Literature DB >> 27822288

Xiao Yao San against Corticosterone-Induced Stress Injury via Upregulating Glucocorticoid Receptor Reaction Element Transcriptional Activity.

Guoping Cao1, Shenglan Gong2, Fengxue Zhang3, Wenjun Fu3.   

Abstract

Previous studies have revealed that uncontrollable stress can impair the synaptic plasticity and firing property of hippocampal neurons, which influenced various hippocampal-dependent tasks including memory, cognition, behavior, and mood. In this work, we had investigated the effects and mechanisms of the Chinese herbal medicine Xiao Yao San (XYS) against corticosterone-induced stress injury in primary hippocampal neurons (PHN) cells. We found that XYS and RU38486 could increase cell viabilities and decrease cell apoptosis by MTT, immunofluorescence, and flow cytometry assays. In addition, we observed that XYS notably inhibited the nuclear translocation of GR and upregulated the mRNA and protein expressions levels of Caveolin-1, GR, BDNF, TrkB, and FKBP4. However, XYS downregulated the FKBP51 expressions. Furthermore, the results of the electrophoretic mobility shift assay (EMSA) and double luciferase reporter gene detection indicated that FKBP4 promotes the transcriptional activity of GR reaction element (GRE) by binding with GR, and FKBP51 processed the opposite action. The in vivo experiment also proved the functions of XYS. These results suggested that XYS showed an efficient neuroprotection against corticosterone-induced stress injury in PHN cells by upregulating GRE transcriptional activity, which should be developed as a potential candidate for treating stress injury in the future.

Entities:  

Year:  2016        PMID: 27822288      PMCID: PMC5086362          DOI: 10.1155/2016/5850739

Source DB:  PubMed          Journal:  Evid Based Complement Alternat Med        ISSN: 1741-427X            Impact factor:   2.629


1. Introduction

In the last decade, hippocampal neurogenesis in the mature brain has attracted considerable attention [1-3]. Up to now, stress is the earliest identified and the most profound factor that can affect adult neurogenesis both positively and negatively [4, 5]. In brain, hippocampal area was crucially involved in memory and emotional information processing, which affects the abilities of generating and differentiating into multiple neural cell lineages [6]. A large number of evidences have suggested that hippocampal neurogenesis contributes to some hippocampus-dependent tasks, such as cognition and mood [7]. Uncontrollable stress exerts long-lasting changes in the brain, and it leads to behavioral, emotional, and cognitive modifications including Alzheimer's disease (AD), anxiety, and major depression through altering the synaptic plasticity and firing properties of hippocampal neurons [8]. Therefore, investigations of the underlying mechanisms of stress cascades are urgently needed for developing effective therapies of hippocampal dysfunction. The hypothalamic-pituitary-adrenal (HPA) axis and its end-effect neuroendocrine hormones, namely, glucocorticoids, are mediators of the myriad stress effects on the hippocampus [9]. Briefly, HPA axis is activated after uncontrollable stress accumulating in brain either internally or externally, and then glucocorticoid receptors (GRs) are triggered and expressed densely in the hippocampus [10]. Corticosterone, the major glucocorticoid, exerts powerful feedback effects on the HPA axis. Accumulating reports have proved that nerve cells under persistent exposure to high concentration of corticosterone can notably induce DNA damage, some protein activation, and cells apoptosis [11]. GR is the main mediator of the stress response in neuronal progenitor cells and hippocampal neurogenesis [12]. The expression level of GR directly regulates the excitation-inhibition balance, which is key for the positioning and functional integration of newborn neurons and may contribute to the chronification of paroxysmal brain diseases [13]. The hippocampal area expresses GR in a high level, so it is sensitive to the fluctuating levels of corticosterone in particular [14]. Traditional Chinese medicines (TCMs) have been used in China for thousands of years. Due to the advantage of high efficiency and low toxicity, TCMs have attracted great interest in recent years [15]. Some active natural components from TCMs, including icariin from Epimedium brevicornum Maxim, baicalin from Scutellaria baicalensis Georgi, and Shugan Lifei Recipe (SGLFR), have already been proved with excellent activities against corticosterone-induced stress injury [16, 17]. Icariin was able to prevent corticosterone-induced hypothalamic cell apoptosis via activation of the PI3K/Akt pathway [18]. Baicalin exhibits a beneficial effect on adult neurogenesis [19]. SGLFR is beneficial to asthma under stress in rats by regulating the hyperfunction of HPA axis and the disorder of immunosystem [20]. Therefore, it is reasonable to exploit effective herbal products for the treatment of corticosterone-induced stress injury in primary hippocampal neurons (PHN) cells. Xiao Yao San (XYS) is a Chinese herbal formula that has been widely used to treat mental disorders for thousands of years in China [21]. It was reported that XYS had anxiolytic-like effects on the elevated plus-maze (EPM) test by decreasing brain-derived neurotrophic factor (BDNF) and increasing tyrosine hydroxylase (TrkB) [22]. In addition, previous research has proved that treatments with XYS could cause significant reversal of stress-induced deficits in learning and memory in a spatial memory task [23]. However, no papers have been published to report the effects of XYS against corticosterone-induced stress injury in PHN cells. Therefore, in this paper, we decided to investigate whether XYS ameliorated corticosterone-induced stress injury in PHN cells and whether the change of GR level was involved in underlying molecular mechanism.

