Erin A Bassett1, Nicholas Tokarew1,2, Ema A Allemano1, Chantal Mazerolle1, Katy Morin1, Alan J Mears1, Brian McNeill1, Randy Ringuette1,3, Charles Campbell1,3, Sheila Smiley1, Neno T Pokrajac4,5, Adrian M Dubuc4,6, Vijay Ramaswamy4,6,7,8, Paul A Northcott4,6, Marc Remke4,6, Philippe P Monnier9,10, David Potter11, Kim Paes11, Laura L Kirkpatrick11, Kenneth J Coker11, Dennis S Rice11, Carol Perez-Iratxeta1,3, Michael D Taylor4,6,7, Valerie A Wallace1,2,5,10. 1. Regenerative Medicine Program, Ottawa Hospital Research Institute, Ottawa, Canada. 2. Department of Biochemistry, Microbiology and Immunology, University of Ottawa, Ottawa, Canada. 3. Department of Cellular and Molecular Medicine, University of Ottawa, Ottawa, Canada. 4. Department of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, Canada. 5. Donald K. Johnson Eye Institute, Krembil Research Institute, University Health Network, Toronto, Canada. 6. Developmental and Stem Cell Biology Program, Arthur and Sonia Labatt Brain Tumor Research Centre, The Hospital for Sick Children, Toronto, Canada. 7. Division of Neurosurgery, Department of Surgery, University of Toronto, Toronto, Canada. 8. Division of Haematology/Oncology, The Hospital for Sick Children, Toronto, Canada. 9. Genetics and Development Division, Krembil Research Institute, University Health Network, Toronto, Canada. 10. Department of Ophthalmology and Vision Sciences, University of Toronto, Toronto, Canada. 11. Department of Ophthalmology, Lexicon Pharmaceuticals Inc., The Woodlands, United States.
Abstract
The tumor microenvironment is a critical modulator of carcinogenesis; however, in many tumor types, the influence of the stroma during preneoplastic stages is unknown. Here we explored the relationship between pre-tumor cells and their surrounding stroma in malignant progression of the cerebellar tumor medulloblastoma (MB). We show that activation of the vascular regulatory signalling axis mediated by Norrin (an atypical Wnt)/Frizzled4 (Fzd4) inhibits MB initiation in the Ptch+/- mouse model. Loss of Norrin/Fzd4-mediated signalling in endothelial cells, either genetically or by short-term blockade, increases the frequency of pre-tumor lesions and creates a tumor-permissive microenvironment at the earliest, preneoplastic stages of MB. This pro-tumor stroma, characterized by angiogenic remodelling, is associated with an accelerated transition from preneoplasia to malignancy. These data expose a stromal component that regulates the earliest stages of tumorigenesis in the cerebellum, and a novel role for the Norrin/Fzd4 axis as an endogenous anti-tumor signal in the preneoplastic niche.
The tumor microenvironment is a critical modulator of carcinogenesis; however, in many tumor types, the influence of the stroma during preneoplastic stages is unknown. Here we explored the relationship between pre-tumor cells and their surrounding stroma in malignant progression of the cerebellar tumor medulloblastoma (MB). We show that activation of the vascular regulatory signalling axis mediated by Norrin (an atypical Wnt)/Frizzled4 (Fzd4) inhibits MB initiation in the Ptch+/- mouse model. Loss of Norrin/Fzd4-mediated signalling in endothelial cells, either genetically or by short-term blockade, increases the frequency of pre-tumor lesions and creates a tumor-permissive microenvironment at the earliest, preneoplastic stages of MB. This pro-tumor stroma, characterized by angiogenic remodelling, is associated with an accelerated transition from preneoplasia to malignancy. These data expose a stromal component that regulates the earliest stages of tumorigenesis in the cerebellum, and a novel role for the Norrin/Fzd4 axis as an endogenous anti-tumor signal in the preneoplastic niche.
The tumor microenvironment is comprised of many stromal cell types, including the vasculature, which is well known to promote the growth and propagation of established tumors (Calabrese et al., 2007; Hambardzumyan et al., 2008; Hanahan and Coussens, 2012). It has also become increasingly clear that construction of a tumor-permissive stroma is a dynamic process influencing all stages of malignant progression, through the ongoing extracellular matrix (ECM) remodelling and recruitment or activation of angiogenic vascular cells, fibroblasts and immune cells (Hanahan and Coussens, 2012; Hanahan and Weinberg, 2011). While there is mounting evidence that a permissive niche is required during the earliest steps of tumor initiation, studying this early crosstalk requires adequate multistage models of carcinogenesis (Barcellos-Hoff et al., 2013). Medulloblastoma (MB), the most common malignant brain tumor in children, has become a paradigm for the study of pediatric tumors and primary brain tumors; however little is known about tumor/stromal communication in the early stages of MB. It is challenging to model these early events with humantumor biopsies or MB cell lines, as both represent late stage tumors and the latter frequently fail to maintain their in vivo characteristics (Sasai et al., 2006). An effective surrogate to test these interactions endogenously is the Ptchmouse (Goodrich et al., 1997), a model of the human predisposition to MB (Gorlin syndrome) that, along with a subset of sporadic MB, belong to the Sonic hedgehog (Shh) subgroup (Taylor et al., 2012). Ptchmice progress through well-defined stages of tumorigenesis in the cerebellum, beginning with the ectopic proliferation of granule neuron progenitor cells (GNPs), which form preneoplastic lesions on the cerebellar surface by two weeks of age. While most of these lesions regress, a minority undergo malignant transformation to MB (Kessler et al., 2009; Oliver et al., 2005). The environmental signals that co-operate with Ptchhaploinsufficiency to regulate lesion induction and transformation are poorly understood.Here, we modelled pre-tumor/stromal crosstalk during Ptch MB evolution by manipulating the Norrin/Frizzled4 (Fzd4) pathway, an endogenous signalling axis that regulates vascular development in the cerebellum via neural/endothelial interactions (Wang et al., 2012; Xu et al., 2004; Zhou et al., 2014). We demonstrate that the preneoplastic niche is a potent modulator of Ptchtumor initiation. Loss of vascular Norrin/Fzd4 signalling, either genetically or by short-term blockade, creates a tumor-permissive stroma that promotes the formation of preneoplastic lesions and their progression to malignancy. We show that activation of angiogenesis and stromal remodelling are key features of the oncogenic microenvironment that dramatically accelerates tumorigenesis in the Ptchcerebellum. This is the first study to describe a stromal component to the early stages of Shh-driven tumor initiation in the brain.
Results
Ndp is expressed in GNPs and mouse and human Shh-MB
To assess the stromal compartment at early stages of tumorigenesis in the Ptch cerebellum, we sampled entire lesions at postnatal day (P) 14 by Collagen IV+ immunostaining, and observed an invasion of vasculature in a minority (24%; Figure 1A). Furthermore, lesion volume, which is a measure of neoplastic progression in the Ptch model, was statistically larger in vascularized lesions (mean 0.18 mm3) compared to non-vascularized ones (mean 0.029 mm3, Figure 1B). These observations are notable, considering that only a minority of lesions undergo malignant transformation and continue to grow into tumors (Kessler et al., 2009; Oliver et al., 2005). To explore this pre-tumor/blood vessel interaction, we targeted Norrin signalling, a well-characterized regulator of neural-endothelial cell communication in the cerebellum (Wang et al., 2012; Zhou et al., 2014). Norrin (encoded by the X-linked gene Ndp) is a secreted atypical Wnt ligand that signals specifically through the Fzd4 receptor and the Lrp5/6 and Tspan12 co-receptors to activate the canonical Wnt pathway in endothelial cells (Figure 1C), where it is required for blood brain barrier (BBB) integrity in the cerebellum (Junge et al., 2009; Wang et al., 2012; Xu et al., 2004). Using male Ndpmice carrying an Ndp-lacZ knockout (KO) allele (Junge et al., 2009), we examined the cerebellar expression profile of Ndp. Consistent with alkaline phosphatase-based reporter data (Ye et al., 2010a), we detected Ndp expression in the Purkinje cell layer, presumably in Bergmann glia (Figure 1D). We also detected Ndp expression in the cerebellar external granule layer (EGL), where GNPs, the Shh-MB cell of origin, reside throughout postnatal development (Figure 1D). Combined X-gal staining and immunohistochemistry (IHC) during the peak period of GNP proliferation at P7 revealed that Ndp expression is concentrated in the outer region of the Pax6+ EGL, in the proliferative phospho-histone H3 (PH3)+ compartment (Figure 1D). β-gal+ cells also overlapped with myelin basic protein (MBP)+ white matter (Figure 1D) implicating oligodendrocytes as another source of Norrin. To focus our expression analysis on the Ptchtumor-relevant cell type, we examined Ndp expression in GNPs isolated from the cerebellar surface at various stages of tumorigenesis. While Ndp levels in Ptch GNPs from pre-lesion (P7) and early lesion (P14) stages were comparable, Ndp expression exhibited a downward trend in GNPs at a lesion progression stage (P30) that reached significance by the tumor stage (Figure 1E). In human MB, NDP expression is enriched specifically in the Shh subgroup compared to the other three molecularly distinct subgroups: Wnt, driven by aberrant Wnt pathway activation, and Group 3 and 4, which are less clearly defined biologically (Taylor et al., 2012) (Figure 1F). Based on a limited sample size, we observed a trend towards reduced survival in Shh-MB patients with tumors exhibiting the lowest levels of NDP expression compared to those with the highest (Figure 1G). Thus, given its known function in signalling to endothelial cells and its expression pattern in GNPs and MB, the Norrin/Fzd4 axis is well-positioned to mediate neural-endothelial cell crosstalk within the Shh-MB lesion and tumor microenvironment.
Figure 1.
Ndp is expressed in Shh-MB precursors and mouse and human Shh-MB.
(A) Representative immunostains for Collagen IV (ColIV) counterstained with hematoxylin, to depict non-vascularized (red outline) and vascularized (green outline) lesions from 37 Ptch mouse cerebellar lesions sampled by serial sections at P14. (B) Boxplot showing statistically larger volume in P14 Ptch lesions assigned as vascularized versus those assigned as non-vascularized, based on immunostaining serial sections of each lesion for ColIV. (C) Schematic illustrating the machinery required for Norrin activation of β-catenin (β-cat)/T-cell factor (TCF)-dependent transcription via the Fzd4 receptor and Lrp5 and Tspan12 co-receptors. (D) X-gal staining (blue) of sagittally sectioned cerebella from male Ndp mice carrying an Ndp-lacZ KO allele, at the ages indicated. Bottom row, combined X-gal staining and immunohistochemistry (IHC, brown) for phospho-histone H3 (PH3), Pax6, and myelin basic protein (MBP). (E) Box plot of qRT-PCR analysis of Ndp expression in mouse Ptch purified GNPs and MB lysate from symptomatic animals ranging in age from 3 to 10 months. (F) Box plot of NDP expression obtained by array profiling of human cerebella and two different cohorts (Boston, left; Toronto, right) of human MB samples, categorized by molecular subgroup. (G) Kaplan-Meier survival curve illustrating overall survival of Shh-MB patients with high versus low NDP expression. EGL, external granule layer; GNP, granule neuron progenitor; PCL, Purkinje cell layer; ML, molecular layer; WM, white matter; IGL, internal granule layer; CB, cerebellum; MB, medulloblastoma. Scale bars, 100 µm.
DOI:
http://dx.doi.org/10.7554/eLife.16764.002
Ndp is expressed in Shh-MB precursors and mouse and human Shh-MB.
(A) Representative immunostains for Collagen IV (ColIV) counterstained with hematoxylin, to depict non-vascularized (red outline) and vascularized (green outline) lesions from 37 Ptchmousecerebellar lesions sampled by serial sections at P14. (B) Boxplot showing statistically larger volume in P14Ptch lesions assigned as vascularized versus those assigned as non-vascularized, based on immunostaining serial sections of each lesion for ColIV. (C) Schematic illustrating the machinery required for Norrin activation of β-catenin (β-cat)/T-cell factor (TCF)-dependent transcription via the Fzd4 receptor and Lrp5 and Tspan12 co-receptors. (D) X-gal staining (blue) of sagittally sectioned cerebella from male Ndpmice carrying an Ndp-lacZ KO allele, at the ages indicated. Bottom row, combined X-gal staining and immunohistochemistry (IHC, brown) for phospho-histone H3 (PH3), Pax6, and myelin basic protein (MBP). (E) Box plot of qRT-PCR analysis of Ndp expression in mousePtch purified GNPs and MB lysate from symptomatic animals ranging in age from 3 to 10 months. (F) Box plot of NDP expression obtained by array profiling of human cerebella and two different cohorts (Boston, left; Toronto, right) of human MB samples, categorized by molecular subgroup. (G) Kaplan-Meier survival curve illustrating overall survival of Shh-MB patients with high versus low NDP expression. EGL, external granule layer; GNP, granule neuron progenitor; PCL, Purkinje cell layer; ML, molecular layer; WM, white matter; IGL, internal granule layer; CB, cerebellum; MB, medulloblastoma. Scale bars, 100 µm.DOI:
http://dx.doi.org/10.7554/eLife.16764.002
Norrin/Fzd4 loss of function dramatically enhances Ptch MB formation
To explore the relevance of the stromal compartment during Shh-MB evolution, we disrupted the Norrin/Fzd4 signalling axis at the level of the ligand or receptor in Ptchmice. Given that MB incidence in Ptchmice is dependent on the genetic background strain (Mille et al., 2014), we performed all long and short-term studies of tumorigenesis by comparing animals within the same breeding cohort. While germ-line deletion of the ligand Ndp (Ndp) or conditional deletion of Fzd4 in endothelial cells via the Tie2Cre driver (Tie2Cre+;Fzd4) alone did not result in tumors, both mutations dramatically accelerated MB formation and significantly reduced survival in Ptchmice (Figure 2A–C), to an extent that has only previously been observed in this model upon DNA damage (Pazzaglia et al., 2006a; 2006b; Wetmore et al., 2001). In both Ndp and Tie2Cre+;Fzd4compound mutants, MB incidence increased by approximately two-fold and mean latency was reduced more than two-fold compared to Ptch littermates (Figure 2C). In isolated GNPs, we detected the expression of endogenous FZD4 protein (Figure 2D), and transcripts of Fzd4, Lrp5 and Tspan12 (Figure 2E); however, conditional deletion of Fzd4 from GNPs in the Ptch model had no impact on survival and tumorigenesis (Figure 2F). These results reveal a novel tumor inhibitory role for Norrin/Fzd4 signalling in PtchMB that, strikingly, is mediated by the endothelial cell component of the tumor stroma.
Figure 2.
Norrin/Fzd4 signalling in endothelial cells has a potent tumor inhibitory role in Ptch MB.
