Literature DB >> 27824106

Peripheral and spinal 5-HT receptors participate in cholestatic itch and antinociception induced by bile duct ligation in rats.

Bin Tian1, Xue-Long Wang1, Ya Huang2, Li-Hua Chen3, Ruo-Xiao Cheng2, Feng-Ming Zhou2, Ran Guo4, Jun-Cheng Li1, Tong Liu2.   

Abstract

Although 5-HT has been implicated in cholestatic itch and antinociception, two common phenomena in patients with cholestatic disease, the roles of 5-HT receptor subtypes are unclear. Herein, we investigated the roles of 5-HT receptors in itch and antinociception associated with cholestasis, which was induced by common bile duct ligation (BDL) in rats. 5-HT-induced enhanced scratching and antinociception to mechanical and heat stimuli were demonstrated in BDL rats. 5-HT level in the skin and spinal cord was significantly increased in BDL rats. Quantitative RT-PCR analysis showed 5-HT1B, 5-HT1D, 5-HT2A, 5-HT3A, 5-HT5B, 5-HT6, and 5-HT7 were up-regulated in peripheral nervous system and 5-HT1A, 5-HT1F, 5-HT2B, and 5-HT3A were down-regulated in the spinal cord of BDL rats. Intradermal 5-HT2, 5-HT3, and 5-HT7 receptor agonists induced scratching in BDL rats, whereas 5-HT3 agonist did not induce scratching in sham rats. 5-HT1A, 5-HT2, 5-HT3, and 5-HT7 agonists or antagonists suppressed itch in BDL rats. 5-HT1A agonist attenuated, but 5-HT1A antagonist enhanced antinociception in BDL rats. 5-HT2 and 5-HT3 agonists or antagonists attenuated antinociception in BDL rats. Our data suggested peripheral and central 5-HT system dynamically participated in itch and antinociception under cholestasis condition and targeting 5-HT receptors may be an effective treatment for cholestatic itch.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27824106      PMCID: PMC5099756          DOI: 10.1038/srep36286

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Itch (pruritus) is an unpleasant somatic sensation that elicits a desire to scratch1. Acute itch serves as a self-protective mechanism against potential harmful environmental irritants or parasites2. However, chronic itch is a debilitating symptom that arises from many systemic disorders, such as dermatologic diseases (e.g. atopic dermatitis and psoriasis), chronic kidney failure, chronic liver diseases (e.g. cholestasis), infections, and hematologic diseases34. Scratching transiently relieves acute itch5, but has limited effects on chronic itch and paradoxically evokes itch-scratch-itch cycle. Chronic itch disrupts sleep and substantially reduces the quality of life of patients1. Antihistamines are often clinically prescribed for treating allergy itch; however, they are inefficient for many aforementioned chronic itch conditions4. Although the recent discovery for itch-specific neural pathway678, novel itch mediators and receptors9101112, greatly improves our understanding on acute itch2, the pathogenesis of chronic itch associated with systemic disorders remains enigmatic. Cholestasis is defined as diminished delivery of bile into the intestine resulting either from a functional defect at hepatocyte level or obstruction at the bile duct level of any cause, such as primary biliary cirrhosis (PBC), primary sclerosing cholangitis (PSC), intrahepatic cholestasis of pregnancy (ICP), and benign recurrent intrahepatic cholestasis13. Infections, autoimmune, metabolic diseases and drug side effects often results in cholestasis14. Patients with cholestasis experience severe and intractable pruritus1516, and also exhibit altered pain perception1718. Analgesia has been observed in cholestatic patients, for example, patients undergoing orthotopic liver transplantation for cholestatic diseases reported lower postoperative pain scores and required less morphine for analgesia than patients undergoing liver resection19. It was demonstrated peripheral endogenous opioid-mediated and naloxone-reversible analgesia in mice or rats with bile duct ligation, which induced obstructive cholestatic disease2021. Recently, there were several important findings to elucidate the pathogenesis of cholestatic pruritus. For example, serum concentrations of lysophosphatidic acid (LPA) and autotoxin (the enzyme that forms LPA) were significantly increased in cholestatic patients with pruritus and could directly activate dorsal root ganglia (DRG) neurons reflected by increased intracellular calcium22, suggesting LPA is a potential mediator of cholestatic pruritus. Bile acids, such as deoxycholic acid (DCA) and taurolithocholic acid (TLCA), bind to TGR5 (also known as GPR131 or GPBAR1) and activate transient receptor potential cation channel A1 (TRPA1) in primary sensory neurons and subsequently stimulates the release of itch-related neuropeptides, such as gastrin-releasing peptide (GRP) and natriuritic precursor peptide B (NPPB), in the spinal cord to transmit itch in mice1723. Previous report also demonstrated that protease-activated receptor 2 (PAR2)-induced sensitization of transient receptor potential cation channel V1 (TRPV1) contributed to the pathogenesis of cholestatic pruritus in rats24. Although several novel itch mediators (LPA, bile acids and PAR2 agonists) and receptors (TGR5, TRPV1/A1, and PAR2) were demonstrated to be involved in cholestatic itch, the peripheral and central mechanisms underlying cholestatic pruritus and antinociception are still not completely understood. Among monoamine neurotransmitters, serotonin, or 5-hydroxytryptamine (5-HT), is considered to play key and complex role in pain sensation25, and recently it was also demonstrated its crucial role in itch sensation26. To date, seven classes of 5-HT receptors (5-HT1-5-HT7) have been identified and comprise at least 15 subtypes25. Except 5-HT3 receptor as a ligand-gated cation channel, all other 5-HT receptors are G protein-coupled receptors (GPCRs)25. As 5-HT is not able to penetrate the blood-brain-barrier (BBB), peripheral and central 5-HT systems are considered to be separated compartments and employ distinct rate-limiting enzymes for 5-HT synthesis, such as tryptophan hydroxylase 1 (Tph1) in the skin and tryptophan hydroxylase 1 (Tph2) in the brain26. 5-HT in the skin released from mast cells, as a critical component of “inflammatory soup”, was identified as a potent inducer of pain or itch via activation distinct 5-HT receptors subtypes, such as 5-HT2A, 5-HT2B, 5-HT2C, 5-HT3, 5-HT4, 5-HT6, and 5-HT7272829. Descending 5-HT pathways, originating from the nucleus raphe magus (NRM) within the vicinity of the rostral ventromedial medulla (RVM), may exert either inhibitory or facilitatory influence on pain or itch transmission in spinal cord dorsal horn, possible dependent on the physiological or pathophysiological status263031. The discovery of multiple 5-HT receptors subtypes may explain their complex influence on the processing of pain or itch signal2528303233. Interestingly, several clinical trials found that administration of 5-HT3 receptor antagonist ondansetron3435363738 or selective serotonin reuptake inhibitor (SSRI) sertraline3940 were able to alleviate cholestatic pruritus, providing important clinical evidence to support critical role of 5-HT system in cholestatic pruritus. Although the importance of 5-HT system is emphasized in the modulation of pain and itch252641, the possible roles of peripheral and spinal 5-HT receptors in itch and antinociception induced by cholestasis are still unclear. The aim of the present study was to reveal the possible roles of peripheral and spinal 5-HT receptors in itch and antinociception in common bile duct ligation (BDL) rats, a severe model of obstructive cholestasis. We firstly demonstrated behavioral phenotypes for itch and antinociception in BDL rats and then examined the changes of the 5-HT level in the skin and spinal cord. Furthermore, we used quantitative real-time polymerase chain reaction (qPCR) to screen the expression change of difference 5-HT receptors subtypes at the peripheral and central nervous systems in BDL rats. Finally, we employed several pharmacological 5-HT receptors agonists and antagonists to elucidate the distinct roles of 5-HT receptors subtypes, especially 5-HT1A, 5-HT2, 5-HT3 and 5-HT7, in the modulation of itch and antinociception in BDL rats.

Materials and Methods

Animals

Adult male Sprague-Dawley rats (weighing 200–250 g) were obtained from the Shanghai SLAC Laboratory Animal CO. LTD. Rats were housed in groups of 3 rats per cage with food and water available ad libitum and kept in controlled room temperature (22 ± 2 °C) and humidity (60–80%) under a 12 h/12 h light/dark cycle. All experimental procedures and animal handing were performed in accordance with the guidelines of the International Association for the Study of Pain and the animal protocols were approved by Soochow University Animal Committee. The authors tried all efforts to minimize the number of animals used.

Surgical laparotomy and common bile duct ligation (BDL)

The surgical laparotomy and common bile duct ligation was performed as previously described4243. Briefly, laparotomy was performed under anesthesia with isoflurane and common bile duct was ligated using two ligatures. Rats with laparotomy, bile duct identification without ligation were used as sham rats. The body temperature of rat was maintained at 37 ± 1 °C during the entire surgical procedure. Cholestasis was confirmed by increased serum level of bilirubin as well as the intact ligature and proximal dilation of the common bile duct at the sacrifice time.