2. Materials and Methods

2.1. Chemicals and Materials

Compounds including paeoniflorin, liquiritin, ferulic acid, and glycyrrhizic acid were purchased from Chengdu Pufeide Biological Technology Co., Ltd. (Chengdu, China). RU-38486 used for the positive drug was obtained from the Medchem Express (Princeton, USA). Corticosterone is one kind of adrenal cortical hormone, which has the strongest effect on carbohydrate metabolism. As a potent GR antagonist, RU-38486 (mifepristone) can decrease the injury caused by high level of adrenal cortical hormone [24]. Fetal bovine serum (FBS), penicillin, and streptomycin were obtained from Hyclone Laboratories, Inc. (Massachusetts, USA). Dulbecco's minimum essential medium (DMEM), Neurobasal®-A medium, B27 NeuroMix, cytosine arabinoside, poly-L-lysine, and trypsin were purchased from Gibco (California, USA). Tissue Protein Extraction Kit was purchased from KEYGEN Biotech. Co., Ltd. (China). Bicinchoninic acid (BCA) Protein Assay Kit, bovine serum albumin (BSA), and Firefly Luciferase Reporter Gene Assay Kit were purchased from Beyotime Institute of Biotechnology (Shanghai, China). Cell Cycle and Apoptosis Analysis Kits were all purchased from Beyotime Institute of Biotechnology (Shanghai, China). Corticosterone, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT), and 4,6-diamidino-2-phenylindole (DAPI) were provided by Sigma (St. Louis, MO, USA). Antibodies against microtubule-associated protein 2 (MAP-2), Caveolin-1, GR, BDNF, TrkB, FKBP4, FKBP51, and GAPDH-conjugated affinipure goat anti-rabbit IgG and horseradish peroxidase-conjugated goat anti-rabbit IgG were supplied by Abcam (Cambridge, UK). Electrophoretic mobility shift assay (EMSA) kit was obtained from Invitrogen (Carlsbad, USA).

2.2. High Performance Liquid Chromatography (HPLC) Analysis of XYS

HPLC analysis of XYS was performed on Agilent 1100 HPLC system (Agilent Co., USA) using C18 column COSMOSIL (4.6 mm × 250 mm ID; particle size 5 μm, Japan). The mobile phases comprised eluent A (0.1% trifluoroacetic acid) and eluent B (acetonitrile). The gradient flow was as follows: 0.00–15.00 min, 17% B; 15–40 min, 17%–45% B; 40–60 min, 45%–60% B; 60–70 min, 60%–80% B; 70–85 min, 80% B. The analysis was performed at a flow rate of 1.0 mL/min with DAD detection at 235 nm. The injection volume was 20 μL. Furthermore, the professional software Similarity Evaluation System for Chromatographic Fingerprint of TCM (version 2004A), which was used for data analysis, was recommended by the State Food and Drug Administration. We calculated the correlation coefficients of entire chromatographic profiles of samples for the simulated mean chromatogram.