(A) Kaplan-Meier survival curve to assess the impact of Ndp deletion in Ptchmice. Ndpanimals do not develop tumors but five of 44 animals were euthanized prematurely due to a skin condition. (B) Kaplan-Meier survival curve to assess the impact of endothelial cell-targeted (Tie2Cre-driven) Fzd4 deletion in Ptchmice. Tie2Cre+;Fzd4 animals do not develop tumors but exhibit reduced survival as reported in Fzd4 mice, which die with esophageal-related feeding defects and progressive auditory and cerebellar degeneration (Wang et al., 2001). (C) Summary of sample sizes, MB incidence and average latency in all animals from Kaplan-Meier survival curves in A and B. (D) Purified P10 GNPs immunostained for anti-FZD4 and anti-keyhole limpet hemocyanin (KLH) isotype-matched control (green), counterstained with Hoescht (blue). White boxes are magnified at right. (E) Box plots of qRT-PCR analysis of Norrin receptor components in isolated mouse GNPs and Ptch MB. (F) Kaplan-Meier survival curve to assess the impact of GNP-targeted (Atoh1Cre-driven) Fzd4 deletion in Ptchmice. (G) Summary of sample sizes, MB incidence and average latency in all animals from Kaplan-Meier survival curve in F *Died with confirmed MB; †Do not develop MB. WT, wild-type; n.s., not significant.
DOI:
http://dx.doi.org/10.7554/eLife.16764.003
Norrin/Fzd4 signalling in endothelial cells has a potent tumor inhibitory role in Ptch MB.
(A) Kaplan-Meier survival curve to assess the impact of Ndp deletion in Ptchmice. Ndpanimals do not develop tumors but five of 44 animals were euthanized prematurely due to a skin condition. (B) Kaplan-Meier survival curve to assess the impact of endothelial cell-targeted (Tie2Cre-driven) Fzd4 deletion in Ptchmice. Tie2Cre+;Fzd4 animals do not develop tumors but exhibit reduced survival as reported in Fzd4mice, which die with esophageal-related feeding defects and progressive auditory and cerebellar degeneration (Wang et al., 2001). (C) Summary of sample sizes, MB incidence and average latency in all animals from Kaplan-Meier survival curves in A and B. (D) Purified P10 GNPs immunostained for anti-FZD4 and anti-keyhole limpet hemocyanin (KLH) isotype-matched control (green), counterstained with Hoescht (blue). White boxes are magnified at right. (E) Box plots of qRT-PCR analysis of Norrin receptor components in isolated mouse GNPs and Ptch MB. (F) Kaplan-Meier survival curve to assess the impact of GNP-targeted (Atoh1Cre-driven) Fzd4 deletion in Ptchmice. (G) Summary of sample sizes, MB incidence and average latency in all animals from Kaplan-Meier survival curve in F *Died with confirmed MB; †Do not develop MB. WT, wild-type; n.s., not significant.DOI:
http://dx.doi.org/10.7554/eLife.16764.003
Loss of Ndp alters the stromal gene expression signature in Ptch MB
To gain insight into Norrin-mediated effects on Ptchtumorigenesis, we examined established Ndp and Ptch MBs by histology and expression profiling. Both tumor types exhibited classic histology, and similar expression patterns for expected Shh-MB neural markers (Atoh1, TUBB3 and GFAP) and Hh target genes (Gli1, Mycn and Ccnd1) (Figure 3A). Co-immunostaining for the ECM protein laminin and the vascular endothelial cell marker CD31 (PECAM1; platelet/endothelial cell adhesion molecule 1) revealed a stromal component in both tumors (Figure 3B). However, tumor heterogeneity poses challenges to histological-based classification, therefore we turned to whole genome expression profiling, where hierarchical clustering and principal component analysis revealed that Ndp and Ptchtumors have clearly separable gene expression signatures (Figure 3C and Figure 3—figure supplement 1A). Consistent with a stromal requirement for Norrin/Fzd4 signalling, tumors in Ndp mutants were enriched for changes in stromal genes compared to their Ptch counterparts, particularly ECM components (Figure 3D,E). Up-regulated genes in Ndptumors included components of endothelial cells, including Esm1 (Endothelial cell-specific molecule 1), Plvap (Plasmalemmal vesicle associated protein) and Emcn (Endomucin) (Figure 3—figure supplement 1C,D), which we validated by qRT-PCR (Figure 3F). The up-regulation of Plvap, a marker of fenestrated endothelial cells, was associated with increased vascular permeability in Ndp versus Ptchtumors, demonstrated by enhanced leakage of the serum protein binding dye Evans blue (Figure 3G). Additional genes upregulated in Ndp versus Ptchtumors by qRT-PCR were Pecam1, suggesting increased vascularity in Ndptumors, and the angiogenic regulator Angpt2 (Angiopoietin-2) (Figure 3F). These results suggest that rather than impacting Shh signalling, loss of Norrin modulates features of the tumor stroma.
Figure 3.
Ptch and Ndp MBs have separable gene expression signatures enriched for stromal gene changes.
(A) Sections of Ptch and Ndp established MBs stained by hematoxylin and eosin (H and E), in situ hybridization for Atoh1, Gli1, Mycn and Ccnd1 (purple), or immunostaining for class III β-tubulin (TUBB3) and glial fibrillary acidic protein (GFAP; green) counterstained with Hoescht (blue). n = 3 tumors of each genotype examined. (B) Sections of Ptch and Ndp established MBs co-immunostained for CD31 (green) and pan-laminin (red), counterstained with Hoescht (blue). n = 3 tumors of each genotype examined. (C) Whole genome expression profiles of Ptch and Ndp MBs and P6 WT (wild-type) GNPs were used for principal component analysis performed with the 1500 most variable probes across all samples. (D,E) Cellular component gene ontology (GO) analysis of differentially expressed genes between Ptch and Ndp MBs. (F) qRT-PCR analysis of vascular genes upregulated in Ndp versus Ptch MBs. (G) Wholemount views of Ptch and Ndp MBs in animals injected with Evans Blue dye prior to sacrifice. Scale bars, 100 µm. See also Figure 3—figure supplement 1.
DOI:
http://dx.doi.org/10.7554/eLife.16764.004
(A) Hierarchical clustering calculated from the 1500 probes with the largest interquartile ranges across all samples following whole genome expression analyses of Ptch and Ndp MBs and P6 WT (wild-type) GNPs. (B,C) A total of 1586 transcripts were detected, using limma (Smyth, 2004), as differentially expressed in Ptch versus Ndp MB with adjusted P values below 0.05. The heatmaps display the top 50 most up- and down-regulated genes between the two tumor types. Genes marked by a green rectangle fall into the extracellular region Gene Ontology (GO) class. (D) Immunostains of PLVAP and Endomucin (green) on Ndp and Ptch MBs (top) and lesions (bottom) demonstrates validation of up-regulated genes at the protein level. Scale bars, 100 µm.
DOI:
http://dx.doi.org/10.7554/eLife.16764.005
Figure 3—figure supplement 1.
Differential stromal gene expression in Ptch MB upon loss of Ndp.
(A) Hierarchical clustering calculated from the 1500 probes with the largest interquartile ranges across all samples following whole genome expression analyses of Ptch and Ndp MBs and P6 WT (wild-type) GNPs. (B,C) A total of 1586 transcripts were detected, using limma (Smyth, 2004), as differentially expressed in Ptch versus Ndp MB with adjusted P values below 0.05. The heatmaps display the top 50 most up- and down-regulated genes between the two tumor types. Genes marked by a green rectangle fall into the extracellular region Gene Ontology (GO) class. (D) Immunostains of PLVAP and Endomucin (green) on Ndp and Ptch MBs (top) and lesions (bottom) demonstrates validation of up-regulated genes at the protein level. Scale bars, 100 µm.
DOI:
http://dx.doi.org/10.7554/eLife.16764.005
Ptch and Ndp MBs have separable gene expression signatures enriched for stromal gene changes.
(A) Sections of Ptch and Ndp established MBs stained by hematoxylin and eosin (H and E), in situ hybridization for Atoh1, Gli1, Mycn and Ccnd1 (purple), or immunostaining for class III β-tubulin (TUBB3) and glial fibrillary acidic protein (GFAP; green) counterstained with Hoescht (blue). n = 3 tumors of each genotype examined. (B) Sections of Ptch and Ndp established MBs co-immunostained for CD31 (green) and pan-laminin (red), counterstained with Hoescht (blue). n = 3 tumors of each genotype examined. (C) Whole genome expression profiles of Ptch and Ndp MBs and P6 WT (wild-type) GNPs were used for principal component analysis performed with the 1500 most variable probes across all samples. (D,E) Cellular component gene ontology (GO) analysis of differentially expressed genes between Ptch and Ndp MBs. (F) qRT-PCR analysis of vascular genes upregulated in Ndp versus Ptch MBs. (G) Wholemount views of Ptch and Ndp MBs in animals injected with Evans Blue dye prior to sacrifice. Scale bars, 100 µm. See also Figure 3—figure supplement 1.DOI:
http://dx.doi.org/10.7554/eLife.16764.004
Differential stromal gene expression in Ptch MB upon loss of Ndp.
(A) Hierarchical clustering calculated from the 1500 probes with the largest interquartile ranges across all samples following whole genome expression analyses of Ptch and Ndp MBs and P6 WT (wild-type) GNPs. (B,C) A total of 1586 transcripts were detected, using limma (Smyth, 2004), as differentially expressed in Ptch versus Ndp MB with adjusted P values below 0.05. The heatmaps display the top 50 most up- and down-regulated genes between the two tumor types. Genes marked by a green rectangle fall into the extracellular region Gene Ontology (GO) class. (D) Immunostains of PLVAP and Endomucin (green) on Ndp and Ptch MBs (top) and lesions (bottom) demonstrates validation of up-regulated genes at the protein level. Scale bars, 100 µm.DOI:
http://dx.doi.org/10.7554/eLife.16764.005
Stromal Norrin/Fzd4 signalling regulates lesion induction in the Ptch cerebellum
In the Ptch model, MB progression is impacted by both the number of preneoplastic lesions, and the rate at which they transform to established tumors (Corcoran et al., 2008; Pazzaglia et al., 2006a; 2006b; Tanori et al., 2010). To determine the stage of tumorigenesis where stromal Norrin/Fzd4 signalling is critical, we examined lesion formation in cerebella of Ndp and Tie2Cre+;Fzd4 compound mutants. At P14, the earliest stage when lesions are consistently detected in Ptchmice, the number of cerebellar lesions in Ndp and Tie2Cre+;Fzd4mutants was increased 3.9-fold and 2.4-fold, respectively, compared their Ptch littermates (Figure 4A,C). This effect on lesion number was not associated with changes to the Ptchcerebellum at prior ages, as we failed to detect separable GNP expression profiles or general overgrowth of the EGL in Ndp versus Ptch cerebella at P6 (Figure 4—figure supplement 1). Thus, we have revealed an endogenous signalling axis in the preneoplastic microenvironment that plays a protective role during the early stages of Shh-induced tumorigenesis.
Figure 4.
Loss of Norrin/Fzd4 signalling increases lesion formation in P14 Ptch cerebella.
(A) Quantification of lesions from serial sections of cresyl violet stained P14 cerebella from Ndp, Ptch and Ndp mice. Example lesions are outlined in red, and n indicates the number of mice examined. (B) Quantification of lesion volumes from the lesions in A. (C) Quantification of lesions from serial sections of hematoxylin and eosin (H and E) stained P14 cerebella from Tie2Cre+;Fzd4, Ptch, and Tie2Cre+;Fzd4mice. Example lesions are outline in red, and n indicates number of mice examined. (D) Quantification of lesion volumes from the lesions in C. Means are denoted by black horizontal lines on graphs. Scale bars, 100 µm. See also Figure 4—figure supplement 1.
DOI:
http://dx.doi.org/10.7554/eLife.16764.006
(A) Principal component analysis following genome-wide expression array profiling of acutely isolated WT (wild-type), Ptch, Ndp and Ndp GNPs (n = 4 animals per group) does not reveal clear separation of mutant GNPs. (B,C) Measurements from sections in equivalent cerebellar regions of P6 WT, Ptch, Ndp and Ndp GNPs (n = 3 in each group) show that loss of Ndp does not increase EGL thickness in otherwise WT mice, or in Ptch mice which exhibit an already thickened EGL. Vertical red lines in B denote EGL thickness. Means are denoted by black horizontal lines on the graph. Scale bar, 100 µm.
DOI:
http://dx.doi.org/10.7554/eLife.16764.007
Figure 4—figure supplement 1.
Loss of Norrin signalling in Ptch mice does not promote general EGL overgrowth or significant changes in GNP gene expression profile .
(A) Principal component analysis following genome-wide expression array profiling of acutely isolated WT (wild-type), Ptch, Ndp and Ndp GNPs (n = 4 animals per group) does not reveal clear separation of mutant GNPs. (B,C) Measurements from sections in equivalent cerebellar regions of P6 WT, Ptch, Ndp and Ndp GNPs (n = 3 in each group) show that loss of Ndp does not increase EGL thickness in otherwise WT mice, or in Ptch mice which exhibit an already thickened EGL. Vertical red lines in B denote EGL thickness. Means are denoted by black horizontal lines on the graph. Scale bar, 100 µm.
DOI:
http://dx.doi.org/10.7554/eLife.16764.007
Loss of Norrin/Fzd4 signalling increases lesion formation in P14 Ptch cerebella.
(A) Quantification of lesions from serial sections of cresyl violet stained P14 cerebella from Ndp, Ptch and Ndpmice. Example lesions are outlined in red, and n indicates the number of mice examined. (B) Quantification of lesion volumes from the lesions in A. (C) Quantification of lesions from serial sections of hematoxylin and eosin (H and E) stained P14 cerebella from Tie2Cre+;Fzd4, Ptch, and Tie2Cre+;Fzd4mice. Example lesions are outline in red, and n indicates number of mice examined. (D) Quantification of lesion volumes from the lesions in C. Means are denoted by black horizontal lines on graphs. Scale bars, 100 µm. See also Figure 4—figure supplement 1.DOI:
http://dx.doi.org/10.7554/eLife.16764.006
Loss of Norrin signalling in Ptch mice does not promote general EGL overgrowth or significant changes in GNP gene expression profile .