Drugs and administration

Serotonin hydrochloride (5-HT), deoxycholic acid (DCA), 5-HT2 receptor agonist α-methylserotonin maleate salt (α-methyl-5-HT), 5-HT3A receptor agonist 2-Methyl-5-hydroxytryptamine hydrochloride (2-Methyl-5-HT), and the 5-HT2A receptor antagonist ketanserin tartrate salt (ketanserin) was obtained from Sigma-Aldrich (St. Louis, MO, USA). The 5-HT1A receptor agonist 8-hydroxy-2-(dipropylamino) tetralin hydrobromide (DPAT), the 5-HT1A receptor antagonist WAY-100635 maleate salt, the 5-HT3A receptor agonist 2-Methyl-5-hydroxytryptamine hydrochloride (2-Methyl-5-HT), 5-HT7 receptor antagonist (2R)-1-[(3-Hydroxyphenyl)sulfonyl]-2-[2-(4-methyl-1-piperidinyl)ethyl]pyrrolidine hydrochloride (SB269970) were obtained from Tocris Bioscience (Bristol, UK). 5-HT3A receptor antagonist Ondansetron Hydrochloride Injection was obtained from China Jiangsu yabang Pharmaceytical factory CO. Ltd. (Jiangsu, China). The 5-HT re-uptake inhibitor Fluoxetine Hydrochloride Dispersible Tablets (PROZAC) was obtained from Patheon France. Ketanserin, WAY-100635 and Fluoxetine were dissolved in 10% DMSO and other reagents were dissolved in sterile saline if not specified. The information of 5-HT receptor agonists and antagonists used in this study was list in Table 1.
Table 1

5-HT receptor agonists and antagonists used in this study.

ChemicalsTargetFormulaM.WtBiological ActivityRef.
DPAT5-HT1A receptor agonistC16H25NO.HBr328.29Full 5-HT1A serotonin receptor agonist; more active enantiomer. Reduces hippocampal 5-HT levels following systemic administration in rats in vivo.44
WAY-1006355-HT1A receptor antagonistC25H34N4O2.C4H4O4538.64Potent, silent antagonist of 5-HT1A receptors (IC50 = 2.2 nM; Ki = 0.84 nM for rat 5-HT1A receptors). Displays 100-fold selectivity for 5-HT1A over other 5-HT subtypes.45, 46
α-methyl-5-HT5-HT2 receptor agonistC11H14N2O · C4H4O4306.31a-methyl-5-HT displays a high affinity (Ki = 3 nM with [3H]DOB) for 5-HT2 site and little selectivity for 5-HT1A, 5-HT1B, 5-HT1C, and 5-HT1D sites (Ki = 42, 85, 150, and 150 nM, respectively) and a very low affinity for 5-HT1E (Ki greater than 10,000 nM) sites.47, 48
ketanserin5-HT2A receptor antagonistC22H22FN3O3 · C4H6O6545.51Selective 5-HT2 serotonin receptor antagonist. Ketanserin significantly reduces nicotine self-administration in rats, supporting an unexpected involvement of serotonin in nicotine addiction.49, 50
2-Methyl-5-HT5-HT3A receptor agonistC11H14N2O.HCl226.715-HT3 agonist (Ki = 1200 nM) and potent 5-HT6 ligand (Ki = 46 nM).51, 52
Ondansetron5-HT3A receptor antagonistC18H19N3O.HCl329.83Selective 5-HT3 receptor antagonist (Ki = 6.16 nM). Antiemetic; prevents emesis induced by cytotoxic drugs and radiation.53, 54, 55
LP445-HT7 receptor agonistC27H37N3OS.HCl488.13High affinity 5-HT7 receptor agonist (Ki = 0.22 nM) that displays selectivity over 5-HT1A and 5-HT2A receptors (200- and >1000-fold respectively). Induces relaxation of substance P-stimulated guinea pig ileum (EC50 = 2.56 μM).29, 56
SB 2699705-HT7 receptor antagonistC 18H28N2O3S.HCl388.95Potent and selective 5-HT7 receptor antagonist (pKi values are 8.9, 7.2 and 6.0 for 5-HT7A, 5-HT5A and 5-HT1B and < 6.0 for 5-HT1A, 5-HT1D, 5-HT1E, 5-HT1F, 5-HT2A, 5-HT2B, 5-HT2C, 5-HT4 and 5-HT6 receptors respectively).29, 57, 58
After BDL surgery 5, 10, 15, and 30 days, intradermal injection of 5-HT (200 μg) into the rat cheek (total volume 20 μl) or neck (total volume 50 μl) was perform to assess itch response in the sham and BDL rats. After BDL surgery 15 days, intradermal injection 5-HT receptors agonists into the rat cheek (total volume 20 μl), including 5-HT1A receptor agonist 8-hydroxy-2-(dipropylamino) tetralin hydrobromide (DPAT; 100 μg), 5-HT2A receptor agonist α-methylserotonin maleate salt (α-methyl-5-HT; 100 μg), 5-HT3 receptor agonist 2-Methyl-5-hydroxytryptamine hydrochloride (2-Methyl-5-HT; 100 μg), 5-HT7 receptor agonist 4-[2-(Methylthio)phenyl]-N-(1,2,3,4-tetrahydro-1-naphthalenyl)-1-piperazinehexanamide hydrochloride (LP44; 100 μg) was perform to assess itch response in the sham and BDL rats. After BDL surgery 15 days, we also examined the effects of intrathecal injection of 5-HT receptors agonists on itch and antinociception in the sham and BDL rats. The doses used were as follow: DPAT (10 μg), α-methyl-5-HT (10 μg), 2-Methyl-5-HT (10 μg), and LP44 (10 μg). After BDL surgery 15 days, the effects of 5-HT receptors antagonists on itch and antinociception in the sham and BDL rats were assessed by intrathecal (i.t.) or intraperitoneal (i.p.) injection of them, including 5-HT1A receptor antagonist WAY-100635 maleate salt (i.t. 10 μg), 5-HT2A receptor antagonist ketanserin tartrate salt (i.p. 1 mg/kg), 5-HT3 receptor antagonist ondansetron hydrochloride (i.p. 3 mg/kg), and 5-HT7 receptor antagonist (2R)-1-[(3-Hydroxyphenyl)sulfonyl]-2-[2-(4-methyl-1-piperidinyl)ethyl]pyrrolidine hydrochloride (SB269970; i.t. 10 μg). The injection of 5-HT receptors agonists or antagonists was performed before 30 min of i.d. injection of 5-HT (200 μg) and the doses used in this study were based on previous reports2959606162 and our pilot experiments.

Neck model of itch

As described previously125963, rats were shaved at the nape of the neck at least 2 day before experiments. On the day of behavioral testing, rats were individually placed in small plastic chambers (15 × 20 × 25 cm) on an elevated metal mesh floor and allowed at least 60 min for habituation. Under brief anesthesia of isoflurane, rats were given an intradermal injection of 50 μl of 5-HT (200 μg) via a 26 G needle into the nape of the neck. Immediately after the injection, rats were returned to their chambers and were video recorded for 60 min. The video was subsequently played back offline and itch behavior was quantified by counting the number of scratches in a blinded manner. A scratch was counted when a rat lifted its hind paw to scratch the shaved region and returned the paw to the floor or to the mouth for licking. The neck model of itch is usually used to test the possible effects of intrathecal or systemic injection of drugs.

Cheek model of itch

As described previously646566, we intradermally injected chemicals into the cheek of rats. Rats were shaved on cheeks (approx. 5 × 8 mm area) at least 2 day before the experiment. On the day of experiment, rats were intradermally injected of 20 μl of 5-HT (200 μg) via a 26G needle into the cheek under brief anesthesia with isoflurane. After the injection, rats were immediately returned to their chambers and were video recorded for 60 min. The video was played back and the wipes and scratches were quantified by counting their number in a blinded manner. Scratching is counted when rats scratch the injection site on the cheek by hind paw and then returning to the floor or to the mouth. Wiping is counted when rats unilaterally wipe the injected site using the forelimb, which was not part of grooming behavior. As intrathecal injection of drugs by lumbar puncture may be difficult to reach the central nerve system that innervates the cheek area, the cheek model of itch is usually used to test the possible effects of systemic injection of drugs.

Hargreaves test

According to previously report67, we put the rats in plastic boxes and measured the hindpaw withdrawal latency to radiant heat apparatus (IITC Life Science). Rats were placed on a glass floor maintained at 25 °C in a clear plastic chamber and a radiant heat source, which was located under the glass floor, was focused onto the plantar surface of the hindpaw. We measured paw withdrawal latency 2–3 times for each hindpaw, and we used the mean of the results for analysis. We set a cut off of 20 s to prevent potential tissue injury.

Tail immersion test

As previously described4366, tail immersion test was employed to determine heat pain sensitivity in rats. Briefly, the terminal 3 cm of a rat’s tail was immersed in hot water bath at 52 °C and the latency of tail flick was recorded with a cutoff time of 15 seconds to avoid tissue damage.

von Frey filament test

To test mechanical hypersensitivity, we determined the mechanical sensitivity of hind paws by using series of von Frey filaments (4 g, 15 g, and 26 g) as previous report66. Rats were placed on a metal mesh floor and von Frey filaments were applied from underneath the floor. The plantar surface of hind paw was received consecutively by 10 stimulations. The measurement was repeated twice at an interval of 10 minutes. We used response frequency to estimate the mechanical sensitivity of rats.

Rota-rod test

We used Rota-rod test to evaluate the motor function of rats at day 15 after BDL surgery4368. Before testing 2 days, all of the rats were trained at various speeds of rotation. Each rat was placed on the rungs and allowed to remain stationary at 0 rpm for 10 sec, after which the speed was increased to 5 rpm for a maximum of 5 min. Rats were tested at 5, 10 until 25 rpm, during this time, rats that fell off the cylinder were placed back on the rotarod for three times. All rats were tested at 25 rpm for the 5-min period for each animal. Rats were tested for three trials with an interval of 20 min and the latency for falling was averaged.

