of miRNA-guided cleavage products, as identified by 5’-RACE, with the frequency of clones shown.

Discussion

In recent years, research on small RNA function and mechanism has become one of the hot spots in the life science. miRNAs as a new regulator, play important and diverse roles in multiple developmental and physiological processes, antiviral defense, responding to biotic, abiotic stresses etc. It has been indicated that miRNAs play an important role in plant-pathogen interactions, such as miR393, miR319, miR160, miR167, miR390, and miR408 [35]. A growing number of pathogen-responsive miRNAs have been identified [36]. To our best knowledge, the small RNAs of Z. jujuba have not been previously reported. In this study, a total of 85 conserved miRNA unique sequences belonging to 32 miRNA families and 24 novel miRNA unique sequences, including their complementary miRNA* strands were identified in two libraries derived from Z. jujuba wild type (ZZN) uninfected leaves and leaves infected (ZZD) with JWB disease. 40 target genes of 85 conserved miRNAs and 49 target genes of 24 novel miRNAs were predicted using computational analysis, and their functions were putatively assigned. We also identified differentially expressed miRNAs associated with JWB disease between ZZN and ZZD libraries. The targets of miR156 and miR159 were validated using the modified 5’-RACE method. The regulatory mechanism of miRNAs involved in witches’-broom phytoplasma response is a complicated problem. Currently there are only two reported studies involving witches’-broom phytoplasma responsive miRNAs, which consist of the investigation of Mexian lime infected by Candidatus Phytoplasma aurantifolia [29] and mulberry infected by aster yellows phytoplasma [37]. Both these studies concluded that the differentially expressed miRNAs in healthy and phytoplasma infected plants involved in modulating multiple pathways such as hormonal, nutritional, and stress signaling pathways [29, 37]. They also concluded that these responsive sRNAs may work cooperatively in the response to phytoplasma infection and be responsible for some symptoms observed in the infected plants [38]. Compared to these two studies, among the 85 conserved witches’-broom phytoplasma responsive miRNAs identified in Z. jujuba, only 3 miRNA families, including miR156, miR172 and miR477, were also differentially expressed in Candidatus phytoplasma aurantifolia infected Mexican lime and aster yellows phytoplasma infected in mulberry. Therefore, the expression patterns of miRNAs responsive to the phytoplasma infection were diverse in different plants. In this study, among the differentially expressed miRNAs, miR156 was the most up-regulated differentially miRNAs, suggesting that miR156 may play an important role in response to JWB. In both libraries, all the up-regulated miRNA sequences with a greater than 3.5 fold change were members of miR156 family. The SQUAMOSA PROMOTER BINDING PROTEIN LIKE (SPL) genes were the targets of miR156. Our results showed that miR156 was up-regulated in the infected sprig leaves, meanwhile miR172 was down-regulated. A previous study showed that the overexpression of miR156b in Arabidopsis increased axillary branching [39], which is similar to the symptom of the witches’-broom disease [38-40]. Furthermore, APETALA2 was regulated by miR172 through direct RNA cleavage or translational repression [36, 41]. In this study, we found the expression levels of miR172 was down-regulated, suggesting that the expression levels of APETALA2 gene was increased, which takes part in regulating flowering time and floral organ identity [41]. In addition, some SPL genes, such as AtSPL9, positively regulate the expression of miR172. This forms the miR156-AtSPL9-miR172 regulatory pathway [42, 43]. Therefore, the miR156-SPL9-miR172 regulatory pathway may be also conserved in response to phytoplasma infection. The expression changes of miR156 and miR172 might leads to the symptoms of the JWB diseases such as development of green leaf-like structures instead of flowers and sterility of flowers. MiR159 is the most abundant miRNAs in both libraries, which targets the mRNAs of MYB transcription factors. The expression level of miR159 was down-regulated in the ZZD library. It has been suggested that the overexpression of MYB33 leads to rolled leaf and shorter petioles [44, 45]. Therefore, our results suggest that miR156, miR172 and miR159 play important roles in the responses to JWB diseases, which will provide the insight to elusive the molecular mechanisms of witches’-broom disease in Z. jujuba.

The predicted hairpin structures of all the novel miRNAs.

(PDF) Click here for additional data file.

Primers used for qRT-PCR.

(DOC) Click here for additional data file.

Primers used for validation of the miRNA cleavage of targets.

(DOC) Click here for additional data file.

The expression profiling of miRNAs between ZZN and ZZD libraries.

(DOC) Click here for additional data file.
  35 in total

Review 1.  Functions of microRNAs in plant stress responses.

Authors:  Ramanjulu Sunkar; Yong-Fang Li; Guru Jagadeeswaran
Journal:  Trends Plant Sci       Date:  2012-02-23       Impact factor: 18.313

Review 2.  Phytoplasmas and their interactions with hosts.

Authors:  Nynne M Christensen; Kristian B Axelsen; Mogens Nicolaisen; Alexander Schulz
Journal:  Trends Plant Sci       Date:  2005-10-12       Impact factor: 18.313

3.  Specific effects of microRNAs on the plant transcriptome.

Authors:  Rebecca Schwab; Javier F Palatnik; Markus Riester; Carla Schommer; Markus Schmid; Detlef Weigel
Journal:  Dev Cell       Date:  2005-04       Impact factor: 12.270

Review 4.  The diversity of RNA silencing pathways in plants.

Authors:  Peter Brodersen; Olivier Voinnet
Journal:  Trends Genet       Date:  2006-03-29       Impact factor: 11.639

Review 5.  The control of developmental phase transitions in plants.