(A) Principal component analysis following genome-wide expression array profiling of acutely isolated WT (wild-type), Ptch, Ndp and Ndp GNPs (n = 4 animals per group) does not reveal clear separation of mutant GNPs. (B,C) Measurements from sections in equivalent cerebellar regions of P6 WT, Ptch, Ndp and Ndp GNPs (n = 3 in each group) show that loss of Ndp does not increase EGL thickness in otherwise WT mice, or in Ptchmice which exhibit an already thickened EGL. Vertical red lines in B denote EGL thickness. Means are denoted by black horizontal lines on the graph. Scale bar, 100 µm.DOI:
http://dx.doi.org/10.7554/eLife.16764.007
Loss of Norrin/Fzd4 signalling promotes stromal remodelling and angiogenesis in Ptchlesions
Together with the altered stromal expression signature in Ndptumors, our finding of enhanced lesion formation suggests that loss of Norrin/Fzd4 signalling may induce stromal perturbations that impact the earliest stages of MB progression. We therefore compared stromal characteristics in lesions from Ndp and Tie2Cre+;Fzd4 compound mutants and their Ptchlittermates. Consistent with our previous observations (Figure 1A), immunostaining for CD31 and laminin showed that the majority of Ptchlesions were poorly vascularized, aside from existing blood vessels associated with the meninges at the cerebellar surface (Figure 5A). In contrast, compound mutant lesions exhibited several hallmarks of angiogenic remodelling, including irregular deposition of ECM (Figure 5A), an increased frequency of mitotic endothelial cells per vessel area (Figure 5B), and an increase in vascular endothelial cell and laminin density (Figure 5C). This vascular remodelling was restricted to lesions, with only rare examples of disrupted morphology associated with the EGL in single Tie2Cre+;Fzd4 cerebella (Figure 5—figure supplement 1). Interestingly, while the vast majority of compound mutant lesions were vascularized at P14 (78% Ndp and 95% Tie2Cre+;Fzd4 versus 24% Ptch;Figure 5D), compound mutant lesion volume was not increased at this early stage of tumor evolution (Figure 4B,D). Accordingly, we observed vascular remodeling in very small (<0.02 mm3) compound mutant lesions (Figure 5—figure supplement 2). Thus, vascular remodelling induced by loss of Norrin/Fzd4 is independent of the increase in lesion volume.
Figure 5.
Loss of Norrin/Fzd4 signalling in endothelial cells promotes angiogenic remodeling.
(A) Co-immunostaining for CD31 and pan-laminin, counterstained with Hoescht (blue), on sections of P14 cerebella from the genotypes indicated. Lesions are outlined in white. Arrow on Ptch lesion denotes meningeal blood vessels. Scale bar, 100 µm. (B) Quantification of mitotic endothelial cells in Ptch and Ndp lesions. Top images show co-immunostaining for CD31 and PH3, counterstained with Hoescht (blue), on vascularized P14 lesion sections. Scale bar, 50 µm. Red squares denote areas shown by confocal scans below, where left image depicts the composite maximum intensity projection and the center and right images show individual z-stack slices. Scale bar, 10 µm. Blue arrows denote a PH3+ cell scored as negative for co-localization, whereas red arrows denote a positive co-localization. Graph on right summarizes quantification of double labelled PH3+CD31+ cells per endothelial area. (C) Quantification of CD31+ vessel density and laminin density in lesions of Ptch, Ndp and Tie2Cre+;Fzd4. Number of lesions (n) examined is indicated on each graph in B and C, and means are denoted by black horizontal lines. (D) Summary of the proportion of vascularized lesions from each genotype. ****p<0.0001. See also Figure 5—figure supplement 1 and 2.
DOI:
http://dx.doi.org/10.7554/eLife.16764.008
Co-immunostaining for CD31 and pan-Laminin from P14 animals of the genotypes indicated. Note that Tie2Cre+;Fzd4 cerebella do not develop preneoplastic lesions but exhibit rare foci of disrupted morphology associated with the EGL. 3 lesion-free regions from at least 3 cerebella per genotype were examined. EGL, external granule layer. Scale bars, 100 µm.
DOI:
http://dx.doi.org/10.7554/eLife.16764.009
Co-immunostaining for CD31 and pan-laminin on cerebellar lesion sections from P14 Ptch and Tie2Cre+;Fzd4mice (lesions outlined in white), to illustrate vascular remodeling in small (<0.02 mm3) compound mutant lesions. Scale bars, 100 µm.
DOI:
http://dx.doi.org/10.7554/eLife.16764.010
Figure 5—figure supplement 1.
EGL-associated morphology in Norrin/Fzd4-deficient cerebella .
Co-immunostaining for CD31 and pan-Laminin from P14 animals of the genotypes indicated. Note that Tie2Cre+;Fzd4 cerebella do not develop preneoplastic lesions but exhibit rare foci of disrupted morphology associated with the EGL. 3 lesion-free regions from at least 3 cerebella per genotype were examined. EGL, external granule layer. Scale bars, 100 µm.
DOI:
http://dx.doi.org/10.7554/eLife.16764.009
Figure 5—figure supplement 2.
Lesion size is not correlated with vascular remodeling in Ndp and Tie2Cre+;Fzd4compound mutants.
Co-immunostaining for CD31 and pan-laminin on cerebellar lesion sections from P14 Ptch and Tie2Cre+;Fzd4mice (lesions outlined in white), to illustrate vascular remodeling in small (<0.02 mm3) compound mutant lesions. Scale bars, 100 µm.
DOI:
http://dx.doi.org/10.7554/eLife.16764.010
Loss of Norrin/Fzd4 signalling in endothelial cells promotes angiogenic remodeling.
(A) Co-immunostaining for CD31 and pan-laminin, counterstained with Hoescht (blue), on sections of P14 cerebella from the genotypes indicated. Lesions are outlined in white. Arrow on Ptch lesion denotes meningeal blood vessels. Scale bar, 100 µm. (B) Quantification of mitotic endothelial cells in Ptch and Ndp lesions. Top images show co-immunostaining for CD31 and PH3, counterstained with Hoescht (blue), on vascularized P14 lesion sections. Scale bar, 50 µm. Red squares denote areas shown by confocal scans below, where left image depicts the composite maximum intensity projection and the center and right images show individual z-stack slices. Scale bar, 10 µm. Blue arrows denote a PH3+ cell scored as negative for co-localization, whereas red arrows denote a positive co-localization. Graph on right summarizes quantification of double labelled PH3+CD31+ cells per endothelial area. (C) Quantification of CD31+ vessel density and laminin density in lesions of Ptch, Ndp and Tie2Cre+;Fzd4. Number of lesions (n) examined is indicated on each graph in B and C, and means are denoted by black horizontal lines. (D) Summary of the proportion of vascularized lesions from each genotype. ****p<0.0001. See also Figure 5—figure supplement 1 and 2.DOI:
http://dx.doi.org/10.7554/eLife.16764.008
EGL-associated morphology in Norrin/Fzd4-deficient cerebella .
Co-immunostaining for CD31 and pan-Laminin from P14 animals of the genotypes indicated. Note that Tie2Cre+;Fzd4 cerebella do not develop preneoplastic lesions but exhibit rare foci of disrupted morphology associated with the EGL. 3 lesion-free regions from at least 3 cerebella per genotype were examined. EGL, external granule layer. Scale bars, 100 µm.DOI:
http://dx.doi.org/10.7554/eLife.16764.009
Lesion size is not correlated with vascular remodeling in Ndp and Tie2Cre+;Fzd4compound mutants.
Co-immunostaining for CD31 and pan-laminin on cerebellar lesion sections from P14Ptch and Tie2Cre+;Fzd4mice (lesions outlined in white), to illustrate vascular remodeling in small (<0.02 mm3) compound mutant lesions. Scale bars, 100 µm.DOI:
http://dx.doi.org/10.7554/eLife.16764.010Consistent with the known role for Norrin/Fzd4 in normal BBB development and function [(Wang et al., 2012) and Figure 6—figure supplement 1A,B], lesions in compound mutants showed a marked loss of vascular integrity, characterized by induction of PLVAP (Figure 6A,B), variable loss of the tight junction protein Claudin-5 (Figure 6A), and leakage of Evans blue (Figure 6C). In contrast, single Ptchmice never exhibited leaky vessels (Figure 6A–C and Figure 6—figure supplement 1A,B), which is consistent with the positive regulation of BBB maintenance by active Hh signalling (Alvarez et al., 2011). Accordingly, the proportion of leaky lesions was significantly increased in compound mutants compared to Ptch (Figure 6D). Lesion-associated vessels in compound mutants did not show overt differences in pericyte coverage (Figure 6—figure supplement 1D,E), however, they did exhibit a high frequency of perivascular accumulation of CD45+ leukocytes compared with Ptch lesions (Figure 6D,E). Together, these results show that loss of Norrin/Fzd4 signalling to endothelial cells accelerates the transition to a tumor-permissive stroma characterized by vascular permeability, inflammation and angiogenic remodelling. These changes are reminiscent of the switch to angiogenesis that promotes the preneoplastic progression of non-central nervous system (CNS) tumors (Baeriswyl and Christofori, 2009), where the range of cellular and molecular players involved include Angpt2 (Mazzieri et al., 2011; Rigamonti et al., 2014), consistent with our observation of increased Angpt2 expression in Ndptumors (Figure 3F).
(A) Whole brain images of P14 mice injected with Evans Blue dye prior to sacrifice, to indicate blood brain barrier disruption in the cerebellum (outlined in red) upon loss of Fzd4 signalling irrespective of Ptch status, but intact barrier function in WT or single mutant Ptch cerebella. (B) Co-immunostaining for plasmalemmal vesicle associated protein (PLVAP) and Claudin-5 from P14 animals of the genotypes indicated. Note presence of PLVAP+ vessels in all mutants with loss of Ndp/Fzd4. (C) Schematic of the relationship between the remaining EGL and surrounding stromal components at the surface of the P14 cerebellum. (D) Co-immunostaining for CD31 and the pericyte marker PDGFRβ on P14 cerebellar lesion sections (lesions outlined in white) from Ptch(n = 8 lesions examined), Ndp (n = 7 lesions examined) and Tie2Cre+;Fzd4(n = 16 lesions examined). (E) Co-immunostaining for CD31 and PDGFRβ on P14 sections from the approximate cerebellar location depicted in C, from the genotypes indicated. Immunostains are counterstained with Hoescht (blue). In B and E, 3 lesion-free regions from at least 3 cerebella per genotype were examined. EGL, external granule layer; ECM, extracellular matrix. Scale bars, 100 µm.
DOI:
http://dx.doi.org/10.7554/eLife.16764.012
Figure 6.
Loss of Norrin/Fzd4 signalling in endothelial cells promotes vessel leakiness in Ptch lesions.
(A) Co-immunostaining for PLVAP and Claudin-5 (Cld5) counterstained with Hoescht (blue), on lesion sections of P14 cerebella from the genotypes indicated. Vessels outlined in turquoise. Top images show Cld5 channel only, to illustrate variable reduction in Cld5 expression (arrowheads). (B) Quantification of PLVAP+ vessel density in lesions of Ptch, Ndp and Tie2Cre+;Fzd4. Number of lesions (n) examined is indicated on each graph, and means are denoted by black horizontal lines. (C) P14 Ptch, Ndp and Tie2Cre+;Fzd4mice injected with Evans Blue dye prior to sacrifice. Sections containing lesions (outlined in blue) show Evans Blue as red fluorescence, followed by adjacent H and E-stained sections and whole brain images (cerebella outlined in red). (D) Summary of the proportion of lesions from each genotype containing leaky vessels or ≥5 CD45+ cells. ****p<0.0001; **p<0.01. (E) Co-immunostaining for CD45 and Collagen IV (ColIV) on lesion sections of P14 cerebella. Scale bars, 100 µm. See also Figure 6—figure supplement 1 and 2.
DOI:
http://dx.doi.org/10.7554/eLife.16764.011
(A) Whole brain images of P14 mice injected with Evans Blue dye prior to sacrifice, to indicate blood brain barrier disruption in the cerebellum (outlined in red) upon loss of Fzd4 signalling irrespective of Ptch status, but intact barrier function in WT or single mutant Ptch cerebella. (B) Co-immunostaining for plasmalemmal vesicle associated protein (PLVAP) and Claudin-5 from P14 animals of the genotypes indicated. Note presence of PLVAP+ vessels in all mutants with loss of Ndp/Fzd4. (C) Schematic of the relationship between the remaining EGL and surrounding stromal components at the surface of the P14 cerebellum. (D) Co-immunostaining for CD31 and the pericyte marker PDGFRβ on P14 cerebellar lesion sections (lesions outlined in white) from Ptch(n = 8 lesions examined), Ndp (n = 7 lesions examined) and Tie2Cre+;Fzd4(n = 16 lesions examined). (E) Co-immunostaining for CD31 and PDGFRβ on P14 sections from the approximate cerebellar location depicted in C, from the genotypes indicated. Immunostains are counterstained with Hoescht (blue). In B and E, 3 lesion-free regions from at least 3 cerebella per genotype were examined. EGL, external granule layer; ECM, extracellular matrix. Scale bars, 100 µm.
DOI:
http://dx.doi.org/10.7554/eLife.16764.012
(A) Co-immunostaining for CD31 and Lef1, counterstained with Hoescht (blue), on sections of P14 Ptchand Ndp lesions. Scale bar, 50 µm. Red squares denote the area magnified on the right and shown by confocal images of single z-stack slices. Scale bar, 10 µm. (B) Quantification of double labelled Lef1+CD31+ cells per endothelial area in Ptch lesions (vascularized and non-vascularized) and Ndp lesions.
DOI:
http://dx.doi.org/10.7554/eLife.16764.013
Loss of Norrin/Fzd4 signalling in endothelial cells promotes vessel leakiness in Ptch lesions.
(A) Co-immunostaining for PLVAP and Claudin-5 (Cld5) counterstained with Hoescht (blue), on lesion sections of P14 cerebella from the genotypes indicated. Vessels outlined in turquoise. Top images show Cld5 channel only, to illustrate variable reduction in Cld5 expression (arrowheads). (B) Quantification of PLVAP+ vessel density in lesions of Ptch, Ndp and Tie2Cre+;Fzd4. Number of lesions (n) examined is indicated on each graph, and means are denoted by black horizontal lines. (C) P14Ptch, Ndp and Tie2Cre+;Fzd4mice injected with Evans Blue dye prior to sacrifice. Sections containing lesions (outlined in blue) show Evans Blue as red fluorescence, followed by adjacent H and E-stained sections and whole brain images (cerebella outlined in red). (D) Summary of the proportion of lesions from each genotype containing leaky vessels or ≥5 CD45+ cells. ****p<0.0001; **p<0.01. (E) Co-immunostaining for CD45 and Collagen IV (ColIV) on lesion sections of P14 cerebella. Scale bars, 100 µm. See also Figure 6—figure supplement 1 and 2.
Figure 6—figure supplement 2.
Vascularization of Ptchand Ndp lesions is associated with reduced expression of the Wnt target Lef1 in endothelial cells .
(A) Co-immunostaining for CD31 and Lef1, counterstained with Hoescht (blue), on sections of P14 Ptchand Ndp lesions. Scale bar, 50 µm. Red squares denote the area magnified on the right and shown by confocal images of single z-stack slices. Scale bar, 10 µm. (B) Quantification of double labelled Lef1+CD31+ cells per endothelial area in Ptch lesions (vascularized and non-vascularized) and Ndp lesions.