RNA isolation and quantitative real-time polymerase chain reaction (qPCR)

The sham and BDL rats were sacrificed at 15 days after surgery. The rat brainstem, trigeminal ganglia, cervical DRGs and spinal cord were dissected out and collected. Total RNA was extracted by homogenizing tissues using Trizol Reagent (Invitrogen, Carlsbad, California) according to the protocol supplied by manufacturer. Chloroform (Sigma-Aldrich) was added after homogenization and the tubes were vortexed, followed by incubation at room temperature for 5 min and centrifugation at 14,000 rpm for 20 min at 4 °C. The supernatant was transferred to a new tube and isopropanol was added. The aqueous phase was centrifuged at 14,000 RPM for 20 min at 4 °C. Pellets were washed using 70% ethanol and resuspended in diethylpyrocarbonate (DEPC)-treated water. The purity and concentration of RNA were determined with NanoDrop ND-1000 Spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) with absorbance at 260 and 280 nm. One microgram of total RNA was reverse transcribed for synthesizing cDNA using RevertAid First Strand cDNA Synthesis Kit, according to the protocol supplied by the manufacturer (Thermo Fisher Scientific, Waltham, USA). qPCR experiment was performed by SYBR Green PCR Master Mix (Roche, Basle, Switzerland) using Opticon real-time PCR Detection System (ABI 7500, Life technology, USA). Data were normalized to the housekeeping gene β-actin. The 2(-Delta Delta C(t)) method was used to analyze the relative level of gene expression. Primers used are listed in Table 2.
Table 2

Sequences of primers used for real-time quantitative PCR.

Target geneForward (5′-3′)Reverse (5′-3′)Product size (bp)Accession number
5-HT1ACCATCAGCAAGGACCACGGCTACCCGTAGAGAACCAGCATGAGCAA86NM_012585.1
5-HT1BGTCAAGCCAAAGCGGAGGAGCAGGGTGGGTAAATAGAAAGC105NM_022225.1
5-HT1DCCCGAGAAAGGAAAGCCACTGAGGACCAAGGATACCACAAAGAA92NM_012852.1
5-HT1FCTGTGACCTTTGGCTGAGTGTTCGACTGCGTCTGTGATTGCTC104NM_021857.3
5-HT2ACTTCCAACGGTCCATCCACAGGGCACCACATTACAACAAACAG132NM_017254.1
5-HT2BCGCCATCCCAGTCCCTATTCAGCCAGTGACCCAAAGAGC116NM_017250.1
5-HT2CGACTGAGGGACGAAAGCAAAGGAAGGACCCGATGAGAACGA83NM_012765.3
5-HT3AGTGACCGCCTGTAGCCTTGAGATGCTCTTGTCCGACCTCA147NM_024394.2
5-HT4TGCCTTCCTTATCATCCTCTGCCACCACATTCCACTGTATCCCT134NM_012853.1
5-HT5ACGCTGTGCTCCTGGGATATCCTGTTGAACGCCGTGTAGAT104NM_013148.1
5-HT5BCGTGGTGCTCTTCGTCTACTGTCCTGAGGTGCTTCCTTTGC117NM_024395.1
5-HT6GCACGAACTGGGCAAAGCTGGACGCCACGAGGACAAAA82NM_024365.2
5-HT7TTCTGTCGGTCTGGCTGCTCTCACCGCAGTGGAGTAGATCGTGTAG130NM_022938.2
CK-7CGAGGAGATGGCCAACCATAGAGCGGTTCATCTCCGCAAT138NM_001047870.1
PCNACTTACTCTGCGCTCCGAAGGTGATGTCTTCATTACCAGCACA115NM_022381.3
TPH1ACGAACTCTTAGGCCACGTCCTTGCACAGTCCAAACTCCACA151NM_001100634.2
TPH2CAGCCCGCAATGATGATGTTTCGCTTCTCTTGTCCTCGCTTT145NM_173839.2
ActinACTATCGGCAATGAGCGGTTCCAGCACTGTGTTGGCA TAGAGGTC152NM_031144.3

Immunofluorescence

Rats were deeply anesthetized with chloral hydrate and intracardially perfused first with saline, then with 4% of the fixative solution paraformaldehyde in 0.1 M phosphate buffer (pH = 7.4). The L4-6 lumbar spinal cords were collected and postfixed in the same solution overnight. The spinal cords were transferred into a phosphate-buffered 15% sucrose solution overnight. After that, they were transferred into a phosphate-buffered 30% sucrose solution overnight. The spinal cord sections were cut at the thickness of 14-μm in a cryostat. The sections were mounted on siliconized slides for immunostaining. Sections were rinsed three times for 10 min with PBS, and then all incubated in PBS containing 10% normal goat serum (GIBCO) and 0.3% Triton X-100 (Sigma) for 1 h. Then, the sections were incubated overnight at 4 °C in rabbit polyclonal anti-5-HT antibody (diluted 1:500; Sigma, S5545, USA). We used the same anti-5-HT antibody as Prof. Yaobo Liu’s laboratory and the specificity of the antibody had been demonstrated by his lab69. After this, the sections were rinsed three times for 10 min with PBS and then incubated in a solution containing a goat anti-rabbit secondary antibody conjugated to Alexa Fluor 488 (1:500; Molecular Probes) for 1 h. They were then rinsed three times for 10 min with PBS, quickly rinsed with ddH2O, and left to dry on a plate at 37 °C for 15 min. Finally, the slice sections were mounted on glass slides and coverslipped with a drop of mounting medium (Dako North America Inc., Carpinteria, CA, USA). The coverslip was sealed with nail polish for preventing drying and movement. All slice sections were stored in dark at 4 °C. The sections were observed and photographed were examined under a Zeiss fluorescence microscope AXIO SCOPE A1 (Oberkochen, Germany), and images were analyzed with AxioVision software.

Histology

Rats were terminally anesthetized with isoflurane and transcardially perfused with phosphate buffersaline (pH 7.4, 0.1 M) followed by fixation with 4% (w/v) paraformaldehyde. Liver samples were post-fixed in 4% (w/v) formalin prepared in PBS for 24 h. This was followed by the dehydration of fixed tissue in various grades of alcohol (70%, 90%, 100%, v/v) and then cleared in benzene. Samples were removed; transverse sections were embedded in molten paraffin wax and 5 μm thick sections were cut using a microtome. Liver sections were stained with standard H&E staining. The images were analyzed using Adobe PhotoShop and the average number of bile duct-like structures per high-power field (HPF) was quantified.

High performance liquid chromatography (HPLC) analysis for 5-HT

Rats were terminally anesthetized with isoflurane on day 15 after BDL surgery. The skin and lumbar spinal cords were dissected quickly, weighed and then homogenized with an ultrasonic homogenizer (Microsonic, Dortmund, Germany) in 400 μl 0.4 mol/L perchloric acid. Samples were then centrifuged at 15000 rpm at 4 °C for 10 min, filtered through the 0.22 μm syringe filter and stored at −80 °C until HPLC analysis. The concentration of 5-HT were measured by applying reverse-phase HPLC with electrochemical detection (Waters, USA). The reversed phase column was YWG-C18, which was perfused for analysis with amobile phase composed of 0.1 mol/L NaAc (including 0.1 mol/L EDTA-Na2) and 10% methanol at pH 5.1. The flow rate was 1 mL/min. The data was quantified using the area under the peaks and external standards. The obtained results were presented in ng per gram of wet tissue (ng/g).

Statistical analysis

All data were analyzed using GraphPad Prism 6 software (GraphPad, San Diego, CA, USA). All data were expressed as the mean ± S.E.M. The statistical significance between two groups was analyzed by unpaired two-tailed Student’s t-test. One-way ANOVA followed by post-hoc Bonferroni test was used for multiple comparisons. Two-way repeated-measured ANOVA was also used to analyze the data with multiple time points. Differences with P < 0.05 were considered as statistical significance.

Results

Obstructive cholestasis model was established by common bile duct ligation (BDL) in rats

We firstly established an obstructive cholestatic rat model by common bile duct ligation (BDL). The biochemical and morphological evidence of liver injury and cholestasis were confirmed in BDL rats by multiple approaches (Fig. 1). H&E staining of liver section in BDL rats showed typical features of cholestasis, including expansion of the liver capillary bile duct, fibrosis around the small bile duct, and connection of the portal area (Fig. 1A). The bile duct-like structures in liver sections from BDL rats were increased compared to the sham rats (Fig. 1B). In addition, qPCR analysis showed that the mRNA expression of CK-7, which is a specific cholangiocytes marker, and proliferating cell nuclear antigen (PCNA), which is a cell proliferation-related marker, were significantly increased in BDL rats compared to the sham rats (Fig. 1C). Thus, the results showed that the bile duct had obvious hyperplasia in the BDL rats at the 4th week after surgery. The increased serum total bilirubin (BR) was also demonstrated in BDL rats (Fig. 1D; t8 = 2.508; P = 0.0365). In accordance with previous study7071, There was no significant difference for the body weight between the sham and BDL rats within 1 to 15 days after BDL surgery (Fig. 1E; F(1,52) = 0.1752; P = 0.6772).
Figure 1

Cholestasis was induced by common bile duct ligation (BDL) in rats.