Authors:  Peter Huijser; Markus Schmid
Journal:  Development       Date:  2011-10       Impact factor: 6.868

6.  Enhanced seed carotenoid levels and branching in transgenic Brassica napus expressing the Arabidopsis miR156b gene.

Authors:  Shu Wei; Bianyun Yu; Margaret Y Gruber; George G Khachatourians; Dwayne D Hegedus; Abdelali Hannoufa
Journal:  J Agric Food Chem       Date:  2010-09-08       Impact factor: 5.279

7.  Bacteria-responsive microRNAs regulate plant innate immunity by modulating plant hormone networks.

Authors:  Weixiong Zhang; Shang Gao; Xiang Zhou; Padmanabhan Chellappan; Zheng Chen; Xuefeng Zhou; Xiaoming Zhang; Nyssa Fromuth; Gabriela Coutino; Michael Coffey; Hailing Jin
Journal:  Plant Mol Biol       Date:  2010-12-12       Impact factor: 4.076

8.  Identification of genes differentially expressed during interaction of Mexican lime tree infected with "Candidatus Phytoplasma aurantifolia".

Authors:  Maryam Ghayeb Zamharir; Mohsen Mardi; Seyed Mohammad Alavi; Nader Hasanzadeh; Mojtaba Khayyam Nekouei; Hamid Reza Zamanizadeh; Ali Alizadeh; Ghasem Hoseini Salekdeh
Journal:  BMC Microbiol       Date:  2011-01-01       Impact factor: 3.605

9.  The complex jujube genome provides insights into fruit tree biology.

Authors:  Meng-Jun Liu; Jin Zhao; Qing-Le Cai; Guo-Cheng Liu; Jiu-Rui Wang; Zhi-Hui Zhao; Ping Liu; Li Dai; Guijun Yan; Wen-Jiang Wang; Xian-Song Li; Yan Chen; Yu-Dong Sun; Zhi-Guo Liu; Min-Juan Lin; Jing Xiao; Ying-Ying Chen; Xiao-Feng Li; Bin Wu; Yong Ma; Jian-Bo Jian; Wei Yang; Zan Yuan; Xue-Chao Sun; Yan-Li Wei; Li-Li Yu; Chi Zhang; Sheng-Guang Liao; Rong-Jun He; Xuan-Min Guang; Zhuo Wang; Yue-Yang Zhang; Long-Hai Luo
Journal:  Nat Commun       Date:  2014-10-28       Impact factor: 14.919

10.  Arabidopsis mutant sk156 reveals complex regulation of SPL15 in a miR156-controlled gene network.

Authors:  Shu Wei; Margaret Y Gruber; Bianyun Yu; Ming-Jun Gao; George G Khachatourians; Dwayne D Hegedus; Isobel A P Parkin; Abdelali Hannoufa
Journal:  BMC Plant Biol       Date:  2012-09-18       Impact factor: 4.215

View more
  7 in total

1.  The use of high-throughput small RNA sequencing reveals differentially expressed microRNAs in response to aster yellows phytoplasma-infection in Vitis vinifera cv. 'Chardonnay'.

Authors:  Marius C Snyman; Marie-Chrystine Solofoharivelo; Rose Souza-Richards; Dirk Stephan; Shane Murray; Johan T Burger
Journal:  PLoS One       Date:  2017-08-16       Impact factor: 3.240

Review 2.  Nanotechnology based approaches for detection and delivery of microRNA in healthcare and crop protection.

Authors:  Vrantika Chaudhary; Sumit Jangra; Neelam R Yadav
Journal:  J Nanobiotechnology       Date:  2018-04-13       Impact factor: 10.435

3.  Comparative genome analysis of jujube witches'-broom Phytoplasma, an obligate pathogen that causes jujube witches'-broom disease.

Authors:  Jie Wang; Laiqing Song; Qiqing Jiao; Shuke Yang; Rui Gao; Xingbo Lu; Guangfang Zhou
Journal:  BMC Genomics       Date:  2018-09-19       Impact factor: 3.969

4.  miRVIT: A Novel miRNA Database and Its Application to Uncover Vitis Responses to Flavescence dorée Infection.

Authors:  Walter Chitarra; Chiara Pagliarani; Simona Abbà; Paolo Boccacci; Giancarlo Birello; Marika Rossi; Sabrina Palmano; Cristina Marzachì; Irene Perrone; Giorgio Gambino
Journal:  Front Plant Sci       Date:  2018-07-17       Impact factor: 5.753

5.  ceRNA Cross-Talk in Paulownia Witches' Broom Disease.

Authors:  Guoqiang Fan; Zhe Wang; Xiaoqiao Zhai; Yabing Cao
Journal:  Int J Mol Sci       Date:  2018-08-20       Impact factor: 5.923

Review 6.  Plant Hormones in Phytoplasma Infected Plants.

Authors:  Marina Dermastia
Journal:  Front Plant Sci       Date:  2019-04-17       Impact factor: 5.753

7.  Differential Response of Grapevine to Infection with 'Candidatus Phytoplasma solani' in Early and Late Growing Season through Complex Regulation of mRNA and Small RNA Transcriptomes.

Authors:  Marina Dermastia; Blaž Škrlj; Rebeka Strah; Barbara Anžič; Špela Tomaž; Maja Križnik; Christina Schönhuber; Monika Riedle-Bauer; Živa Ramšak; Marko Petek; Aleš Kladnik; Nada Lavrač; Kristina Gruden; Thomas Roitsch; Günter Brader; Maruša Pompe-Novak
Journal:  Int J Mol Sci       Date:  2021-03-29       Impact factor: 5.923

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.