2.3. Animals

Male Wistar rats (180–220 g) were purchased from the Experimental Animal Center in Guangzhou University of Chinese Medicine. All experimental procedures were approved by the Animal Care and Use Committee of the Experimental Animal Center in Guangzhou University of Chinese Medicine and performed in strict accordance with the PR China Legislation Regarding the Use and Care of Laboratory Animals. The rats were allowed to adapt to the new environment for one week before the experiments, which were housed in a room under 12 h light/dark cycles, a relative humidity of 60 ± 10%, and a controlled temperature of 22 ± 3°C. The rats were allowed ad libitum access to water and a standard pellet diet throughout the experiment.

2.4. Preparation of XYS Cerebrospinal Fluid

The herbal formula of XYS comprises the following traditional Chinese medicines: Angelica sinensis (Oliv.) Diels, Paeonia lactiflora Pall., Bupleurum chinense DC., Atractylodes macrocephala Koidz, Glycyrrhiza uralensis Fisch., Poria cocos (Schw.) Wolf, Zingiber officinale Rosc., and Mentha haplocalyx Briq., and the ratio is 6 : 6 : 6 : 6 : 6 : 2 : 2 : 3 [24]. The herbal formula was immersed in 10 times volume of distilled water and boiled at 80°C for 1 h. The water extracts were collected and then concentrated by rotary evaporator. The rats were randomly divided into four groups: animals in Control groups were treated with physiological saline; XYS groups were treated with 20.106 (High), 10.053 (Medium), and 5.256 (Low) g/kg of XYS water extracts. Physiological saline and XYS water extracts were administered intragastrically (i.g.) twice daily for five consecutive days. Rats were anesthetized using intraperitoneal (i.p.) chloral hydrate (350 mg/kg) 1 hour after the last administration [25]. The skin, fascia, and muscle in the back side of the neck were exposed successively, subsequently piercing the ring pillow membrane and extracting cerebrospinal fluid (CSF) from the cisterna magna. The CSF was centrifuged (13,000 r/min) at 4°C for 10 min and then sterilized by 0.22 μm microporous membrane.

2.5. PHN Cells Isolation and Culture

PHN cells were isolated from fetal Sprague-Dawley (SD) rats at embryonic day 18 (E18) based on the previously described method [26]. Briefly, the embryos were removed by caesarian section and hippocampi were rapidly isolated under sterile conditions, cut into 1 mm pieces, and digested with 0.125% trypsin at 37°C for 15 min. Trypsin activity was then stopped by planting DMEM containing 10% FBS, 100 U/mL of penicillin, and 100 U/mL streptomycin. The cells (5 × 105 cells/mL) were then planted on poly-l-lysine coated plastic dishes in a constant temperature and humidity incubator. 24 hours after planting, the DMEM was replaced with Neurobasal-A medium containing 2% B27 NeuroMix, 100 U/mL of penicillin, and 100 U/mL streptomycin. Cultures were treated with cytosine arabinoside (2 μg/mL) to inhibit glial proliferation after 48 hours. The hippocampal neurons were used for experiments after 7–10 days of culture.

2.6. Corticosterone Injury

The PHN cells were incubated in corticosterone (Cort) at different concentrations (1280, 640, 320, 160, 80, 40, 20, 10, and 0 μmol/L) for 7 days. The cell viabilities were detected according to the MTT assay. Briefly, 10 μL MTT was added to each well at 37°C for 1 h, and the formative formazan crystals were dissolved by DMSO (100 μL) at 37°C for 4 h. The absorbance of samples then was measured at 492 nm using a spectrophotometer (Huayi Science and Technology Co. Ltd., China).