(A) Representative H&E staining photomicrographs of liver section in sham and BDL rats. Compared to SHAM control rats, the bile duct had obvious atypical hyperplasia in the BDL rats at the 4th week after surgery (×200). The right pictures are higher magnification of boxed area in left pictures. (B) Quantification of bile duct-like structure in liver sections from the sham and BDL rats. (C) qPCR analysis showed that the mRNA expression of CK-7 and proliferating cell nuclear antigen (PCNA) were significantly increased in BDL rats compared to the sham rats. (D) The level of serum total bilirubin (BR) was significantly increased in BDL rats compared to sham rats at the 4th week after BDL surgery. n = 4–6 per group. (E) There was no significant difference for the body weight between sham and BDL rats (n = 12 per group) (**P < 0.01 versus sham group and analyzed by Student’s t-test or two-way ANOVA followed by Bonferroni’s test).

5-HT-evoked itch behavior was significantly enhanced in BDL rats

Previous report by Belghiti M et al. demonstrated spontaneous scratching behavior was significantly increased in BDL rats24, suggesting BDL rat may be a suitable model for exploring the mechanisms underlying cholestatic itch. Aimed to replicate this cholestatic itch model in rats, we carefully observed and quantified the spontaneous behaviors after BDL surgery, such as scratching, grooming, and biting behaviors, which may reflect chronic itch in rats24. Surprisingly, none of aforementioned itch-related behaviors showed significant difference between the sham and BDL rats (Fig. 2A). This discrepancy may be attributed to the different rat stains employed: we used SD rats while Belghiti M et al. used Wistar rats. Our results argued lack of BDL-associated spontaneous itch in SD rats. To further determine whether chemical-evoked itch sensation was changed in BDL rats, we next investigated whether 5-HT-evoked itch was affected in BDL rats. After BDL surgery 15 to 30 days, scratching induced by intradermal (i.d.) injection of 5-HT into the nape of the neck was significant enhanced (Fig. 2B; F(1,22) = 45.76; P < 0.0001) in BDL rats. In order to distinguish itch and pain behaviors in rats, we used the cheek model by i.d. injection of chemicals into cheek of rats, which demonstrated that painful stimuli elicit forelimb wiping, while itchy stimuli elicit hindlimb scratching72. After BDL surgery 10 to 30 days, scratching induced by i.d. injection of 5-HT into the cheek was significant enhanced (Fig. 2C; F(1,43) = 34.88; P < 0.0001) in BDL rats. In contrast, there was no significant difference for the wiping behavior induced by 5-HT in cheek model between the sham and BDL rats (Fig. 2C; F(1,43) = 1.775, P = 0.1898).
Figure 2

5-HT-induced itch was enhanced in BDL rats compared to sham control.

(A) Spontaneous itch-related behaviors, such as scratching, grooming, and biting, were not changed in BDL rats compared to sham group (n = 6 per group). (B) The scratching behavior induced by i.d. injection of 5-HT (200 μg) into the nape of the neck of rats was significantly increased in BDL rats compared to sham group (n = 6 per group). (C) The scratching behavior, but not wiping behavior, induced by i.d. injection of 5-HT (200 μg) into the cheek of rats was significantly increased in BDL rats compared to sham group (n = 6 per group) (*P < 0.05, **P < 0.01, ***P < 0.001 versus sham values and analyzed by two-way ANOVA followed by Bonferroni’s test).

Antinociception responding to mechanical and heat stimuli was induced in BDL rats

We next asked whether pain sensation was affected in BDL rats. After BDL surgery 6 to 30 days, the mechanical sensitivity, evaluated by von Frey test, was significantly lower in BDL rats than that in sham rats (Fig. 3A; 4g: F(1,125) = 39.40, P <  0.0001; 15 g: F(1,125) = 44.21, P < 0.0001; 26 g: F(1,126) = 19.52, P < 0.0001). The heat sensitivity was determined by Hargreaves test and tail-flick test. The results showed the paw thermal withdrawal latency to radiated heat was significantly increased from 2 to 30 days following BDL surgery in rats (Fig. 3B; F (1,104) = 60.80, P < 0.0001). Tail-flick latency to 52 °C hot water was also significantly prolonged in BDL rats (Fig. 3C; F (1,200) = 350.2, P < 0.0001). After BDL 30 days, there was no significant difference for the falling latency evaluated by Rota-rod test between sham and BDL rats (Fig. 3D), suggesting that pain or itch phenotypes in BDL rats may not be attributed to the motor coordination dysfunction.
Figure 3

Antinociception responding to heat and mechanical stimuli was induced in BDL rats.

(A) We used von Frey filament (4 g, 15 g and 26 g) to evaluate mechanical sensitivity in sham and BDL rats. Compared to sham rats, BDL rats showed reduced mechanical sensitivity 6 to 30 days after BDL surgery (n = 8–12 per group). (B) The Hargreaves test showed that paw withdrawal thermal latency was significantly increased in the BDL rats compared to sham control 6 to 30 days after BDL surgery (n = 6–8 per group). (C) The tail-immersion test showed that latency of tail-flick in response to 52 °C hot water was significantly increased in the BDL rats compared to sham group 3 to 30 days after BDL surgery (n = 8 per group). (D) There was no significant difference for the duration to fall from the rod between sham and BDL rats (n = 8 per group) (*P < 0.05, **P < 0.01, ***P < 0.001 versus sham values and analyzed by Student’s t-test or two-way ANOVA followed by Bonferroni’s test).

Figure 4

The 5-HT level in the skin and the spinal cord significantly increased in BDL rats.

(A) Representative photomicrographs showing the immunostaining of 5-HT in spinal cord dorsal horn of the sham and BDL rats 15 days after BDL surgery. Scale bar: 100 μm. (B) The quantitative analysis showed that the 5-HT-positive immunofluoresence density significantly increased in spinal cord BDL rats compared to sham rats 15 days after BDL surgery (n = 4 per group). (C) HPLC analysis showed that 5-HT level in the skin and the spinal cord significantly increased in BDL rats compared to sham rats 15 days after BDL surgery (n = 5 per group). (D) qPCR analysis showed the mRNA expression of tryptophan hydroxylase 1 (Tph1) in the skin and tryptophan hydroxylase 1 (Tph2) in the brain stem, the rate-limiting enzymes for 5-HT synthesis, were up-regulated in BDL rats compared to sham rats. (*P < 0.05, ***P < 0.001 versus sham values and analyzed by Student’s t-test).

The levels of 5-HT in the skin and spinal cord were increased in BDL rats

We subsequently evaluated the changes of 5-HT level in the skin and the lumbar spinal cord in sham and BDL rats by using immunofluorescence and high-performance liquid chromatography (HPLC) analysis. The immunostaning of 5-HT in the spinal cord dorsal horn was increased in BDL rats compared to sham rats (Fig. 4A,B; t14 = 5.707, P < 0.0001). As shown in Fig. 4, HPLC analysis also confirmed that 5-HT level in the skin (t7 = 2.435, P = 0.0451) and the spinal cord (t6 = 2.594, P = 0.0410) significantly increased in BDL rats (Fig. 4C). To determine the origin of increased 5-HT levels in the skin and spinal cord, we further used qPCR to examine the mRNA expression of tryptophan hydroxylase 1 (Tph1) in the skin and tryptophan hydroxylase 1 (Tph2) in the brain stem, the rate-limiting enzymes for 5-HT synthesis26. The results showed that the expression of both Tph1 in the skin and Tph2 in the brain stem were up-regulated in BDL rats (Fig. 4D). Thus, the results suggested that increased 5-HT level in the skin and the spinal cord, possible due to the up-regulated 5-HT synthesis, may actively participate in itch and antinociception under cholestasis condition.

The expression profile of 5-HT receptor subtypes changed in peripheral and central nervous system (CNS)

We next used qPCR to examine the expression profile changes of 5-HT receptor subtypes in peripheral and central nervous system (especially spinal cord and brain stem). The results demonstrated that mRNA expression of multiple 5-HT receptors, including 5-HT1B, 5-HT1D, 5-HT2A, 5-HT2C, 5-HT3A, 5-HT5A, 5-HT5B, 5-HT6, and 5-HT7, were up-regulated in dorsal root ganglia (DRG) from BDL rats compared to sham rats (Fig. 5A). The results also demonstrated that mRNA expression of multiple 5-HT receptors, including 5-HT1B, 5-HT1D, 5-HT1F, 5-HT2A, 5-HT2B, 5-HT3A, 5-HT5B, 5-HT6, and 5-HT7, were up-regulated in trigeminal ganglia (TG) from BDL rats compared to sham rats (Fig. 5B). In sharp contrast, the mRNA expression of multiple 5-HT receptors, including 5-HT1A, 5-HT1F, 5-HT2B, and 5-HT3A, were down-regulated in the spinal cord from BDL rats compared to sham rats (Fig. 5C). Similarly, the mRNA expression of multiple 5-HT receptors, including 5-HT1A, 5-HT1F, 5-HT2B, 5-HT2C, and 5-HT3A, were down-regulated in the brain stem (especially cervicomedullary junction) from BDL rats compared to sham rats (Fig. 5D). Thus, these results suggested up-regulation of 5-HT receptors in primary sensory neurons in DRG or TG and down-regulation of 5-HT receptors in the spinal cord or brainstem may contribute to the enhanced itch behavior and antinociception in BDL rats. We subsequently performed pharmacological experiments to investigate the possible roles of four 5-HT receptors subtypes, including 5-HT1A, 5-HT2, 5-HT3 and 5-HT7, in itch and antinociception in BDL rats.
Figure 5

Q-PCR analysis revealed the expression profile of 5-HT receptor subtypes in peripheral and central nervous system (CNS) in sham and BDL rats.