(A) Whole brain images of P14mice injected with Evans Blue dye prior to sacrifice, to indicate blood brain barrier disruption in the cerebellum (outlined in red) upon loss of Fzd4 signalling irrespective of Ptch status, but intact barrier function in WT or single mutant Ptch cerebella. (B) Co-immunostaining for plasmalemmal vesicle associated protein (PLVAP) and Claudin-5 from P14 animals of the genotypes indicated. Note presence of PLVAP+ vessels in all mutants with loss of Ndp/Fzd4. (C) Schematic of the relationship between the remaining EGL and surrounding stromal components at the surface of the P14 cerebellum. (D) Co-immunostaining for CD31 and the pericyte marker PDGFRβ on P14cerebellar lesion sections (lesions outlined in white) from Ptch(n = 8 lesions examined), Ndp (n = 7 lesions examined) and Tie2Cre+;Fzd4(n = 16 lesions examined). (E) Co-immunostaining for CD31 and PDGFRβ on P14 sections from the approximate cerebellar location depicted in C, from the genotypes indicated. Immunostains are counterstained with Hoescht (blue). In B and E, 3 lesion-free regions from at least 3 cerebella per genotype were examined. EGL, external granule layer; ECM, extracellular matrix. Scale bars, 100 µm.DOI:
http://dx.doi.org/10.7554/eLife.16764.012
Vascularization of Ptchand Ndp lesions is associated with reduced expression of the Wnt target Lef1 in endothelial cells .
(A) Co-immunostaining for CD31 and Lef1, counterstained with Hoescht (blue), on sections of P14Ptchand Ndp lesions. Scale bar, 50 µm. Red squares denote the area magnified on the right and shown by confocal images of single z-stack slices. Scale bar, 10 µm. (B) Quantification of double labelled Lef1+CD31+ cells per endothelial area in Ptch lesions (vascularized and non-vascularized) and Ndp lesions.DOI:
http://dx.doi.org/10.7554/eLife.16764.013Our findings suggest that Wnt signaling in the endothelium is normally anti-angiogenic, particularly in the context of lesion formation. Therefore, we asked whether vascularization of Ptch lesions was associated with altered Wnt signalling by examining expression of Lef1, a canonical Wnt target gene (Logan and Nusse, 2004). Endothelial Lef1 expression in P14Ndp lesions was significantly reduced compared to P14Ptch lesions and EGL (Figure 6—figure supplement 2A,B), confirming the Ndp dependence of this marker in the endothelium. While Lef1 expression in the endothelium of non-vascularized Ptch lesions was similar to that in adjacent EGL, we observed a downregulation of endothelial Lef1 expression in vascularized Ptch lesions compared to EGL (Figure 6—figure supplement 2B). These data suggest that lesion progression in Ptchmice may be associated with a reduction in endogenous canonical Wnt activity in the endothelium, which is also consistent with the downward trend in Ndp expression during Ptch lesion progression.
The tumor-protective microenvironment has an acute requirement for Fzd4 activity
Genetic deletion of Ndp or Fzd4 impacts cerebellar vasculature throughout development and adulthood (Wang et al., 2012; Zhou et al., 2014). Thus, we determined whether we could recapitulate the effects of genetic inactivation on the development of a tumor-permissive stroma by short-term treatment of Ptchmice with a function blocking Fzd4 antibody (αFzd4), which has been previously shown to effectively cross the BBB and impact retinal vasculature (Paes et al., 2011) (Figure 7—figure supplement 1). αFzd4 treatment of Ptchmice at P7 and P16 was sufficient to phenocopy the enhanced tumor initiation phenotype of our compound mutant models, increasing MB incidence from 69% in animals injected with anti-keyhole limpet hemocyanin (αKLH) control antibody to 93% in those injected with αFzd4, and significantly reducing mean tumor latency from 167 to 104 days (Figure 7A). Furthermore, a single dose of αFzd4 administered as late as P7 was sufficient to increase number (but not volume) of lesions at P14 (Figure 7B), convert lesions to a leaky vasculature phenotype (Figure 7C,I), and significantly increase the proportion of vascularized lesions compared to αKLH controls (Figure 7D,I). Thus, acute disruption of Fzd4 promotes the conversion to an angiogenic, pro-tumor stroma within seven days, suggesting that continued maintenance of Norrin/Fzd4 signalling creates a tumor-protective microenvironment.
Figure 7—figure supplement 1.
Functional in vivo validation of anti-Fzd4 blocking antibody .
Retina whole mount preparations of P14 wild-type mice injected at P7 with a single dose of anti-Fzd4 (αFzd4) blocking antibody (n = 3) or anti-KLH (αKLH) isotype matched control antibody (n = 3). Confocal images show slices from the lectin-stained peripheral retina to represent the superficial vascular plexus, and intermediate and deep capillary beds. Note the reduced vascular density and abnormal vascular morphology in the intermediate and deep capillary beds of αFzd4-treated mice, as previously reported (Paes et al., 2011). Scale bars, 100 µm
DOI:
http://dx.doi.org/10.7554/eLife.16764.015
Figure 7.
Acute disruption of Fzd4 promotes the conversion to a pro-tumor stroma .
(A) Kaplan-Meier survival curve comparing Ptch mice treated with αFzd4 or αKLH isotype matched control antibodies at P7 and P16. All mice died with confirmed MB. Sample sizes, MB incidence and average latency are indicated at right. (B) Quantification of lesion number and volume from P14 cerebella of Ptch mice treated at P7 with αFzd4 (n = 13 mice, 52 lesions total) or αKLH (n = 13 mice, 29 lesions total). Means are denoted by black horizontal lines on graphs. (C) Lesion images from Ptch mice treated at P7 with αKLH (n = 5 lesions) or αFzd4 (n = 6 lesions). Mice were injected with Evans Blue dye prior to sacrifice and sampled by H and E staining followed by Evans Blue visualization as red fluorescence on adjacent sections. Lesions outlined in blue. (D) Lesion images from Ptch mice treated at P7 with αKLH (n = 29 lesions) or αFzd4 (n = 52 lesions), immunostained for ColIV and counterstained with hematoxylin, to quantify the proportions of non-vascularized (outlined in red) and vascularized (outlined in green) lesions in each group. (E) Kaplan-Meier survival curve comparing Ptch mice treated with Ptx or PBS vehicle control at P7, P9, P11 and P13. The sudden drop in Ptx-treated survival is a result of four animals dying from brain hemorrhages or seizures. Three other Ptx-treated animals were euthanized due to malocclusion or unknown causes, while all other mice in both groups died with confirmed MB. Sample sizes, MB incidence and average latency are indicated at the right. (F) Quantification of lesion number and volume from P14 cerebella of Ptch mice treated as above with Ptx (n = 8 mice, 43 lesions total) or PBS (n = 7 mice, 26 lesions total). (G) Lesion images from Ptch mice treated with Ptx (n = 13 lesions) or PBS (n = 13 lesions) as above. Mice were injected with Evans Blue dye prior to sacrifice and sampled by ColIV immunostaining followed by Evans Blue visualization as red fluorescence on adjacent sections. Lesions outlined in white. (H) Lesion images from Ptch mice treated with Ptx (n = 13 lesions) or PBS (n = 13 lesions) as above, immunostained for ColIV to quantify the proportions of non-vascularized (outlined in brown) and vascularized (outlined in green) lesions in each group. (I) Summary of Ptch lesion number and vessel parameters upon treatment with αFzd4 or Ptx. Scale bars, 100 µm. See also Figure 7—figure supplement 1 and 2.
DOI:
http://dx.doi.org/10.7554/eLife.16764.014
Retina whole mount preparations of P14 wild-type mice injected at P7 with a single dose of anti-Fzd4 (αFzd4) blocking antibody (n = 3) or anti-KLH (αKLH) isotype matched control antibody (n = 3). Confocal images show slices from the lectin-stained peripheral retina to represent the superficial vascular plexus, and intermediate and deep capillary beds. Note the reduced vascular density and abnormal vascular morphology in the intermediate and deep capillary beds of αFzd4-treated mice, as previously reported (Paes et al., 2011). Scale bars, 100 µm
DOI:
http://dx.doi.org/10.7554/eLife.16764.015
(A-C) Immunostaining on cerebellar sections from P14 wild-type mice treated with Ptx or PBS control at P7, 9, 11 and 13. At least 6 sections from n = 3 cerebella per treatment group were examined. (A) Double labelling with the blood vessel marker CD31 and the tight junction protein zona occludens -1 (ZO-1) reveals a reduction in ZO-1 expression in Ptx-treated animals. (B) Double labelling with CD31 and the tight junction protein claudin-5 shows a variable reduction in claudin-5 expression in Ptx-treated animals. (C) Double labelling with CD31 and the fenestrated endothelial cell marker plasmalemmal vesicle associated protein (PLVsAP) demonstrates that Ptx-induced blood brain barrier disruption is PLVAP-independent. Positive PLVAP immunostaining in an Ndp cerebellum (bottom row) is shown as a control. Scale bars, 100 µm.
DOI:
http://dx.doi.org/10.7554/eLife.16764.016
Acute disruption of Fzd4 promotes the conversion to a pro-tumor stroma .
(A) Kaplan-Meier survival curve comparing Ptchmice treated with αFzd4 or αKLH isotype matched control antibodies at P7 and P16. All mice died with confirmed MB. Sample sizes, MB incidence and average latency are indicated at right. (B) Quantification of lesion number and volume from P14 cerebella of Ptchmice treated at P7 with αFzd4 (n = 13 mice, 52 lesions total) or αKLH (n = 13 mice, 29 lesions total). Means are denoted by black horizontal lines on graphs. (C) Lesion images from Ptchmice treated at P7 with αKLH (n = 5 lesions) or αFzd4 (n = 6 lesions). Mice were injected with Evans Blue dye prior to sacrifice and sampled by H and E staining followed by Evans Blue visualization as red fluorescence on adjacent sections. Lesions outlined in blue. (D) Lesion images from Ptchmice treated at P7 with αKLH (n = 29 lesions) or αFzd4 (n = 52 lesions), immunostained for ColIV and counterstained with hematoxylin, to quantify the proportions of non-vascularized (outlined in red) and vascularized (outlined in green) lesions in each group. (E) Kaplan-Meier survival curve comparing Ptchmice treated with Ptx or PBS vehicle control at P7, P9, P11 and P13. The sudden drop in Ptx-treated survival is a result of four animals dying from brain hemorrhages or seizures. Three other Ptx-treated animals were euthanized due to malocclusion or unknown causes, while all other mice in both groups died with confirmed MB. Sample sizes, MB incidence and average latency are indicated at the right. (F) Quantification of lesion number and volume from P14 cerebella of Ptchmice treated as above with Ptx (n = 8 mice, 43 lesions total) or PBS (n = 7 mice, 26 lesions total). (G) Lesion images from Ptchmice treated with Ptx (n = 13 lesions) or PBS (n = 13 lesions) as above. Mice were injected with Evans Blue dye prior to sacrifice and sampled by ColIV immunostaining followed by Evans Blue visualization as red fluorescence on adjacent sections. Lesions outlined in white. (H) Lesion images from Ptchmice treated with Ptx (n = 13 lesions) or PBS (n = 13 lesions) as above, immunostained for ColIV to quantify the proportions of non-vascularized (outlined in brown) and vascularized (outlined in green) lesions in each group. (I) Summary of Ptchlesion number and vessel parameters upon treatment with αFzd4 or Ptx. Scale bars, 100 µm. See also Figure 7—figure supplement 1 and 2.
Figure 7—figure supplement 2.
Disruption of cerebellar endothelial cell tight junctions upon treatment with pertussis toxin (Ptx) .
(A-C) Immunostaining on cerebellar sections from P14 wild-type mice treated with Ptx or PBS control at P7, 9, 11 and 13. At least 6 sections from n = 3 cerebella per treatment group were examined. (A) Double labelling with the blood vessel marker CD31 and the tight junction protein zona occludens -1 (ZO-1) reveals a reduction in ZO-1 expression in Ptx-treated animals. (B) Double labelling with CD31 and the tight junction protein claudin-5 shows a variable reduction in claudin-5 expression in Ptx-treated animals. (C) Double labelling with CD31 and the fenestrated endothelial cell marker plasmalemmal vesicle associated protein (PLVsAP) demonstrates that Ptx-induced blood brain barrier disruption is PLVAP-independent. Positive PLVAP immunostaining in an Ndp cerebellum (bottom row) is shown as a control. Scale bars, 100 µm.
DOI:
http://dx.doi.org/10.7554/eLife.16764.016
DOI:
http://dx.doi.org/10.7554/eLife.16764.014
Functional in vivo validation of anti-Fzd4 blocking antibody .
Retina whole mount preparations of P14 wild-type mice injected at P7 with a single dose of anti-Fzd4 (αFzd4) blocking antibody (n = 3) or anti-KLH (αKLH) isotype matched control antibody (n = 3). Confocal images show slices from the lectin-stained peripheral retina to represent the superficial vascular plexus, and intermediate and deep capillary beds. Note the reduced vascular density and abnormal vascular morphology in the intermediate and deep capillary beds of αFzd4-treated mice, as previously reported (Paes et al., 2011). Scale bars, 100 µmDOI:
http://dx.doi.org/10.7554/eLife.16764.015
Disruption of cerebellar endothelial cell tight junctions upon treatment with pertussis toxin (Ptx) .
(A-C) Immunostaining on cerebellar sections from P14 wild-type mice treated with Ptx or PBS control at P7, 9, 11 and 13. At least 6 sections from n = 3 cerebella per treatment group were examined. (A) Double labelling with the blood vessel marker CD31 and the tight junction protein zona occludens -1 (ZO-1) reveals a reduction in ZO-1 expression in Ptx-treated animals. (B) Double labelling with CD31 and the tight junction protein claudin-5 shows a variable reduction in claudin-5 expression in Ptx-treated animals. (C) Double labelling with CD31 and the fenestrated endothelial cell marker plasmalemmal vesicle associated protein (PLVsAP) demonstrates that Ptx-induced blood brain barrier disruption is PLVAP-independent. Positive PLVAP immunostaining in an Ndp cerebellum (bottom row) is shown as a control. Scale bars, 100 µm.DOI:
http://dx.doi.org/10.7554/eLife.16764.016
Ptx-Induced BBB disruption does not affect Ptch tumorigenesis
To further examine what feature of the Norrin/Fzd4-deficient vasculature is pro-tumorigenic, we teased apart the impact of vessel permeability alone using pertussis toxin (Ptx), a stimulator of mouse BBB disruption (Clifford et al., 2007). Ptx treatment compromised paracellular permeability in the P14 cerebellum by disrupting endothelial cell tight junctions via reduced ZO-1 and Claudin-5 expression, accompanied by Evans Blue leakage (Figure 7—figure supplement 2A,B and data not shown). This Ptx-mediated effect on BBB integrity was independent of PLVAP induction (Figure 7—figure supplement 2C), an indicator of transcellular openings (Stan et al., 2004). Ptx treatment of Ptchmice did not affect MB incidence or latency compared to PtchPBS-injected controls (Figure 7E). Furthermore, despite vascular permeability as seen by Evans Blue leakage in lesions of Ptx-treated Ptchmice, the number, volume and proportion of vascularized lesions were not changed (Figure 7F–I). Although Ptx has been shown in certain contexts to inhibit Hh signalling by disrupting Gαi protein coupling to Smoothened (Riobo et al., 2006), our failure to observe changes in lesion number or MB latency suggests that GNP proliferation was not suppressed in this system. These data show that Ptx-induced BBB disruption alone does not drive lesion formation, lesion angiogenesis, or tumor initiation.