Real-time quantitative PCR (qPCR) analysis showed that mRNA expression changes of different 5-HT receptors subtypes in dorsal root ganglia (A), trigeminal ganglia (B), spinal cord (C), and brainstem (D). Notably, multiple 5-HT receptors were up-regulated in dorsal root ganglia or trigeminal ganglia from BDL rats, including 5-HT1B, 5-HT1D, 5-HT1F, 5-HT2A, 5-HT2C, 5-HT3A, 5-HT5A, 5-HT5B, 5-HT6, and 5-HT7. In contrast, several 5-HT receptors were down-regulated in the spinal cord or brainstem from BDL rats, including 5-HT1A, 5-HT1F, 5-HT2B, 5-HT2C and 5-HT3A. (n = 6 per group) (*P < 0.05; **P < 0.01, ***P < 0.001 versus sham values and analyzed by Student’s t-test).

Peripheral 5-HT receptors, especially 5-HT2, 5-HT3 and 5-HT7, contributed to enhanced itch response in BDL rats

We tried to identify which subtypes of 5-HT receptors in the periphery are involved in the enhanced itch behavior in BDL rats through i.d. injection of 5-HT receptors agonists into rat cheek. We found that i.d. injection of 5-HT1A receptor agonist 8-hydroxy-2-(dipropylamino) tetralin hydrobromide (DPAT; 100 μg) failed to induce scratching behavior in both sham and BDL rats (Fig. 6A). In contrast, i.d. injection of 5-HT2 receptor agonist α-methylserotonin maleate salt (α-methyl-5-HT; 100 μg) was able to induce scratching behavior in both sham and BDL rats (Fig. 6B; for sham: t11 = 12.43; P < 0.0001; for BDL: t12 = 46.09; P < 0.0001). Interestingly, i.d. injection of 5-HT3 receptor agonist 2-Methyl-5-hydroxytryptamine hydrochloride (2-Methyl-5-HT; 100 μg) could only induce scratching response in BDL rats, but not in sham rats (Fig. 6C; for sham: t12 = 1.156; P = 0.2702; for BDL: t11 = 5.216; P = 0.0003). Finally, i.d. injection of 5-HT7 receptor agonist 4-[2-(Methylthio)phenyl]-N-(1,2,3,4-tetrahydro-1-naphthalenyl)-1-piperazinehexanamide hydrochloride (LP44; 100 μg) was also able to induce scratching behavior in both sham and BDL rats (Fig. 6D; for sham: t9 = 11.93; P < 0.0001; for BDL: t8 = 11.52; P < 0.0001).
Figure 6

The effects of intradermal injection of 5-HT receptor agonists in sham and BDL rats.

(A–D) The scratching response was induced by intradermal (i.d.) injection of 5-HT1A receptor agonist DPAT (A) 100 μg, 5-HT2 receptor agonist α-methyl-5-HT (B) 100 μg, 5-HT3 receptor agonist 2-Methyl-5-HT (C) 100 μg, 5-HT7 receptor agonist LP44 (D) 100 μg into cheek of sham and BDL rats 15 days after BDL surgery (n = 6–8 per group). (E) No obvious scratching behavior induced by i.d. injection of DCA (1 to 200 μg into the cheek of naïve rats (n = 6–8 per group). (F) 15 minutes after i.d. injection of DCA (50 μg), the rats were given an i.d. injection 5-HT (20 μg) into the cheek. 5-HT-induced scratching behavior was significantly enhanced by DCA in naïve rats (n = 6–8 per group) (**P < 0.01, ***P < 0.001 vs. vehicle values and analyzed by Student’s t-test or one-way AVOVA following Bonferroni post hoc test).

As recent work showed that bile acid, such as deoxycholic acid (DCA) was able to induce itch behavior in mice via activation of TGR5 and TRPA1 in primary sensory neurons in DRG, suggesting bile acid may contribute to cholestatic itch1723. We also tried to investigate the possible itch-inducing effect of DCA in rats and the interaction of peripheral bile acid and 5-HT system. Unexpected, i.d. injection of DCA (1 to 200 μg) into cheek failed to induce scratching behavior in rats (Fig. 6E). Thus, although bile acid can induce itch in mice1723, our results clearly showed that bile acid was not able to induce scratching in rats, suggesting species difference for bile acid-induced itch. Interestingly, co-administration of DCA was able to enhance 5-HT-induced scratching in rats (Fig. 6E; t9 = 3.999; P = 0.0031), suggesting DCA may potentiate 5-HT-induced itch in rats.

Increasing level of 5-HT in the central nervous system (CNS) inhibited itch and induced antinociception in sham and BDL rats

After we demonstrated the role of peripheral 5-HT and 5-HT receptors in itch, we subsequently investigate the role of 5-HT in the CNS for modulating itch and antinociception in sham and BDL rats. Firstly, we found that intrathecal (i.t.) injection of 5-HT (1 μg) could significantly inhibit i.d. injection of 5-HT (200 μg)-induced scratching in both sham and BDL rats (Fig. 7A; for sham: t12 = 6.854; P < 0.0001; for BDL: t9 = 4.003; P = 0.0031). Additionally, i.t. injection of 5-HT could significantly increase the tail-flick latency response to 52 °C hot water in naïve rats (Fig. 7B; F(1,48) = 41.96, P < 0.0001). We also found that intraperitoneal (i.p.) injection of 5-HT re-uptake inhibitor fluoxetine (10 mg/kg) could significantly suppressed 5-HT-induced scratching in sham and BDL rats (Fig. 7C; for sham: t8 = 6.442; P = 0.0002; for BDL: t10 = 14.62; P < 0.0001). Finally, i.p. injection of fluoxetine also significantly increased the tail-flick latency response to 52 °C hot water in sham and BDL rats (Fig. 7D; for sham: F(1,80) = 163.6, P < 0.0001; for BDL: F(1,100) = 167.2, P < 0.0001). Thus, increasing 5-HT level in CNS suppressed itch and induced antinociception in sham and BDL rats.
Figure 7

Enhanced 5-HT level in CNS inhibited itch and induced antinociception in sham and BDL rats.

(A) Intrathecal (i.t.) injection of 5-HT (1 μg) significantly suppressed scratching induced by i.d. injection of 5-HT (200 μg) into the nape of the neck in sham and BDL rats (n = 5–9 per group). (B) I.t. injection of 5-HT (1 μg) increased the latency of tail-flick response to 52 °C hot water in naïve rats (n = 6–8 per group). (C) Intraperitoneal (i.p.) injection of 5-HT reuptake inhibitor fluoxetine (10 mg/kg) significantly suppressed scratching induced by i.d. injection of 5-HT (200 μg) into the cheek of sham and BDL rats (n = 6–8 for each group) (**P < 0.01, ***P < 0.001 vs. saline values and analyzed by Student’s t-test or two-way AVOVA following Bonferroni post hoc test). (D) I.p. injection of 5-HT reuptake inhibitor fluoxetine (10 mg/kg) significantly increased the latency of tail-flick response to 52 °C hot water in sham and BDL rats in a time-dependent manner (n = 6–8 per group) (*P < 0.05; **P < 0.01, ***P < 0.001 vs. saline values from sham rats; ##P < 0.01, ###P < 0.001 vs. saline values from BDL rats and analyzed by two-way AVOVA following Bonferroni post hoc test).

Itch could be modulated by 5-HT receptors agonists or antagonists in sham and BDL rats

In order to reveal the distinct roles of 5-HT receptor subtypes on itch response in sham and BDL rats, 5-HT receptors agonists or antagonists were administrated after BDL surgery 15 days. It was found that i.t. injection of 5-HT1A receptor agonist DPAT (Fig. 8A; for sham: t10 = 5.799; P = 0.0002; for BDL: t14 = 5.102; P = 0.0002), 5-HT2 receptor agonist α-methyl-5-HT (Fig. 8B; for sham: t10 = 8.398; P < 0.0001; for BDL: t11 = 11.18; P < 0.0001), 5-HT3 receptor agonist 2-Methyl-5-HT (Fig. 8C; for sham: t8 = 9.602; P < 0.0001; for BDL: t9 = 2.433; P = 0.00378), and 5-HT7 receptor agonist LP44 (Fig. 8D; for sham: t9 = 4.746; P = 0.0010; for BDL: t8 = 6.597; P = 0.0002), suppressed 5-HT-induced scratching in both sham and BDL rats. Thus, these results suggested over-activation of 5-HT receptors subtypes 5-HT1A, 5-HT2, 5-HT3, and 5-HT7 might suppress itch in sham and BDL rats.
Figure 8

The effects of 5-HT receptors agonists or antagonists on 5-HT-induced scratching behavior in sham and BDL rats.

(A–D) Scratching behavior induced by i.d. injection of 5-HT (200 μg) into the nape of the neck was significantly suppressed by intrathecal (i.t.) injection of 5-HT1A receptor agonist DPAT (A) 10 μg, 5-HT2 receptor agonist α-methyl-5-HT (B) 10 μg, 5-HT3 receptor agonist 2-Methyl-5-HT (C) 10 μg, 5-HT7 receptor agonist LP44 (D) 10 μg in sham and BDL rats (n = 6–8 per group). (E) Intrathecal (i.t.) injection of 5-HT1A receptor antagonist WAY-100635 (10 μg) increased 5-HT-induced scratching in sham rats, but suppressed that in BDL rats (n = 6–8 per group). (F) Intraperitoneal (i.p.) injection of 5-HT2 receptor antagonists ketanserin (1 mg/kg) could suppress 5-HT-induced scratching in both sham and BDL rats (n = 6–8 per group). (G) Intraperitoneal (i.p.) injection of 5-HT3 receptor antagonists ondansetron (3 mg/kg) can suppress 5-HT-induced scratching in BDL rats, but not sham rats (n = 6–8 per group). (H) Intrathecal (i.t.) injection of 5-HT7 receptor antagonist SB269970 (10 μg) could suppress 5-HT-induced scratching in both sham and BDL rats (n = 6–8 per group) (*P < 0.05, **P < 0.01, ***P < 0.001 vs. vehicle values and analyzed by Student’s t-test).

We next assessed the effects of intrathecal (i.t.) or intraperitoneal (i.p.) injection of 5-HT receptors antagonists on itch in sham and BDL rats after BDL surgery 15 days. The results showed that i.t. injection of 5-HT1A receptor antagonist WAY-100635 increased 5-HT-induced scratching in sham rats (Fig. 8E; t12 = 3.328; P = 0.0060), but suppressed that in BDL rats (Fig. 8E; t10 = 5.101; P = 0.0005). It was found that i.p. application of 5-HT2 receptor antagonist ketanserin significantly inhibited 5-HT-induced scratching in both sham and BDL rats (Fig. 8F; for sham: t8 = 9.300; P < 0.0001; for BDL: t10 = 9.926; P < 0.0001). Interestingly, i.p. application of 5-HT3 receptor antagonist ondansetron hydrochloride failed to inhibit 5-HT-induced itch in sham rats (Fig. 8G; t7 = 1.011; P = 0.3456, but significantly inhibited that in BDL rats (Fig. 8G; t9 = 9.498; P < 0.0001). Finally, i.t. injection of 5-HT7 receptor antagonist SB269970 significantly inhibited 5-HT-induced scratching in both sham and BDL rats (Fig. 8H; for sham: t9 = 15.33; P < 0.0001; for BDL: t8 =9.374; P < 0.0001). Thus, these data suggested antagonism of 5-HT receptor subtypes 5-HT1A, 5-HT2, 5-HT3, and 5-HT7, might suppress itch response under cholestasis condition. It also suggested antagonism of 5-HT1A might increase 5-HT-induced itch, however, antagonism of 5-HT2 and 5-HT7 might suppress itch under physiological condition.

Antinociception could be modulated by 5-HT receptors agonists or antagonists in sham and BDL rats

In order to reveal the possible roles of 5-HT receptor subtypes on antinociception in sham and BDL rats, 5-HT receptors agonists or antagonists were administrated after BDL surgery 15 days. It was found that i.t. injection of 5-HT1A receptor agonist DPAT (Fig. 9A; F(1,72) = 82.89, P < 0.0001), 5-HT2 receptor agonist α-methyl-5-HT (Fig. 9B; F(1,60) = 12.15, P = 0.0009), 5-HT3 receptor agonist 2-Methyl-5-HT (Fig. 9C; F (1,60) = 41.07, P < 0.0001), but not 5-HT7 receptor agonist LP44 (Fig. 9D; F(1,48) = 3.308, P = 0.0752), reduced the latency of tail-flick in response to 52 °C hot water in BDL rats. In contrast, as shown in Fig. 9A–D, only 5-HT2 receptor agonist α-methyl-5-HT significantly reduced the latency of tail-flick in response to 52 °C hot water (F(1, 55) = 8.913, P = 0.0042) in sham rats,, but 5-HT1A receptor agonist DPAT (F(1,96) = 0.6788, P = 0.4120), 5-HT3 receptor agonist 2-Methyl-5-HT (F(1,55) = 0.8980, P = 0.3475), and 5-HT7 receptor agonist LP44 (F(1,54) = 0.3522, P = 0.5553) had no effects. Thus, it was suggested that over-activation of 5-HT receptors 5-HT1A, 5-HT2, and 5-HT3 might attenuate antinociception in BDL rats.
Figure 9

The effects of 5-HT receptors agonists or antagonists on antinociception in sham and BDL rats.

(A) I.t. injection of 5-HT1A receptor agonist DPAT decreased the latency of tail-flick response to 52 °C hot water in BDL rats, but not sham rats (n = 6–8 per group). (B) I.t. injection of 5-HT2 receptor agonist α-methyl-5-HT decreased the latency of tail-flick response to 52 °C hot water in sham and BDL rats (n = 6–8 per group). (C) I.t. injection of 5-HT3 receptor agonist 2-Methyl-5-HT decreased the latency of tail-flick response to 52 °C hot water in BDL rats, but not sham rats (n = 6–8 per group). (D) I.t. injection of 5-HT7 receptor agonist LP44 failed to change the latency of tail-flick response to 52 °C hot water in sham and BDL rats (n = 6–8 per group). (E) I.t. injection of 5-HT1A receptor antagonist WAY-100635 significantly increased the latency of tail-flick in response to 52 °C hot water in sham and BDL rats (n = 6–8 per group). (F) I.p. application of 5-HT2 receptor antagonist ketanserin significantly reduced the latency of tail-flick in response to 52 °C hot water in BDL rats, but not sham rats (n = 6–8 per group). (G) I.p. application of 5-HT3A receptor antagonist ondansetron significantly reduced the latency of tail-flick in response to 52 °C hot water in BDL rats, but not sham rats (n = 6–8 per group). (H) I.t. injection of 5-HT7 receptor antagonist SB269970 failed to change the latency of tail-flick in response to 52 °C hot water in sham and BDL rats (n = 6–8 per group) (*P < 0.05; **P < 0.01, ***P < 0.001 vs. saline values from sham rats; ##P < 0.01, ###P < 0.001 vs. saline values from BDL rats and analyzed by two-way AVOVA following Bonferroni post hoc test).

We next assessed the effects of intrathecal (i.t.) or intraperitoneal (i.p.) injection of 5-HT receptors antagonists on antinociception in sham and BDL rats after BDL surgery 15 days. The results showed that i.t. injection of 5-HT1A receptor antagonist WAY-100635 significantly increased the latency of tail-flick in response to 52 °C hot water in sham and BDL rats (Fig. 9E; for sham: F(1,72) = 95.79, P < 0.0001; for BDL: F(1, 60) = 7.657, P = 0.0075). Interestingly, i.p. application of 5-HT2 receptor antagonist ketanserin (Fig. 9F) and 5-HT3A receptor antagonist ondansetron (Fig. 9G;) significantly reduced the latency of tail-flick in response to 52 °C hot water in BDL rats (for ketanserin: F(1,60) = 42.43, P < 0.0001; for ondansetron: F(1, 50) = 24.14, P < 0.0001), but not in sham rats (for ketanserin: F(1, 48) = 3.409, P = 0.0710; for ondansetron: F(1, 40) = 0.8852, P = 0.3524). Finally, i.t. injection of 5-HT7 receptor antagonist SB269970 failed to change the latency of tail-flick in response to 52 °C hot water in sham and BDL rats (Fig. 9H; for sham: F(1,48) = 0.01346, P = 0.9081; for BDL: F(1,60) = 1.261, P = 0.2660). Thus, it was suggested that antagonism of 5-HT1A might produce antinociception in sham and BDL rats, while antagonism of 5-HT2 and 5-HT3 might attenuate antinociception in BDL rats. Additionally, i.t. injection of 5-HT7 receptor antagonist SB269970 had little effects on antinociception in sham and BDL rats.