Loss of Norrin signalling accelerates Ptch LOH in Ptch MB
The striking acceleration of PtchMB initiation observed upon loss of Norrin/Fzd4 activity (Figure 2A–C) prompted us to assess indicators of GNP growth and malignant progression. We first observed a modest, but significant, increase in the mitotic index of P14 lesions of Ndp mutants compared to their Ptchcounterparts (Figure 8A), which was not counterbalanced by enhanced cell death or differentiation, as Ndp lesions exhibited less Cleaved Caspase 3 immunostaining and comparable expression levels of the differentiation marker NeuN compared to their Ptchlittermates (Figure 8A). Interestingly, this increased mitotic index did not translate into increased lesion volume at this stage (Figure 4B,D). We examined the relationship between proliferating GNPs and lesion vasculature by Pax6/CD31/EdU triple staining, and found that Pax6+EdU+ S-phase GNPs were present in the vicinity of blood vessels in Ptch+/− or Ndp+/− lesions (Figure 8—figure supplement 1). In the Ptch MB context, enhanced proliferation and DNA damage in pre-malignant GNPs leads to increased incidence and decreased latency of MB (Ayrault et al., 2009; Leonard et al., 2008; Mille et al., 2014; Uziel et al., 2005). Here, Ptch loss of heterozygosity (LOH; where the remaining wild-type Ptch allele is inactivated) is a well-established indicator of malignant progression in this model (Mille et al., 2014; Pazzaglia et al., 2006a; 2006b). To determine if Norrin/Fzd4 signalling affects the rate of Ptch LOH, we microdissected GNPs from lesions in Ptch+/− and Ndp+/− cerebella at P14, and determined Ptch LOH status by detection of wild-type Ptch transcript (Figure 8B). At this stage, the frequency of Ptch LOH was increased in Ndp+/− lesions (9/17) compared to Ptch lesions (3/14). Thus, the shorter MB latency observed upon Ndp loss-of-function is characterized by an accelerated rate of Ptch LOH.
Figure 8.
Loss of Norrin signalling accelerates the transition to malignancy in Ptch lesions.
(A) Immunostaining and quantification of proliferation (PH3; n=7 Ptchlesions and n=11 Ndp lesions), apoptosis (cleaved caspase 3; n=7 Ptchlesions and n=11 Ndp lesions) and differentiation (neuronal nuclear protein NeuN; n=10 Ptchlesions and n=12 Ndp lesions) on P14 cerebellar lesions (outlined in white) counterstained with Hoescht (blue). Areas in red boxes are magnified at right. Means are denoted by black horizontal lines on graphs. (B) Frequency of Ptch loss of heterozygosity (LOH) in lesions of P14 Ptch and Ndp mice, determined by wild-type allele-specific detection of Ptch transcripts from microdissected lesions. Example images depict a toluidine blue-stained cerebellar section pre- and post-laser capture (lesion outlined in red). (C) Kaplan-Meier survival curve to assess the impact of Ndp deletion in the Neurod2-Smomodel of MB (D) Schematic to illustrate the effects of Norrin/Fzd4 signalling on PtchMB progression. n.s., not significant. ECM, extracellular matrix. Scale bars, 100 µm. See also Figure 8—figure supplement 1.
DOI:
http://dx.doi.org/10.7554/eLife.16764.017
Confocal images of triple staining for Pax6, CD31 and EdU in lesions from P14 Ptch(n = 2) and Ndp (n = 3) mutants pulsed with EdU prior to sacrifice. Top row depicts composite maximum intensity projections, and boxed areas are shown below as individual z-stack slices. Scale bars, 10 µm.
DOI:
http://dx.doi.org/10.7554/eLife.16764.018
Figure 8—figure supplement 1.
Proliferating GNPs are present in the vicinity of blood vessels in Ptchand Ndp lesions .
Confocal images of triple staining for Pax6, CD31 and EdU in lesions from P14 Ptch(n = 2) and Ndp (n = 3) mutants pulsed with EdU prior to sacrifice. Top row depicts composite maximum intensity projections, and boxed areas are shown below as individual z-stack slices. Scale bars, 10 µm.
DOI:
http://dx.doi.org/10.7554/eLife.16764.018
Loss of Norrin signalling accelerates the transition to malignancy in Ptch lesions.
(A) Immunostaining and quantification of proliferation (PH3; n=7 Ptchlesions and n=11 Ndp lesions), apoptosis (cleaved caspase 3; n=7 Ptchlesions and n=11 Ndp lesions) and differentiation (neuronal nuclear protein NeuN; n=10 Ptchlesions and n=12 Ndp lesions) on P14cerebellar lesions (outlined in white) counterstained with Hoescht (blue). Areas in red boxes are magnified at right. Means are denoted by black horizontal lines on graphs. (B) Frequency of Ptch loss of heterozygosity (LOH) in lesions of P14Ptch and Ndpmice, determined by wild-type allele-specific detection of Ptch transcripts from microdissected lesions. Example images depict a toluidine blue-stained cerebellar section pre- and post-laser capture (lesion outlined in red). (C) Kaplan-Meier survival curve to assess the impact of Ndp deletion in the Neurod2-Smomodel of MB (D) Schematic to illustrate the effects of Norrin/Fzd4 signalling on PtchMB progression. n.s., not significant. ECM, extracellular matrix. Scale bars, 100 µm. See also Figure 8—figure supplement 1.DOI:
http://dx.doi.org/10.7554/eLife.16764.017
Proliferating GNPs are present in the vicinity of blood vessels in Ptchand Ndp lesions .
Confocal images of triple staining for Pax6, CD31 and EdU in lesions from P14Ptch(n = 2) and Ndp (n = 3) mutants pulsed with EdU prior to sacrifice. Top row depicts composite maximum intensity projections, and boxed areas are shown below as individual z-stack slices. Scale bars, 10 µm.DOI:
http://dx.doi.org/10.7554/eLife.16764.018To address whether the tumor inhibitory effect of Norrin/Fzd4 signaling extends to models of Shh-MB that do not require Ptch LOH for progression, we used the Neurod2-Smo transgenicmouse, a Shh-MB model where an oncogenic form of Smoothened with an activating point mutation SmoA1 is expressed in GNPs (Hallahan et al., 2004). Deletion of Ndp dramatically accelerated cerebellar tumorigenesis in Neurod2-Smo mice, reducing mean latency almost 5-fold, from 167 to 34 days (Figure 8C). Thus, the tumor inhibitory effects of Norrin signaling extend to oncogene-driven Shh MB.
Discussion
A novel link between stromal signalling and MB initiation
Stromal elements are increasingly recognized as critical to the initiation and progression of many tumor types, however little is known about the contribution of the microenvironment to MB evolution. By exploiting the multi-step nature of tumorigenesis in the Ptchmouse model, we have described a novel stromal interaction regulating Ptch MB initiation and identified a previously unrecognized angiogenic component to the earliest tumorigenic events in the MB microenvironment (Figure 8D). We uncovered a cellular mechanism behind this effect, identifying endothelial cells as the mediators of a potent tumor inhibitory signal that acts during preneoplasia and oncogenic transformation. Furthermore, we identified the Norrin/Fzd4 pathway as an endogenous signalling axis that can be manipulated to target this pre-tumor/stromal relationship. The importance of Wnt signalling in brain tumor vasculature has been demonstrated in established humanglioma, where tumor cell-derived Wnt ligand normalizes vasculature and inhibits angiogenesis (Reis et al., 2012), and in Wnt-MB, where tumor cells secrete Wnt inhibitors to disrupt BBB stability (Phoenix et al., 2016). Here we have extended the concept of tumor-stroma crosstalk via Wnt signalling to the earliest stages of tumorigenesis in the brain.
Norrin/Fzd4 signalling and human tumor progression
Mutations in Norrin/Fzd4 pathway components cause a spectrum of human pathologies, including vascular disorders with retinal and cerebellar phenotypes (Gilmour, 2015; Liu et al., 2010; Romaniello et al., 2013). However, the role of this signalling axis in the vasculature has not been explored in humantumorigenesis. Based on our data, one might predict an inverse relationship between NDP levels and outcome in humanShh-MB (such as earlier age of onset or reduced survival). While we did observe a trend towards reduced survival in Shh-MB patients with the lowest levels of NDP transcript, NDP mRNA levels are generally high in humanShh-MB, suggesting a potential protective role for this pathway. However, transcript abundance may not be a universal indicator of Norrin pathway activation. Notably, the activities of several angiogenic factors, including VEGF and FGF, are regulated at the level of protein bioavailability (Hynes, 2009), requiring release from the ECM to mediate angiogenesis in pre-tumor lesions (Bergers et al., 2000; Nozawa et al., 2006). Interestingly, Norrin also associates with the ECM (Perez-Vilar and Hill, 1997). We also note that, given the clonal evolution patterns resulting in tumor heterogeneity within established mouse and humanShh-MB (Wu et al., 2012), early initiation events will not necessarily be reflected in expression profiles of the evolved tumors in patienttumor banks. Nonetheless, given the known role of Wnt-mediated neural/endothelial crosstalk in CNS vascular development and pathology (Engelhardt and Liebner, 2014; Phoenix et al., 2016; Ye et al., 2010b), our work highlights the importance of further examining the Norrin/Fzd4 pathway in the human MB progression, including a potential prophylactic role in susceptible individuals.
The preneoplastic niche and PtchMB initiation
Ptch MB incidence and latency can be altered by modulating several pathways involved in proliferation and DNA damage (Ayrault et al., 2009; Briggs et al., 2008; Uziel et al., 2005; Wetmore et al., 2001); however there are few factors known to conclusively impact the number of preneoplastic lesions or their transition to malignancy. Ptch lesion induction is known to be mediated by growth or differentiation regulators [Igf1, Ccnd1, Tis21 (Farioli-Vecchioli et al., 2012; Pogoriler et al., 2006; Tanori et al., 2010)] and by radiation or interference with DNA repair (Malek et al., 2011; Pazzaglia et al., 2006a; 2006b), whereas progression of lesions to malignancy is enhanced by the growth promoting factors Igf2, Mycn, Shh co-receptor Boc and by the evasion of p53-induced senescence (Corcoran et al., 2008; Kessler et al., 2009; Mille et al., 2014; Tamayo-Orrego et al., 2016). Here, we introduce the concept that a permissive preneoplastic microenvironment will significantly enhance Ptch lesion induction and tumor initiation. We have linked the pro-tumor stroma induced by loss of Norrin/Fzd4 signalling to increased GNP proliferation and accelerated Ptch LOH, both events that are known to increase the incidence and decrease latency of Ptch MB (Ayrault et al., 2009; Mille et al., 2014; Pazzaglia et al., 2006a; 2006b; Uziel et al., 2005). These data add to accumulating evidence that development of an oncogenic niche supports the growth and transformation of preneoplastic cells (Barcellos-Hoff et al., 2013). Although beyond the scope of our study to investigate in detail, the persistence of stromal changes in Ndp+/− established tumors highlights the relevance of examining the ongoing role of tumor-stroma crosstalk in the growth of MB.
Blood vessels as mediators of tumorigenesis in the Ptch cerebellum
We have identified several Norrin/Fzd4-dependent stromal abnormalities associated with MB initiation, and our data suggest that disrupting the paracellular barrier property of the endothelium alone is not causal. Similarly, a recent study showed that modulation of Wnt-mediated BBB characteristics in orthotopic transplants of established mouse MB did not impact the tumor incidence or survival (Phoenix et al., 2016). We recognize that Ptch vascular endothelial cells in the germ-line Ptch model may exhibit elevated Hh pathway activity; however this is a positive regulator of BBB formation (Alvarez et al., 2011). Furthermore, our data showing dramatic acceleration of tumor formation upon deletion of Ndp from the Neurod2-Smo MB model demonstrate that Norrin-dependent effects on tumorigenesis are independent of Ptch status in the endothelium. We also note that while Ptx treatment disrupted junctional protein expression in the cerebellar endothelium, this was not accompanied by induction of PLVAP, therefore we cannot rule out transcellular permeability as a possible feature of the pro-tumor stroma, or the possibility that the severity of BBB disruption is important.Our work suggests that attenuation of Wnt signaling in endothelial cells and vascular invasion are endogenous factors regulating Ptch lesion progression. These data are consistent with the finding that, although Norrin activity is not fully absent in Ptch lesions (indicated by a largely intact BBB) Ndp expression is downregulated as a function of tumorigenesis. The exact mechanism by which endothelial cells deficient in Norrin/Fzd4 signalling could alter the Ptch preneoplastic niche and affect GNPs remains to be determined. In Tie2Cre+;Fzd4 mutants, we detected rare foci of disrupted morphology involving EGL-associated vessels, suggesting that surface vasculature adjacent to the EGL is particularly susceptible to Norrin-mediated instability. Thus, the interaction between Ptch GNPs and endothelial cells lacking Norrin/Fzd4 pathway activation may provide a unique setting for lesion growth and vascular invasion. Interestingly, previous work analyzing the transcriptomes of Fzd4 versus Fzd4 WT endothelial cells isolated from the adult mouse retina and P16 cerebellum (Ye et al., 2009) showed that Fzd4-deficient endothelial cells exhibit transcript enrichment for genes known to promote both GNP growth (Igf1) and angiogenesis (Angpt2 and Esm1, both of which were upregulated in Ndp+/− versus Ptch+/− MB). However, we have not ruled out the possibility that inflammation is involved. The Tie2Cre driver used to delete Fzd4 is also expressed in hematopoietic lineages (Tang et al., 2010), which, combined with our observation of leukocyte accumulation in Ndp/Fzd4-deficient lesions, leaves open the prospect of an immune cell-mediated component within the pro-tumor stroma.
The permissive preneoplastic niche: A recurring feature of multistage tumor models
In tumors with defined stages of progression, such as pancreatic and breast cancer, the interaction between preneoplastic cells and their surrounding stroma is recognized as a critical modulator of tumor evolution (Coussens et al., 1996; Gullino, 1978; Hanahan and Folkman, 1996; Lin et al., 2006). Mouse models of these tumors have shown that the angiogenic switch, in particular, occurs prior to malignancy and may be a rate limiting step for tumor initiation (Giraudo et al., 2004; Hanahan et al., 1996; Lin et al., 2006; Smith-McCune et al., 1997). Here, we examined cerebellar lesions at the earliest stage that they are consistently detected in the Ptch cerebellum, P14. At this stage, although we detected a modest increase in proliferation and accelerated Ptch LOH in Ndp mutants, we did not find that disruption of Norrin/Fzd4 activity was associated with an increase in lesion volume. These data reflect previous studies in pancreatic and breast tumor models, where the angiogenic switch was not correlated with size in early-stage lesions, but was instead associated with, and required for, the transition from preneoplasia to malignancy (Folkman et al., 1989; Lin et al., 2006). Following this transition, transformed lesions will clearly have a growth advantage. The mechanism by which blood vessels in the pre-tumor microenvironment can promote transformation is not defined. Undoubtedly, further delineating the molecular events mediating crosstalk between preneoplastic cells and stromal elements will be important for understanding tumorigenesis in multiple cancers.