Discussion

Several clinical observation showed that administration of 5-HT3 receptor antagonist ondansetron3435363738 or selective serotonin reuptake inhibitor (SSRI) sertraline3940 were able to alleviate cholestatic pruritus, providing important clues to support key role of 5-HT system in cholestatic pruritus. Unfortunately, little is known of the modulatory effects of peripheral and central 5-HT system, especially 5-HT receptor subtypes, on cholestatic pruritus and antinociception so far7374. Based on the important and complex roles of 5-HT system in the regulation of pain and itch75, the present study investigated the roles of peripheral and central 5-HT system in itch and antinociception in BDL rats, which is a severe model of obstructive cholestasis42. Our results revealed that peripheral and central 5-HT system played important roles in modulation of itch and antinociception in BDL rats. Although no obvious spontaneous scratching was observed in BDL rats, we found an enhanced scratching response was induced by i.d. injection of 5-HT in BDL rats, suggesting itch hypersensitivity in BDL rats. We further showed that the 5-HT level in the skin and spinal cord significantly increased, possible due to the increased 5-HT synthesis, in BDL rats compared to sham rats. In BDL rats, several 5-HT receptor subtypes were up-regulated in the DRG or TG, including 5-HT1B, 5-HT1D, 5-HT2A, 5-HT3, 5-HT5B, 5-HT6, and 5-HT7. In sharp contrast, multiple 5-HT receptor subtypes were down-regulated in the spinal cord or brainstem in BDL rats, including 5-HT1A, 5-HT1F, 5-HT2B, and 5-HT3. Pharmacological activation of 5-HT2A, 5-HT3, and 5-HT7 induced itch in BDL rats. Administration of 5-HT1A, 5-HT2A, 5-HT3, and 5-HT7 agonists or antagonists differentially influenced the itch and antinociception in sham and BDL rats. Thus, these results suggested 5-HT system dynamically participated in itch and antinociception under cholestasis condition and distinct 5-HT receptor subtypes might be involved in these processes. There are several animal models to mimic cholestasis-induced itch and antinociception, including BDL in rats2024 or mice21, administration of α-naphthylisothiocyanate (ANIT) or 17α-ethynylestradiol in rats76 or mice77. Interestingly, we noticed that spontaneous scratching behavior was observed in BDL rats24 and in 17α-ethynylestradiol-treated rats76; However, impaired itch perception was also demonstrated in ANIT or 17α-ethynylestradiol-treated mice77. In the current study, we employed BDL rat model to investigate itch and antinociception associated with severe obstructive cholestasis. We carefully quantified the spontaneous itch-related behaviors, such as scratching, grooming, and biting behaviors after BDL surgery in SD rats24. Surprisingly, we found itch-related behaviors were not significantly increased in BDL rats compared to sham rats. We postulated the discrepancy for spontaneous itch in BDL rats may be attributed to the different rat stains employed: SD rats versus Wistar rats. Although lack of spontaneous scratching behavior in BDL rats, we observed an enhanced scratching induced by intradermal injection of 5-HT in BDL rats, suggesting evoked itch was potentiated in cholestatic rats. Thus, species difference among mice, rats and human and the etiology of cholestasis may explain the distinct itch phenotype under cholestasis condition. After BDL surgery, rats developed antinociception responding to mechanical or heat stimuli, which were consistent with others’ reports204278. In addition, the motor performance of BDL rat was intact evaluated by Rota-rod test, suggesting that itch and antinociception phenotypes of BDL rats may not be attributed to motor dysfunction. Patients with cholestatic pruritus also showed increased number of dermal mast cells, which release histamine, 5-HT and proteases24. Our immunostaining data and HPLC analysis provided evidence that 5-HT level in the skin and the spinal cord significantly increased in BDL rats compared to sham rats. We further found the mRNA expression of Tph1 and Tph2, the rate-limiting enzymes for 5-HT synthesis in the skin and in the brain stem, respectively26, were up-regulated in BDL rats. Thus, it suggested that increased 5-HT level may be attributed to enhanced 5-HT synthesis. Because histamine seems to play little role in cholestasis pruritus79, our data suggested 5-HT, possible from mast cells, may serve as potential itch mediator under cholestatais condition. We subsequently demonstrated that intradermal injection 5-HT2A, 5-HT3 or 5-HT7 receptor agonists induced scratching in BDL rats, whereas only 5-HT2A, or 5-HT7 receptor agonists induced scratching in the sham rats, suggesting 5-HT3 receptor is involved in pathological cholestatic itch but not physiological itch. Our results also demonstrated application of 5-HT3 receptor antagonist ondansetron attenuated itch in BDL rats but not in sham rats. It was consistent with the clinical observation that 5-HT3 receptor antagonist ondansetron alleviated cholestatic pruritus34. We further showed that DCA was not able to induce scratching behavior in rats, although it induced itch in mice1723, suggesting the species difference between rat and mouse existed for bile acid-induced itch. Interestingly, our results showed that BDL rats did not scratch spontaneously but exerted enhanced scratch induced by 5-HT. These data was consistent with the observation that DCA did not evoke scratch in rats, but potentiated 5-HT-induced scratch in rats. Together, these data suggested 5-HT, possible not bile acids, may serve as a potential pruritogen in rats under cholestasis condition. Both increased 5-HT level in skin and increased expression of 5-HT2A, 5-HT3 or 5-HT7 receptors in peripheral nervous system contributed to itch hypersensitivity under cholestasis condition. However, the roles of other 5-HT receptors subtypes, such as 5-HT1D, 5-HT5B, and 5-HT6, on cholestatic itch remain unclear and warrant further investigation. As we demonstrated 5-HT-induced itch was enhanced in BDL rats, we subsequently investigated the dynamic expression changes of 5-HT receptors subtypes in peripheral and central nervous systems by using qPCR analysis under cholestasis condition. The results demonstrated that mRNA expression of multiple 5-HT receptors, including 5-HT1B, 5-HT1D, 5-HT2A, 5-HT3A, 5-HT5B, 5-HT6, and 5-HT7, were up-regulated in DRG or TG from BDL rats compared to sham rats. In sharp contrast, the mRNA expression of multiple 5-HT receptors, including 5-HT1A, 5-HT1F, 5-HT2B, and 5-HT3A, were down-regulated in spinal cord or brainstem (especially cervicomedullary junction) from BDL rats compared to that from sham rats. As we showed increased 5-HT level in CNS could suppress 5-HT-induced scratch in sham and BDL rats, the down-regulation of 5-HT receptors may produce dis-inhibition to contribute to the enhanced itch in BDL rats. Thus, these results suggested up-regulation of certain 5-HT receptors in primary sensory neurons and down-regulation of certain 5-HT receptors in central nervous system may contribute to the enhanced itch behavior in BDL rats. It is unclear for the precise causes to drive the expression changes of 5-HT receptors in BDL rats. As 5-HT is not able to penetrate blood-brain-barrier (BBB), peripheral and central 5-HT systems are considered as two separated compartments25 and the synthesis of 5-HT also employs distinct TPH, a rate-limiting enzymes for 5-HT synthesis. To investigate the possible role of central 5-HT in cholestatic itch, we performed i.t. injection 5-HT or i.p. injection of selective serotonin reuptake inhibitor (SSRI) fluoxetine in the sham and BDL rats. It was found that 5-HT (i.t.) or fluoxetine (i.p.) significantly suppressed 5-HT-induced scratching in sham and BDL rats, suggesting increased 5-HT level in CNS is sufficient to suppress itch in sham and BDL rats. We further used pharmacological 5-HT receptor agonists to reveal the distinct role of certain 5-HT receptor subtypes that involved in. Our results showed that intrathecal injection of 5-HT1A, 5-HT2A, 5-HT3 or 5-HT7 receptors agonists suppressed 5-HT-induced scratching in sham and BDL rats, which was consistent with previous report80. Thus, the results suggested application 5-HT or 5-HT receptor agonists, including 5-HT1A, 5-HT2A, 5-HT3 or 5-HT7, inhibited itch sensation possible through over-activation of these 5-HT receptors subtypes in the spinal cord. We next examined whether increased endogenous 5-HT level in spinal cord contributed to itch hypersensitivity in BDL rats by using selective 5-HT receptor antagonists. Our results showed that antagonism of 5-HT1A, 5-HT2A, 5-HT3 or 5-HT7, inhibited itch sensation in BDL rats, suggested increased endogenous 5-HT in spinal cord of BDL rats might play an itch-facilitating effect through 5-HT1A, 5-HT2A, 5-HT3 or 5-HT7. In sham control rats, antagonism of 5-HT1A increased, while antagonism of 5-HT2A, or 5-HT7 inhibited itch. Meanwhile, antagonism of 5-HT3 had little effect on itch in sham rats. Thus, it was suggested tonic activation of spinal 5-HT1A might play a suppressive effect, while activation of 5-HT2A and 5-HT7 might play a facilitating effect on itch transmission in physiological condition. What is the role of spinal 5-HT1A in regulating cholestatic pruritus? Our results showed 5-HT1A antagonist exerted itch-enhancing effect in sham rats but alleviated itch in BDL rats. Previous study demonstrated that descending serotonergic system from brainstem facilitated gastrin-releasing peptide (GRP)-GRP receptor (GRPR) signaling via spinal 5-HT1A for mediating itch transmision. In sharp contrast, activation of 5-HT1A hyperpolarizes spinal neurons without GRPR to dampen neuronal excitability, suggesting opposing modulation of descending serotonergic system on itch and pain. The dual actions of 5-HT mediated by 5-HT1A suggested neuronal phenotypes (excitatory versus inhibitory) that expresses this receptor might play a key role in determining which actions 5-HT would finally exert on itch neurotransmission. Whether the down-regulation of 5-HT1A, possible other subtypes 5-HT1F, 5-HT2B and 5-HT3A, in spinal cord contributes to itch hypersensitivity in BDL rats warrants further study. To investigate the possible role of spinal 5-HT in cholestasis-associated antinociception, we performed i.t. injection of 5-HT or i.p. injection of selective serotonin reuptake inhibitor (SSRI) fluoxetine in the sham and BDL rats. 5-HT (i.t.) or fluoxetine (i.p.) significantly increased the heat pain threshold in sham and BDL rats, suggesting increased 5-HT level in spinal cord might be sufficient to induced antinociception in sham and BDL rats, which was consistent with previous report81. We next used selective 5-HT receptors agonist to investigate the distinct role of certain 5-HT receptor subtypes that involved in. Our results showed that i.t. injection of 5-HT1A, 5-HT2A, and 5-HT3, but not 5-HT7 receptor agonists suppressed antinociception in BDL rats. Thus, the results suggested over-activation of 5-HT1A, 5-HT2A, and 5-HT3 attenuated antinociception under cholestasis condition. We next examined whether increased endogenous 5-HT level in spinal cord contributed to antinociception in BDL rats by using selective 5-HT receptors antagonists. Our results showed that antagonism of 5-HT2A and 5-HT3 inhibited antinociception in BDL rats, suggesting increased endogenous 5-HT in spinal cord of BDL rats exert antinociception possible through 5-HT2A and 5-HT3. Antagonism of 5-HT1A increased heat pain threshold in both sham and BDL rats, suggesting activation spinal 5-HT1A might play a pronociceptive role in sham and BDL rats. Additionally, agonism or antagonism of 5-HT7 had little effect on antinociception in sham and BDL rats. The limitation of our pharmacological study is the lack of dose-response curves for different 5-HT receptor agonists or antagonists. Thus, our results suggested activation of spinal 5-HT1A might play a pronociceptive role, while activation of 5-HT2A and 5-HT3 might play an antinociceptive role in BDL rats. Previous reports have proposed the endogenous opioidergic system involved in itch and antinociception under cholestasis condition75. Our results suggested serotonergic system was also important for modulating cholestasis-induced itch and antinociception. Endogenous opioids-induced analgesic effects partially mediated by activation of descending serotonergic inhibitory pathways terminating on spinal cord dorsal horn31. 5-HT1A receptor acts as a regulator for 5-HT release, its down-regulation could increase 5-HT release82. Previous report demonstrated the expression of 5-HT1A was down-regulated in hippocampus of BDL mice82. Our results also showed the expression 5-HT1A was down-regulated in spinal cord and brainstem in BDL rats, which may also contribute to the increased release of 5-HT. In summary, our findings showed that itch hypersensitivity and antinociception developed in BDL rats. We found that 5-HT level increased in the skin and spinal cord in BDL rats. 5-HT receptors subtypes, including 5-HT1B, 5-HT1D, 5-HT2A, 5-HT3A, 5-HT5B, 5-HT6, and 5-HT7, were up-regulated in peripheral nervous system and 5-HT1A, 5-HT1F, 5-HT2B, and 5-HT3A were down-regulated in central nervous system. Peripheral activation of 5-HT2, 5-HT3, and 5-HT7 might contribute to cholestatic itch in rats. Agonism or antagonism of 5-HT receptors 5-HT1A, 5-HT2A, 5-HT3, and 5-HT7 might suppress cholestatic itch. Agonism or antagonism of 5-HT receptors 5-HT1A, 5-HT2A, and 5-HT3 differently modulate antinociception in BDL rats. Thus, targeting 5-HT system may provide an effective treatment for cholestatic pruritus and possible other comorbidities.