Materials and methods
Mice
All experiments were approved by the University of Ottawa Animal Care Ethics Committee and adhered to the guidelines of the Canadian Council on Animal Care (CCAC). Ndpmice (RRID:MGI:4414648), generated by disruption of the Ndp locus by a lacZ-containing cassette were obtained from Lexicon Pharmaceuticals (Junge et al., 2009) and maintained by interbreeding on a mixed background. Ndp is an X-linked gene, therefore Ndp males and females have Ndp and Ndp genotypes, respectively. Ndp males were used for lacZ-based reporter expression analysis in Figure 1. Ndp females are infertile, therefore the experimental cross to generate Ndp compound mutants and littermate controls must be performed by crossing Ndp females with Ptch males. Thus, the Ndp and Ndp genotypes are restricted to male mice carrying the Ndp allele, whereas additional controls include both sexes. Ptch (RRID:MGI:2177702), Tie2Cre (RRID:IMSR_JAX:008863), Atoh1Cre (RRID:IMSR_JAX:011104), and Fzd4 (RRID:MGI:4412187), mice were obtained from Jackson Laboratories and maintained on a C57BL/6 background. Tie2Cre+;Fzd4females are infertile, therefore Tie2Cre+;Fzd4compound mutants were generated by crossing Fzd4 females with Tie2Cre+;Fzd4 males. Neurod2-Smo mice (Hallahan et al., 2004) were maintained as homozygotes (RRID:MGI:3831004), crossed with Ndp females, and tumors were monitored in Neurod2-Smo and Neurod2-Smo littermates. In every experiment, all compound mutants were compared to single mutant or wild-type controls from the same breeding cohort to ensure matched backgrounds. In Kaplan-Meier survival curve studies, mice were continually monitored and sacrificed upon display of advanced tumor symptoms or other adverse health effects as per CCAC endpoint guidelines. All animals were dissected to confirm presence or absence of medulloblastoma.
For fixed tissue, pups younger than 14 days old were decapitated and brains were removed and placed directly into fixative. Animals 14 days and older were anesthetized and cardiac perfusion was performed using 10 ml of PBS then 10 ml of fixative, followed by dissection of the brain. Brains used for histological stains, Evans Blue visualization, in situ hybridization or immunostaining were then fixed in 4% paraformaldeyhyde (PFA) overnight at 4°C, whereas brains used for X-gal staining were fixed in 2% PFA with 2 mM MgCl2 and 1.25 mM EGTA (ethylene glycol tetraacetic acid) for 45 min at 4°C. All tissues were then washed in PBS, cryoprotected in 30% sucrose/PBS overnight at 4°C, and embedded in a 50:50 mixture of OCT:30% sucrose by freezing in chilled 2-methylbutane. For fresh frozen tissue, unfixed brains were dissected and embedded as described above. If used for immunostaining, cardiac perfusion was performed using 10 ml of cold PBS before dissection. For laser capture microdissection, tissue was immediately dissected and embedded without perfusion, for maximum RNA integrity.
Granule neuron progenitor (GNP) isolation
GNPs from the EGL or lesion-associated GNPs from P14 and P30Ptchmice were purified from cerebella by percoll gradient separation and pre-plating, as described previously (Oliver et al., 2005). Cells were then transferred to PDL-coated glass coverslips to proceed with immunostaining, or pelleted and immediately resuspended in lysis buffer for subsequent RNA extraction.
Immunostaining
PFA-fixed brain tissue
(immunostains in Figure 1, Figure 3 top row, Figures 7 and 8) Brains were sectioned sagittally in a Leica CM1850 cyrostat at 12 µm onto Superfrost Plus positively charged slides (Fisher Scientific), air dried for 1–2 hr, and stored with desiccant at −20°C. Prior to immunostaining, antigen retrieval was performed in 10 mM sodium citrate buffer (pH 6) in a rice steamer. Slides were blocked with 10% normal serum in TBLS (tris-buffered saline containing 1% bovine serum albumin and 10 mM lysine) for 30 min at room temperature, and antibodies were diluted in TBLS and incubated overnight at 4°C. Sections were incubated with Alexa fluor secondary antibodies (Molecular Probes) at 1:1000 for 1 hr at room temperature, and nuclei were stained with Hoescht before coverslipping with fluorescence mounting medium (Dako S3023). For co-immunostains, both primaries and both secondaries were incubated simultaneously.The following modifications were performed for peroxidase-based immunohistochemistry (IHC): Before blocking, endogenous peroxidases were quenched by incubating slides in 0.3% hydrogen peroxide in PBS for 15 min at room temperature. Biotinylated secondary antibodies were used at 1:200 (Dako), followed by incubation with avidin-biotin peroxidase (Vector Laboratories, PK-4000) for 40 min at room temperature, color development with 2.5% diaminobenzidine, and a brief counterstain with hematoxylin before mounting in 50:50 glycerol:PBS.
Acetone-fixed brain sections
(immunostains in Figure 3B, Figure 5, Figure 6, Figure 3—figure supplement 1, Figure 5—figure supplement 1 and 2, Figure 6—figure supplement 1 and 2, Figure 7—figure supplement 2, and Figure 8—figure supplement 1) Fresh frozen brains were cryosectioned at 12 µm onto Superfrost Plus positively charged slides (Fisher Scientific), air dried for 1–2 hr, and slides were dipped in acetone for 20 s prior to storage at −80 until staining. Before staining, slides were fixed in ice cold acetone for 10 min, washed in ice cold 70% ethanol for 5 min followed by several washes in room temperature PBS, and blocked with 10% normal serum in PBS. Primary antibodies were diluted in 3% normal serum and incubated overnight at 4°C, followed by secondary detection and mounting as described above. For the Pax6/CD31/EdU triple stain, (Figure 8—figure supplement 1), the EdU was detected immediately following Pax6/CD31 immunostaining, using the Molecular Probes Click-iT EdUAlexa Fluor 647 Imaging Kit according to manufacturer’s instructions.
GNP immunostaining (Figure 2)
Once purified, GNPs were allowed to sit on PDL-coated glass coverslips for 2 hr in culture media, followed by the addition of 10 mM of anti-Fzd4 or anti-KLH antibodies to the media for 15 min, washing in PBS, fixation in 4% PFA, and secondary detection and mounting as described above.
Eyes were removed and fixed in 2% PFA for 5 min. Retinae were dissected in 2X PBS, flattened by radial incisions, and stored in −20°C methanol until staining. Retinal whole-mounts (n = 3 biological replicates from each treatment, αFzd4 or αKLH) were blocked for 1 hr with 10% serum, 0.5% Triton-X, and 0.5% Tween-20 in PBS, incubated with Isolectin GS-IB4 Alexa Fluor 594 Conjugate (1:100, Life Technologies I21413), transferred to slides, and coverslipped with Dako fluorescence mounting medium.
X-gal staining (Figure 1)
Slides with 12 µm cryosections of 2% PFA-fixed brains were air-dried for 1 hr, placed in X-gal reaction buffer (1 mg/ml X-gal with 5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, 2 mM MgCl2, 0.02% IGEPAL, 0.01% sodium deoxycholate in 0.1 M phosphate buffer), incubated overnight at 37°C, then washed and mounted with 50:50 glycerol:PBS. For co-X-gal/IHC stains, IHC was performed as described above, immediately after incubation in X-gal reaction buffer. For each X-gal stain or X-gal/IHC co-stain, at least 4 separate sections from n = 3 cerebella were examined.
In situ hybridization (Figure 3)
Digoxigenin (DIG)-labeled antisense RNA riboprobes were prepared by in vitrotranscription from linearized plasmids containing complete or partial cDNA sequences of the following mouse genes: Atoh1 (a gift from Dr. Carol Schuurmans), Mycn, and Ccnd1. ISH was performed as previously described (Jensen and Wallace, 1997), with the following modifications: Slides were incubated 1 to 5 hr in staining buffer containing NBT and BCIP, and slides were mounted in 50:50 glycerol:PBS. For each probe, at least 3 separate sections from n = 3 tumors were examined.
Image acquisition
Brightfield images were visualized using an Axioplan microscope and captured with an Axiocam HRc camera. Fluorescent images were visualized using an AxioImager M1 microscope and captured with an Axiocam HRm camera, or a Zeiss AxioImager M2 microscope and Axiocam MRm camera. For the analysis of CD31/PH3 expression in Figure 5, CD31/Lef1 expression in Figure 6—figure supplement 2, and Pax6/CD31/EdU expression in Figure 8—figure supplement 1, images were captured using an LSM 780 confocal. Retinal whole-mount images were captured using an LSM 510 confocal. (All equipment from Carl Zeiss Inc.). Whole brain images of were captured using a Canon PowerShot SD1400 IS digital camera. Images were processed using Photoshop CS6 (Adobe).
Fzd4 blocking antibody, pertussis toxin (Ptx) and EdU administration
Anti-Fzd4 and anti-KLH control antibodies were generated as described (Paes et al., 2011), and functionally tested in vivo before use (Figure 7—figure supplement 1). Antibodies were diluted in PBS to 3 mg/ml immediately prior to administration, and injected intraperitoneally at a dose of 30 mg/kg. Ptch animals in lesion studies were injected once at P7, whereas Ptch animals in the Kaplan-Meier survival study were injected at P7 followed by a booster dose at P16, an age when the phenotypic effects of a P7 injection are still present (Paes et al., 2011). Ptx was diluted in PBS to 5 mg/ml and pups received intraperitoneal injections of 120 ng Ptx or PBS vehicle control at P7, P9, P11 and P13. Animals were injected intraperitoneally with a dose of 10 mg/kg EdU 4 hr prior to sacrifice.
EGL/lesion measurements and analysis of immunostains
For EGL/lesion measurements, sagittal 12 µm serial sections of cerebella were collected and examined along the mediolateral axis at intervals 144 µm apart, by hematoxylin and eosin (H and E) or cresyl violet staining, and blinded images at 5x magnification were captured. To quantify EGL thickness, three images (at identical locations at the cerebellar vermis between lobules VII and VIII) from n = 3 animals per genotype were measured. To quantify lesion number or volume, lesions were carefully followed continuously along the entire mediolateral axis, and scored as an individual lesion only if they remained spatially separate from all other lesions in every section. Lesion volume (mm3) was calculated by measuring the 2-D area (mm2) of each lesion section using ImageJ, multiplying it by the thickness separating each section from its neighbor (0.144 mm) to obtain the volume of each slice, and adding the individual slice volumes to obtain a total volume. To assess the vascularized, leaky vessel or CD45 accumulation status of the lesions, sagittal sections between 100 and 250 µm apart were examined along the entire mediolateral axis for Evans blue accumulation or stained with markers (anti-ColIV, laminin, CD31, PLVAP or CD45) to sample the entire lesion. To quantify lesions for PH3, cleaved caspase-3, NeuN, CD31, laminin or PLVAP immunostaining, or to examine PDGFRβ immunostaining, 3 to 4 blinded sections from each lesion at 10x or 20x magnification were analyzed. Using ImageJ, the number of PH3+ cells per unit area or percent area stained for caspase-3, NeuN, CD31, laminin or PLVAP were determined. Quantification involving lesion vasculature included all lesion-associated vessels, whether they were 1) on the outer surface of the cerebellum, 2) deeper into the cerebellar folds but still meningeal, or 3) growing into the 'lesion proper.' To quantify the number of PH3+ or Lef1+ cells per endothelial area, 3 sections per lesion were first imaged at 20x magnification by epifluorescence to measure endothelial cell area via tracing of CD31+ vessels, and identify potential double labelled candidates. Sections were then examined by confocal microscopy to confirm double-labelled cells.
Evans Blue injections and visualization
A 2% wt per volume Evans Blue (Sigma) solution in 0.9% saline was administered by intraperitoneal injection at 4 µl per gram of body weight and allowed to circulate overnight. Following perfusion and fixation in 4% PFA as described above, whole brains were photographed and 12 µm cryosections were then visualized under the far red fluorescence filter. The same or immediately adjacent section was H and E- or anti-ColIV-stained to provide a matched image.
Laser capture microdissection
Fresh frozen cerebella were sectioned at 10 µm onto Superfrost microscope slides (Fisher Scientific) and placed immediately on dry ice before storage at −80°C for no more than 5 days before microdissection. Sections were stained and dehydrated by passing through RNase-free coplin jars with solutions made in DEPC-treated distilled water, as follows: 30 s in 75% ethanol, 30 s in distilled water, 2 min in 1% toluidine blue in distilled water, 30 s in distilled water, 30 s in 75% ethanol, 30 s in 95% ethanol, 1 min in 100% ethanol (2 times), and 5 min in xylene. All staining solutions except xylene contained RNase inhibitor (Sigma R7397). Slides were immediately microdissected using the ArcturusXT laser capture microdissection system (Life Technologies) in infrared mode, according to the manufacturer’s instructions. Six to 10 sections from each lesion were captured onto CapSure macro LCM caps (Life Technologies), transferred immediately to RLT plus lysis buffer (Qiagen) with β-mercaptoethanol, briefly vortexed, and stored on dry ice until RNA extraction.
RNA purification and quantitative RT-PCR
For microdissected lesion tissue, total RNA was extracted using the RNeasy Plus Micro kit (Qiagen) with genomic DNA eliminator columns, and amplified complementary DNA (cDNA) was prepared with the Ovation Pico WTA System V2 (NuGEN) according to the manufacturer’s instructions. RNA integrity was assessed by an Agilent 2100 Bioanalyzer (Agilent Technologies) from slide scrapes. For all other samples, total RNA was extracted from freshly isolated/dissected GNPs, cerebellar tumor (with careful preservation of clean margins) or retina tissue using the RNeasy Mini Kit (Qiagen). First-strand cDNA was synthesized using the QuantiTect Reverse Transcription Kit (Qiagen), with and without reverse transcriptase to assess genomic contamination during downstream RT-PCR. For all samples, target gene mRNA levels were determined by quantitative RT-PCR (qRT-PCR) using iQ SYBR Green Supermix (Bio-Rad) and a MyiQ iCycler (Bio-Rad). Primer pairs were designed using PRIMER-blast (http://www.ncbi.nlm.nih.gov/), and are as follows:Gapdh F: GGCCGGTGCTGAGTATGTCG, Gapdh R: TTCAAGTGGGCCCCGGCCTT, Ndp F: CCCACTGTACAAATGTAGCTCAA, Ndp R: AGGACACCAAGGGCTCAGA,Fzd4 F: GACAACTTTCACGCCGCTCATC, Fzd4 R: CCAGGCAAACCCAAATTCTCTCAG, Lrp5 F: GAGGAGTTCTCAGCCCATCC, Lrp5 R: GATCAGGGGAGCAGGTAGGA, Tspan12 F: GATTGCTGTCTGCTGCTTCC, Tspan12 R: ACTGTACTGGCACCATAACCTC, Ptch1 exons2-3 F: CTCCTCATATTTGGGGCCTT, Ptch1 exons2-3 R: AATTCTCGACTCACTCGTCCA, Gli1 F: ACATGCTGGTGGTGCACAT, Gli1 R: AGGCGTGAATAGGACTTCCG, Mycn F: GCGGTAACCACTTTCACGAT, Mycn R: AGTTGTGCTGCTGATGGATG, Esm1 F: ACAGGGTGACCGGAAGATGT, Esm1 R: AGTCACGCTCTGTGTGGGAG, Plvap F: TGACTACGCGACGTGAGATG, Plvap R: CTCGCTCAGGATGATAGCGG,Emcn F: CTCCCGAAGGAACGACCAAAA, Emcn R: GGACCTTCAGTTGTTGTTCCCPecam1 F: GGAATACCAGTGCAGAGCGG, Pecam1 R: CCTCGTTACTCGACAGGATGG,Angpt2 F: AGAGGAGATCAAGGCCTACTGT, Angpt2 R: GCCATCTTCTCGGTGTTGGA.Primers were optimized using a 5-point standard curve of 2-fold diluted composite cDNA from relevant tissue and deemed acceptable with an R2 > 0.95, a percent efficiency between 90-110%, a sharp single point melt curve, positive controls with Ct values > 10 cycle difference compared to no RT control samples, and expected amplicon size by agarose gel electrophoresis. All samples were run in triplicate, normalized to Gapdh, and quantified relative to the reference tissue indicated. During qRT-PCR for microdissected lesions, the expression of genes known to be highly expressed in lesions (Gli1, Mycn) were assessed in parallel to Ptch, along with microdissected tumor samples known to have Ptch LOH, or microdissected EGL known to have high levels of Ptch expression. Ptch LOH status was assigned by quantification relative to microdissected tumors with known LOH.
Microarray analysis of mouse tissue
Total RNA extracted from MB or GNPs was analyzed with the MouseWG-6 v2.0 Expression BeadChip array platform. Illumina BeadStudio outputs were analyzed and annotated with R packages limma (Ritchie et al., 2015) and illuminaMousev2.db version 1.26.0. Data were processed with neqc function (Shi et al., 2010). The hierarchical clustering and the principal component analysis plots were prepared from the 1500 most variable probes across all samples in terms of interquartile range, after data processing (background correction, normalization, and log-transformation), and filtering out probes annotated as Bad and No Match. Significant changing probes were detected with the linear modeling approach and empirical Bayes statistics of limma (Smyth, 2004). Gene Ontology (GO) cellular components enrichment was investigated using DAVID (Huang et al., 2009) for probes with adjusted P value below 0.05 and higher fold changes (>1.0) between Ndp and Ptchtumors. The tables in Figure 3 display the GO terms with P values<0.05. In an analogous manner we analyzed samples from purified P6 GNPs. The principal component analysis plot was prepared from the 1,500 most variable probes as above.
Human tumor samples and expression analysis
NDP expression profiles were determined across three independent cohorts with the R2 database analysis tool (http://r2.amc.nl) using publically available datasets from Heidelberg (Remke et al., 2011), Toronto (Northcott et al., 2011) and Boston (Cho et al., 2011). The following probes were used for analysis: Toronto (Affymetrix Exon 1.0 T Probe Accession: 4006280), Heidelberg (Agilent 4 x 44 k Probe Accession: A_23_P73609) and Boston (Affymetrix u133a Probe Accession: 206022_at). P values represent ANOVA across the four subgroups. Survival analysis in Figure 1 was performed on the MAGIC dataset of clinically annotated SHH tumors (Affymetrix Human Gene 1.1 ST, Probe Accession: 8172220) (Northcott et al., 2012; Vanner et al., 2014). Log2 transformed expression values of NDP were then ranked as either the bottom 10th percentile of expression versus the top 10th percentile. Survival was calculated using the log-rank method in the R-Statistical Environment (v3.1.3) using packages survival (v2.37–7) and ggplot2 (v1.0.0).
Statistics
Sample sizes are as reported in figures and figure captions. Mice were randomly assigned to either αFzd4 or Ptx treatment groups. Statistics were determined by GraphPad Prism 6 or SPSS software. The logrank test was used to generate Kaplan Meier survival curves (Figures 1, 2, 7 and 8). Lesion number (Figures 4 and 7), vessel or laminin density (Figures 5 and 6), number of endothelial PH3+ cells (Figure 5), qRT-PCR (Figures 1 – and 3) and EGL thickness (Figure 4—figure supplement 1) were analyzed by one-way ANOVA with Tukey post-hoc comparisons. Comparison of lesion volumes (Figures 1, 4 and 7), immunostain quantification (Figure 8), and tumor latency (Figures 2, 7 and 8) were analyzed by a two-tailed, unpaired Student’s t-test. The proportion of vascularized, leaky or CD45+ lesions (Figures 5 and 6) and tumor incidence (Figures 2, 7 and 8) were analyzed by the hypergeometric test. The number of endothelial Lef1+ nuclei (Figure 6—figure supplement 2) was assessed by a one-way ANOVA and Fischer’s LSD post hoc comparison. A Levene’s test for homogeneity of variance and normality tests were used to verify parameters for parametric analysis. Microarray analyses were analyzed as described above.In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.Thank you for submitting your article "Norrin/Frizzled4 signalling in the preneoplastic niche blocks medulloblastoma initiation" for consideration by eLife.Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Fiona Watt as the Senior Editor. The reviewers have opted to remain anonymous.The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission. Although the required revisions enumerated below may take a bit longer to complete than the two months we suggest as a time limit for the return of a revised manuscript, the reviewers feel the effort will be worthwhile and could strengthen the conclusions you wish to draw. Please respond with your plans to address these issues and an estimate of the length of time you will require to complete the revisions.Summary:This is a very interesting paper that addresses an under studied area of medulloblastoma (Mb) research, namely the interactions between tumor cells and the stromal environment that influence tumor incidence and growth rate. The authors convincingly show that removing the secreted factor Ndp from mice, or the Fzd4 receptor specifically in endothelial cells, results in a shorter tumor latency and increased incidence in a SHH-Mb model (Ptch1 heterozygous mice). NDP-FZD4 signaling thus appears to modify the endothelial cells in the microenvironment to be tumor protective. The demonstration of a tumor-suppressive function for NDP-FZD4 signaling in the vascular microenvironment of MB is novel, although the NDP-FZD4 signaling pathway has been shown by others to be required for maintaining the blood brain barrier in the vasculature surrounding the cerebellum. They also show that NDP expression is higher in humanSHH versus other Mb subgroups and that low NDP RNA expression trends towards lower survival of patients with SHH-MBs. They propose that vascular remodeling stimulates the transition of pre-neoplastic tissue to malignancy. However, this is based almost entirely on analyzing small lesions in P14mice, long before tumors arise and the vast majority of which will not go on to form a tumor. In addition, some of the quantification of the data and interpretation of the results does not fully support this conclusion as opposed to others. Although an ideal experiment would be to use a tumor model where NDP can be removed only in the tumor cells, the acute blocking of FZD4 and conditional deletion in endothelial cells provide support that the increased tumor incidence is not due to a developmental defect and relies on signaling to blood vessels. With additional data that support the role for vascularization, this paper will be an important contribution to the cancer field.Essential revisions:The expression pattern of Ndp-lacZ resembles HH target gene expression. If Ndp is a HH target gene, then this would mean that in Ptch heterozygotes the pathway is elevated in all cell types, and hyperactivated in tumor cells. This might explain why NDP is only highly expressed in the SHH subgroup of medulloblastoma. Given the increase in tumor incidence when Ndp is removed in mice and proposed resulting increase in vascularization, loss of BBB and increased LOH in early lesions raises the question of whether the SHH-subgroup tumors have more or less blood vessels than other subgroups and whether blood vessel content and BBB correlates with NDP expression levels in SHH-MB. If human MB sections/samples are not available, gene expression analysis of humantumors should be performed (as was done for the mouse microarray data) to determine whether blood vessel marker genes are differentially expressed in the SHH-subgroup, and whether NDP expression levels correlate with blood vessel and BBB markers.Similarly, given that all MBs are vascularized, and the BBB was recently shown to be compromised only in the WNT subgroup (Phoenix, Cancer Cell, 2016) the expression data presented suggest that in the Group3 and Group4 Mb, BBB integrity is maintained by a signaling mechanism not involving NDP-FZD4. Can the Taylor and Northcott groups mine their human Mb expression data sets to analyze this further?A more detailed analysis is needed of the cell types that express Ndp using double immune staining for LacZ and markers of GNPs (PAX6) and astrocytes or endothelial cells, and in early lesions and tumor sections (RNA in situs could be used). Also, the authors need to address whether GNPs and tumor cells express the NDP receptor.The quantification of the blood vessels at P14 is a concern. Based on the images in Figure 1, there is a correlation between the amount of blood vessels and the size of the lesion. Is this generally the case? If so, the authors need to rethink their interpretation. Perhaps the size of the lesion determines whether new blood vessels (from the meninges or elsewhere) will invade the lesion. If the size of the lesion determines whether blood vessels invade, then another interpretation of the mutant studies is that Ndp/Fzd4 loss increases the likelihood of lesions forming and/or their growth rate and occurrence of LOH.The expression level of Ndp in highly vascularized lesions should be compared to those that are not vascularized. If it is not decreased in the vascularized lesions and tumors, how do the authors explain the result?Also, removal of the meninges from the quantification is problematic. In Figure 1B, 5A double mutants and 6D "angiogenic", some of the blood vessels could well be meningeal, but they are not running in a straight line because the lesions are large and likely distort or change the organization of meningeal blood vessels. If they are not included in the quantification in B, this will push the numbers away from the phenotype being claimed.The characterization of angiogenic vessels should be substantiated. Collagen IV expression was used to indicate angiogenic endothelial cell (e.g. Figure 6G,H). However, these types of vessels might be defined as remodeling vessels. Typically, to convincingly indicate an angiogenic endothelial cell, proliferation and other classical markers such as Notch ligands are needed.Figure 3A,B. Can quantification be added, especially for the vascular content? A shortcoming of the paper is that all the quantification is performed at P14, long before tumors form. RNA-seq data is presented to support that vascularization is increased in the tumors, but given the heterogeneity of tumors cells, this is problematic. For example, is there an increase in leukocytes in double mutant tumors and is vascular permeability different in tumors with and without NDP-FZD4 signaling (Evan's blue and PLVAP/CLD5 expression)? If large tumors are difficult to analyze, an earlier stage should be analyzed.Also, to better address mechanism and the question of whether the neoplastic transition coincides with recruitment/infiltration of inflammatory cells, the authors should determine if there is a correlation between the location and density of inflammatory cells (CD45-positive leukocyte) and neoplastic transition at a later stage than P14 when tumors are forming and whether there is a difference when Ndp or Fzd4 are removed.Figure 5A and 6D. The Fzd4 mutant lesions are very curious or interesting, as only the inside region has vessels. Is this seen consistently? One interpretation of 5A is that the meningeal blood vessel was split in two by premalignant cells and the vessel now surrounds the lesion. Also, are the GNPs surrounding the vessels proliferating or postmitotic and the ones invaded by blood vessels are they different?The experiment with a single dose of αFzd4 administered as late as P7 showing that it was sufficient to induce the cellular changes seen in the conditional and null mutants within 7 days (by P14) is a very striking result. It is important to determine whether LOH is increased in these lesions, in order to test whether LOH is related to the phenotype.PLVAP was upregulated in endothelial cells when NDP-FZD4 signaling was suppressed. PLVAP is known to be essential for formation of vascular fenestration. Does PLVAP upregulation increase fenestration in the mutant tumor vasculature?[…] Essential revisions:The expression pattern of Ndp-lacZ resembles HH target gene expression. If Ndp is a HH target gene, then this would mean that in Ptch heterozygotes the pathway is elevated in all cell types, and hyperactivated in tumor cells. This might explain why NDP is only highly expressed in the SHH subgroup of medulloblastoma. Given the increase in tumor incidence when Ndp is removed in mice and proposed resulting increase in vascularization, loss of BBB and increased LOH in early lesions raises the question of whether the SHH-subgroup tumors have more or less blood vessels than other subgroups and whether blood vessel content and BBB correlates with NDP expression levels in SHH-MB. If human MB sections/samples are not available, gene expression analysis of humantumors should be performed (as was done for the mouse microarray data) to determine whether blood vessel marker genes are differentially expressed in the SHH-subgroup, and whether NDP expression levels correlate with blood vessel and BBB markers.Similarly, given that all MBs are vascularized, and the BBB was recently shown to be compromised only in the WNT subgroup (Phoenix, Cancer Cell, 2016) the expression data presented suggest that in the Group3 and Group4 Mb, BBB integrity is maintained by a signaling mechanism not involving NDP-FZD4. Can the Taylor and Northcott groups mine their human Mb expression data sets to analyze this further?The relationship between tumor group and blood vessel density has been addressed recently by Phoenix et al. (2016), who used quantitative IHC on sectioned tumor tissue and showed that the vascular density of human Wnt MBs was 4 times greater than that of humanShh, Group 3 or Group 4 MBs and that Wnt, but not Shh tumors, have disruption of the BBB. These tumor subtype-dependent vascular phenotypes were associated with altered expression of secreted Wnt inhibitors, with higher levels reported in Wnt MB. Our study extends this concept to implicate Ndp expression as another factor that contributes to BBB integrity in mouse and humanShh MB.The reviewers raise an excellent point regarding the impact of Ndp levels on vascularity and BBB integrity within the humanShh MB group. Because is not feasible to compare Ndp high and low tumor material by IHC, we addressed whether there were differences in gene expression between NDPlow and NDPhigh Shh MB, albeit looking at bulk tumor, from which the overwhelming majority of signal will be from tumor cells rather than from the vasculature. This analysis revealed few (6) differentially expressed genes, only one significantly enriched geneset (phosphoinositide binding) and no significant enrichment for a specifically curated angiogenesis geneset.That we did not detect significant changes in angiogenic or BBB genes could be due to the small sample size of Ndplow tumors and the low frequency of endothelial cells within tumors. Consistent with the latter point, we note that in the Phoenix et al. (2016) study, the differences in vascularity/BBB between MB subtypes was not identified on the basis of gene expression analysis from whole tumor transcriptome data.Although the reviewer makes interesting suggestions, as all of the published genomic data was generated using bulk tumor, our ability to mine for cell lineage/signaling pathways that could regulate BBB integrity in Group 3 and 4 tumors, is likely not feasible and is certainly a multi-year undertaking that would be more appropriate for future studies.A more detailed analysis is needed of the cell types that express Ndp using double immune staining for LacZ and markers of GNPs (PAX6) and astrocytes or endothelial cells, and in early lesions and tumor sections (RNA in situs could be used). Also, the authors need to address whether GNPs and tumor cells express the NDP receptor.