Additional Information

How to cite this article: Tian, B. et al. Peripheral and spinal 5-HT receptors participate in cholestatic itch and antinociception induced by bile duct ligation in rats. Sci. Rep. 6, 36286; doi: 10.1038/srep36286 (2016). Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
  82 in total

Review 1.  The pruritus of cholestasis.

Authors:  Nora V Bergasa
Journal:  J Hepatol       Date:  2005-10-06       Impact factor: 25.083

Review 2.  Ondansetron: a selective 5-HT(3) receptor antagonist and its applications in CNS-related disorders.

Authors:  J H Ye; R Ponnudurai; R Schaefer
Journal:  CNS Drug Rev       Date:  2001

Review 3.  Descending serotoninergic systems.

Authors:  J M Besson; A Chaouch
Journal:  Pain Headache       Date:  1987

4.  Synthesis and in vitro and in vivo functional studies of ortho-substituted phenylpiperazine and N-substituted 4-N-(o-methoxyphenyl)aminopiperidine analogues of WAY100635.

Authors:  M M Mensonides-Harsema; Y Liao; H Böttcher; G D Bartoszyk; H E Greiner; J Harting; P de Boer; H V Wikström
Journal:  J Med Chem       Date:  2000-02-10       Impact factor: 7.446

Review 5.  Peripheral mechanisms of itch.

Authors:  Benjamin McNeil; Xinzhong Dong
Journal:  Neurosci Bull       Date:  2012-04       Impact factor: 5.203

Review 6.  Pathogenesis and management of pruritus in cholestatic liver disease.

Authors:  Mohamad H Imam; Andrea A Gossard; Emmanouil Sinakos; Keith D Lindor
Journal:  J Gastroenterol Hepatol       Date:  2012-07       Impact factor: 4.029

7.  Structure-affinity relationship study on N-(1,2,3,4-tetrahydronaphthalen-1-yl)-4-aryl-1-piperazinealkylamides, a new class of 5-hydroxytryptamine7 receptor agents.

Authors:  Marcello Leopoldo; Francesco Berardi; Nicola A Colabufo; Marialessandra Contino; Enza Lacivita; Mauro Niso; Roberto Perrone; Vincenzo Tortorella
Journal:  J Med Chem       Date:  2004-12-16       Impact factor: 7.446

8.  The TGR5 receptor mediates bile acid-induced itch and analgesia.

Authors:  Farzad Alemi; Edwin Kwon; Daniel P Poole; TinaMarie Lieu; Victoria Lyo; Fiore Cattaruzza; Ferda Cevikbas; Martin Steinhoff; Romina Nassini; Serena Materazzi; Raquel Guerrero-Alba; Eduardo Valdez-Morales; Graeme S Cottrell; Kristina Schoonjans; Pierangelo Geppetti; Stephen J Vanner; Nigel W Bunnett; Carlos U Corvera
Journal:  J Clin Invest       Date:  2013-03-25       Impact factor: 14.808

9.  5-HT1 and 5-HT2 binding profiles of the serotonergic agents alpha-methylserotonin and 2-methylserotonin.

Authors:  A M Ismaiel; M Titeler; K J Miller; T S Smith; R A Glennon
Journal:  J Med Chem       Date:  1990-02       Impact factor: 7.446

10.  A new SiF-Dipropargyl glycerol scaffold as a versatile prosthetic group to design dimeric radioligands: synthesis of the [(18) F]BMPPSiF tracer to image serotonin receptors.

Authors:  Puja Panwar Hazari; Jurgen Schulz; Delphine Vimont; Nidhi Chadha; Michele Allard; Magali Szlosek-Pinaud; Eric Fouquet; Anil Kumar Mishra
Journal:  ChemMedChem       Date:  2013-12-27       Impact factor: 3.466

View more
  17 in total

1.  5-hydroxytryptamine 1F Receptor Agonist Induces Mitochondrial Biogenesis and Promotes Recovery from Spinal Cord Injury.

Authors:  Epiphani C Simmons; Natalie E Scholpa; Kristan H Cleveland; Rick G Schnellmann
Journal:  J Pharmacol Exp Ther       Date:  2019-11-27       Impact factor: 4.030

2.  Antipruritic Effects of Kappa Opioid Receptor Agonists: Evidence from Rodents to Humans.

Authors:  Saadet Inan; Alan Cowan
Journal:  Handb Exp Pharmacol       Date:  2022

Review 3.  Mitochondrial biogenesis as a therapeutic target for traumatic and neurodegenerative CNS diseases.

Authors:  Epiphani C Simmons; Natalie E Scholpa; Rick G Schnellmann
Journal:  Exp Neurol       Date:  2020-04-11       Impact factor: 5.330

Review 4.  Physiology and Pathophysiology of Itch.

Authors:  Ferda Cevikbas; Ethan A Lerner
Journal:  Physiol Rev       Date:  2019-12-23       Impact factor: 37.312

5.  A comparative study of serotonin and norepinephrine as adjuncts to improve cutaneous antinociception of mexiletine in response to skin pinpricks in rats.

Authors:  Mingming Han; Fang Kang; Chengwei Yang; Mingyu Zhai; Kesong Zheng; Ting Wang; Ziyou Liu; Juan Li
Journal:  Int J Immunopathol Pharmacol       Date:  2021 Jan-Dec       Impact factor: 3.219

6.  Adjunctive effect of the serotonin 5-HT2C receptor agonist lorcaserin on opioid-induced antinociception in mice.

Authors:  Salvador Sierra; Kumiko M Lippold; David L Stevens; Justin L Poklis; William L Dewey; Javier González-Maeso
Journal:  Neuropharmacology       Date:  2020-01-24       Impact factor: 5.273

7.  FDA-approved 5-HT1F receptor agonist lasmiditan induces mitochondrial biogenesis and enhances locomotor and blood-spinal cord barrier recovery after spinal cord injury.

Authors:  Epiphani C Simmons; Natalie E Scholpa; Rick G Schnellmann
Journal:  Exp Neurol       Date:  2021-04-10       Impact factor: 5.620

8.  Altered expression of differential gene and lncRNA in the lower thoracic spinal cord on different time courses of experimental obstructive jaundice model accompanied with altered peripheral nociception in rats.

Authors:  Qian Wang; Zhi-Xiao Li; Bao-Wen Liu; Zhi-Gang He; Cheng Liu; Min Chen; San-Guang Liu; Wei-Zhong Wu; Hong-Bing Xiang
Journal:  Oncotarget       Date:  2017-11-20

9.  Brain allopregnanolone induces marked scratching behaviour in diet-induced atopic dermatitis mouse model.

Authors:  Masanori Fujii; Sayaka Ohgami; Erika Asano; Takanori Nakayama; Takahiro Toda; Takeshi Nabe; Susumu Ohya
Journal:  Sci Rep       Date:  2019-02-20       Impact factor: 4.379

10.  Role of 5-HT1A and 5-HT3 receptors in serotonergic activation of sensory neurons in relation to itch and pain behavior in the rat.

Authors:  Dan Domocos; Tudor Selescu; Laura Cristina Ceafalan; Mirela Iodi Carstens; Earl Carstens; Alexandru Babes
Journal:  J Neurosci Res       Date:  2020-06-14       Impact factor: 4.433

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.