[…]The expression level of Ndp in highly vascularized lesions should be compared to those that are not vascularized. If it is not decreased in the vascularized lesions and tumors, how do the authors explain the result?Additional (paraphrased) comments from editor:How reliable is the Ndp-LacZ as a reporter for Ndp expression?Were males used for the Ndp-LacZ reporter analysis?Why were the RT-PCR data for Ndp expression normalized to Ndp KO samples?The expression of NDP in humanmedulloblastoma is the same as in adult cerebellum, so that would indicate it is quite low.Given that the Ndp KO allele is the lacZ reporter allele, why have the authors not analyzed lacZ expression in the early lesions or medulloblastoma samples in males mutant for Ndp (on the X chromosome) or the control female littermates they should have that are heterozygous for the KI allele and Ptch1+/-?At this point, the editor thinks that the author's idea of analyzing Lef1 expression (a canonical Wnt target) in vascularized and non-vascularized Ptch+/- lesions is a good one, but would like to hear a response to the comments above and see some definitive proof added to the paper that Ndp is expressed in GNPs and early lesions.1) Provide evidence that Ndp and signaling pathway components are expressed in GNPs.We show that β-gal activity from the Ndp-LacZ reporter overlaps with expression of proliferation (Ph3) and GNP (Pax6) markers in the EGL of the developing cerebellum (Figure 1D). The reviewer raises the question of whether the design of the Ndp-LacZ knockin allele results in a faithful reporter for this gene. While the presence of the targeting cassette can interfere with transcription of the locus, it would result in a reduction of reporter gene expression rather than ectopic expression. Thus, even if the Ndp-LacZ allele is under reporting the expression of this gene, we are still able to detect reporter expression in the EGL. We also clarify that male Ndp-/Y mice were used for the reporter gene analyses.We agree that it would be desirable to corroborate the Ndp-LacZ reporter expression with RNA in situ hybridization or IHC for Ndp with lineage markers. Despite several attempts, this approach has not been successful. Because of these limitations we used q-RT-PCR to confirm the presence of transcripts for Ndp in purified GNPs and established MB (Figure 1E). In the original submission we normalized the NDP expression levels against NDP KO samples because the primers we used do not amplify the null allele. Because representing the data in this manner is unconventional (and confusing), we now report the Ndp levels relative P7 GNPs (after normalizing to Gapdh) (revision, Figure 1E). While transcript levels are reduced in MB relative to P7 GNPs, they are still detectable (average Ct values: P7 GNPs, 24.0 Ndp, 17.3 Gapdh n= 4; MB, 26.5 Ndp, 19.0 Gapdh, n=4). Moreover, our expression data is corroborated in published gene expression dataset where Ndp expression is detected in GNPs and MB (GSE2426 (Oliver et al., 2005);GSE34126 (Pei et al., 2012)).2) Do GNPs and tumor cells express the NDP receptor?We used q-RT-PCR to detect transcripts for Fzd4, Lrp5 and TSPAN12 in purified GNPs and MB samples (Figure 2E). We also now provide new data showing IHC for Fzd4 in purified GNPs (revision, Figure 2D).In summary, we are confident in concluding that GNPs and MB express Ndp and components of the NDP signal transduction pathway.3) What cell types in the cerebellum express NDP?The identity of the other Ndp-expressing cells in the cerebellum is interesting, but not easily resolved given the technical challenges we describe above. However, Phoenix et al. (2016) reported Ndp expression in endothelial cells isolated from mShh and mWnt MB. Moreover, the pattern of reporter activity in an Ndp-AP reporter mouse line is consistent with expression of this gene in Bergman glia (BG) (Ye et al., 2011). Unfortunately, the distribution of the AP reporter activity in BG obscures signal in the EGL (the BG fibers extend into the EGL), therefore one cannot draw conclusions about expression in the GNPs residing in the EGL is the Ndp-AP reporter line. While the cellular source of Ndp that mediates BBB stability is an important question, addressing it would require cell type-specific inactivation of Ndp in GNPs and BG, which it is beyond the scope of the current study.4) What is the relationship between Ndp expression and vascular state of lesions in Ptchmice and if Ndp expression is not changed then how do we account for the vascularization of lesions in Ptchmice.The reviewer raises an excellent point regarding the relationship between Ndp expression and lesion vascularization in Ptchmice. However, in light of the technical challenges of detecting Ndp expression (outlined above) and because we cannot use X-gal staining from the Ndp-LacZ reporter in the Ptch background (the mutant Ptch allele is also a lacZ knock in), it is not feasible to use this approach to monitor Ndp expression in lesions in situ. Therefore, we have used two complimentary approaches to address this issue. First, we compared Ndp expression levels by q-RT-PCR in wildtype GNPs and Ptch GNPs isolated from the cerebellum along a continuum of tumorigenic stages. Here we find that Ndp expression is reduced as a function of tumor progression, with lower levels of Ndp detected in lesion stage GNPs at P30 and MB relative to P7-P14 GNPs (revision Figure 1E). Second, we compared endothelial cell expression of Lef1, a canonical Wnt reporter marker, in vascularized and non-vascularized lesions in Ptchmice. The rationale for this approach is that it would be a general reporter of perturbed canonical Wnt signaling in endothelial cells. Here we found that there was a significant reduction in Lef1 expression in endothelial cells in vascularized Ptch lesions relative to EGL-associated vessels from non-lesion regions (revision, Figure 6—figure supplement 2). While we do not think that the reduction in Lef1 reflects a complete inactivation of endogenous Ndp/Fzd4 signaling in Ptch lesions (because we do not observe the same disruption of the BBB that we do in Ndp or Fzd4 mutants), our findings do suggest the possibility that downregulation of endogenous canonical Wnt signaling in endothelium is associated with lesion vascularization. We speculate that reduced Wnt signaling in endothelial cells sensitizes EGL-associated vessels to respond to angiogenic signals that normally drive vascularization in these lesions/tumors. Genetic disruption of Ndp/Fzd4 signaling, therefore, represents a more strongly sensitized model for this process.These experiments link our mutant mouse analysis to endogenous changes in Ptchtumor progression and strengthen our manuscript. We thank the reviewers for these suggestions.5) The authors state "Ndp- compound mutants must be generated by crossing Ndp females with Ptch males, resulting in all male (Ndp) compound mutants", which does notmake sense since half the males would receive a wild type Ndp allele from the female.We agree and have corrected this mis-statement in the Methods section.The quantification of the blood vessels at P14 is a concern. Based on the images inWe agree with the reviewer that the relationship between lesion size and vascular density is an important factor to consider. Indeed we investigated this possibility at the outset of our study, based on our data showing that lesions in the compound mutants exhibited features of more advanced tumors at early stages. It is for this reason that we compared lesion volume at P14 our double mutant models. While the vast majority of lesions are vascularized in the double mutant models (78% Ndp and 95% Tie2Cre;Fzd4 vs. 24% Ptch) we did not observe a change in lesion volume (Figure 4B,D). Therefore we would argue that vascular density and lesion volume are independent in our double mutant models, at least at this early stage in tumor evolution. To further illustrate this point, we provide examples of vascular remodeling in very small double mutant lesions (revision, Figure 5—figure supplement 2).However, in single Ptchmice we do find a significant difference in lesion volume in vascularized compared with non-vascularized lesions at P14 (revision, Figure 1B), which is consistent with the possibility that activation of angiogenesis is a progression event in single Ptchmice. This relationship is also consistent with the accelerated tumor progression we observe in Ndpmice. However, EGL proliferation (prior to lesion formation) and lesion volume are not increased in the double mutants, which argues against a simple model of vessel invasion triggered by increased growth of GNPs. We do favor the second interpretation of our findings, e.g. that altered Ndp/Fzd4 signaling in endothelial cells promotes lesion formation and an imbalance of proliferation/death resulting in a net gain of proliferation and greater opportunity for Ptch LOH and hence progression.Also, removal of the meninges from the quantification is problematic. InWe would like to clarify that we did include meningeal vessels in the quantification. Essentially all vessels in lesions whether they were 1) on the surface, 2) deeper into the folds but still meningeal, or 3) growing into the "lesion proper" were included in the quantifications. We clarify this point in the Methods section. Thus, we do not disagree that some of the vessels included in the quantification of vascular density (Figure 5C) or angiogenic score (Figure 1A, 5, 7D,H) could be displaced meningeal vessels, as opposed to newly generated vessels via angiogenesis. Moreover, even if they are displaced meningeal vessels, they do contribute to overall vessel density. We take the reviewers’ point that describing lesions as “angiogenic” is confusing, since the assignment is not based on analysis of bona fide angiogenic markers. Therefore, we revised our terminology in these figures to describe the lesions as vascularized vs. non-vascularized with the latter representing lesions where vessels are restricted to the surface.The characterization of angiogenic vessels should be substantiated. Collagen IV expression was used to indicate angiogenic endothelial cell (e.g.To address this concern we quantified mitotic (Ph3+) endothelial cells in Ptch and Ndp lesions at P14 and show that the frequency of these cells as a function of vessel area is significantly increased in the Ndp lesions (revision, Figure 5B).The reviewer raises an excellent point regarding issue of quantifying phenotypic markers in established tumors. Because of sampling bias and intra-tumoral heterogeneity it is difficult to draw conclusions regarding marker and gene expression. For the lesion analyses, all of the quantification was performed on step sections through entire lesions. However, this approach is not practical for large tumors. Therefore, we used global approaches (microarray and q-RT-PCR) and showed upregulated expression of vascular, angiogenic and BBB genes in Ndp compared with Ptch MB (Figure 3F). In addition, we also corroborated increased PLVAP expression in Ndptumors by IHC (Figure 3—figure supplement 1). It is notable that we detected an increase in PLVAP mRNA in whole Ndp MB samples, particularly since the contribution of endothelial cells relative to tumor cells is relatively small. To further illustrate the point that BBB disruption is maintained from lesion stage to MB, we now include images of whole mount Evan’s Blue staining of tumors from our mouse models (revision, Figure 3G). Taken together these data confirm that the BBB disruption and increased vascularity that we document in early lesions are maintained in established tumors with deficient Ndp/Fzd4 signaling. How these and other features, including immune infiltration, contribute to tumor growth is an excellent avenue for future investigation.Also, to better address mechanism and the question of whether the neoplastic transition coincides with recruitment/infiltration of inflammatory cells, the authors should determine if there is a correlation between the location and density of inflammatory cells (CD45-positive leukocyte) and neoplastic transition at a later stage than P14 when tumors are forming and whether there is a difference when Ndp or Fzd4 are removed.We agree with the reviewer that the relationship between inflammation and tumor progression in our model is an interesting direction to explore. We consistently observe infiltration of CD45+ cells in lesions of double mutant, but rarely single Ptchmice (revision, Figure 6D). Investigating the role of inflammation as a function of progression is a very involved undertaking that would require longer than the revision period to complete. I would trust that the reviewer would agree that this line of investigation is more appropriate for future studies.We thank the reviewer for this observation. In early lesions at P14 it is very likely that the meningeal vessels, which are already present in the area of the newly forming lesion and, notably, are most dependent on Ndp/Fzd4 signaling for BBB integrity, are involved in vascular remodeling. Therefore, it will typically look like there are more vessels in the centre of the early lesions. We provide images showing the relationship between Pax6+EdU+ (dividing GNPs) and blood vessels in lesions from Ptch and Ndpmice (revision, Figure 8—figure supplement 1). These data show that Pax6+ GNPs are located in the vicinity of blood vessels and are in S-phase (EdU+).The experiment with a single dose of αFzd4 administered as late as P7 showing that it was sufficient to induce the cellular changes seen in the conditional and null mutants within 7 days (by P14) is a very striking result. It is important to determine whether LOH is increased in these lesions, in order to test whether LOH is related to the phenotype.We thank the reviewer for this suggestion; however, we respectfully disagree that it is important to corroborate the anti-Fzd4 data with analysis of Ptch LOH. We show that the effects of perinatal anti-Fzd4 treatment on tumorigenesis phenocopies several key features associated with genetic Ndp/Fzd4 inactivation, including effects on tumor latency, incidence, lesion induction and vascularization (Figure 7A-D). Including Ptch LOH analysis in this context will not change the main conclusion of the experiment, namely that genetic as well as acute inactivation of the Ndp/Fzd4 axis accelerates Shh MB, and will, therefore, not advance the study. Moreover, the experiment that the reviewer is requesting would require nearly a year to complete, which is far longer than the time allotted for submitting a revised manuscript. However, the reviewer’s comment raises the important issue of whether the tumor inhibitory effect of Ndp/Fzd4 signaling extends to models of Shh MB that do not require Ptch LOH for progression. To address this question we used the Smo-A1 mouse, a model where Shh MB is driven by expression of an oncogenic form of Smoothened in GNPS and is independent of Ptch LOH (Hallahan et al., 2004). We find that tumorigenesis in this model is also dramatically accelerated on an Ndp deficient background (revision, Figure 8C). Based on this data we conclude that the tumor inhibitory effects of Ndp signaling extend to oncogene-driven Shh MB.PLVAP was upregulated in endothelial cells when NDP-FZD4 signaling was suppressed. PLVAP is known to be essential for formation of vascular fenestration. Does PLVAP upregulation increase fenestration in the mutant tumor vasculature?PLVAP expression has been shown to correlate with blood vessel fenestration in established MB tumors (Phoenix et al., 2016).
Authors: Yoon-Jae Cho; Aviad Tsherniak; Pablo Tamayo; Sandro Santagata; Azra Ligon; Heidi Greulich; Rameen Berhoukim; Vladimir Amani; Liliana Goumnerova; Charles G Eberhart; Ching C Lau; James M Olson; Richard J Gilbertson; Amar Gajjar; Olivier Delattre; Marcel Kool; Keith Ligon; Matthew Meyerson; Jill P Mesirov; Scott L Pomeroy Journal: J Clin Oncol Date: 2010-11-22 Impact factor: 44.544
Authors: Timothy N Phoenix; Deanna M Patmore; Scott Boop; Nidal Boulos; Megan O Jacus; Yogesh T Patel; Martine F Roussel; David Finkelstein; Liliana Goumnerova; Sebastien Perreault; Elizabeth Wadhwa; Yoon-Jae Cho; Clinton F Stewart; Richard J Gilbertson Journal: Cancer Cell Date: 2016-03-31 Impact factor: 31.743
Authors: Lara M Linden; Kacy L Gordon; Ariel M Pani; Sara G Payne; Aastha Garde; Dane Burkholder; Qiuyi Chi; Bob Goldstein; David R Sherwood Journal: Dev Biol Date: 2017-06-23 Impact factor: 3.582
Authors: Laura R Goodwin; Gerardo Zapata; Sara Timpano; Jacob Marenger; David J Picketts Journal: Front Mol Neurosci Date: 2021-07-06 Impact factor: 5.639
Authors: Chi Zhang; Maria B Lai; Michelle G Pedler; Verity Johnson; Ralf H Adams; J Mark Petrash; Zhe Chen; Harald J Junge Journal: Arterioscler Thromb Vasc Biol Date: 2018-11 Impact factor: 8.311