2.7. Cell Viabilities and Morphological Changes Assay

We used different concentrations of corticosterone pretreating PHN cells to mimic stress-induced damage and found the IC50 of corticosterone was 223 μmol/L. Thus, we chose 223 μmol/L as the corticosterone dose. The PHN cells were allocated to seven groups: (1) the Control group, in which they were treated by 0.1% DMSO; (2) the CSF group, in which they were treated by control cerebrospinal fluid; (3) the Cort group, in which they received administration of corticosterone at a dose of 223 μmol/L; (4) the Cort + Low group, in which they received administration of both corticosterone and XYS cerebrospinal fluid (low dose); (5) the Cort + Medium group, in which they received administration of both corticosterone and XYS cerebrospinal fluid (medium dose); (6) the Cort + High group, in which they received administration of both corticosterone and XYS cerebrospinal fluid (high dose); and (7) the Cort + RU-38486 group, in which they were administered corticosterone plus RU-38486 (2 μmol/L 0.1% DMSO). The PHN cells in different groups were incubated for 7 days. Finally, the cell viabilities of hippocampal neurons were detected according to the MTT assay. For examination of morphological changes, the cells were photographed by using an inverted microscope (Nikon, Japan).

2.8. MAP-2 Detection in PHN Cells

The PHN cells were fixed using methanol for 30 min and permeabilized using 0.3% Triton X-100 for 10 min after XYS pretreatment and corticosterone injury. The cells were incubated with 5% goat serum albumin for 1 h at 37°C to block nonspecific binding. The cells were incubated with the anti-MAP-2 antibody (1 : 100 dilution) for 16 h at 4°C and then incubated with Alexa Fluor® 488 Goat Anti-Mouse IgG (H+L) (Proteintech Group, Chicago, USA) for 1 h at 37°C. The images were obtained using a fluorescence microscope (OLYMPUS, Japan).

2.9. Cell Survival Rate and Cycle Analysis

The PHN cells were incubated in 6-well plates and treated by XYS and corticosterone for 7 days. Then, the cells were collected, washed three with PBS, centrifuged at 600 ×g for 5 min, and fixed with 75% ethanol at 4°C for 24 h. After that, the cells were stained with PI staining solution for 30 min at 37°C and then analyzed by flow cytometry (FACSCalibur Becton Dickson, San Diego, CA, USA).

2.10. Cell Apoptosis Analysis

For detecting the PHN cells apoptosis, Annexin and PI staining solution were added into cell suspension medium for 20 min in 37°C prior to assessment by flow cytometry.

2.11. Immunofluorescent Examination

The PHN cells were treated with methanol for 30 min and 0.3% Triton X-100 for 10 min. The cells were then incubated in a moist box overnight at 4°C with the rabbit anti-GR, at a 1 : 100 dilution after the blocking of nonspecific protein binding by 5% goat serum albumin, then incubated with Alexa Fluor 488 Goat Anti-Mouse IgG (H+L) (Proteintech Group, Chicago, USA) for 1 h at 37°C, and counterstained by DAPI (1 μg/mL) for 15 min. Images of the cells were obtained using a laser scanning confocal microscope (Leica, TCS SP5, Germany).

2.12. Quantitative Real-Time PCR Assay

The total RNA samples of PHN cells were extracted by using RNAiso Plus reagent (TaKaRa Biotechnology Co., Ltd., China) following the manufacturer's protocol. The purity of the extracted RNA was determined; then reverse transcription polymerase chain reaction (RT-PCR) was performed using PrimeScript® RT reagent kit (TaKaRa Biotechnology Co., Ltd., China) following the manufacturer's instructions with a TC-512 PCR system (TECHNE, UK). Subsequently, the levels of mRNA expression were quantified by real-time PCR with SYBR® PremixEx Taq™II (Tli RNaseH Plus) (TaKaRa Biotechnology Co., Ltd., China) and ABI 7500 Real-Time PCR System (Applied Biosystems, USA). The sequences of the primers are shown in Table 1. A no-template control was analyzed in parallel for each gene, and GAPDH gene was selected as the house-keeping gene in our study. Eventually, the unknown template was calculated through the standard curve for quantitative analysis. Briefly, all gene expression levels were normalized to GAPDH, and the fold changes between the different groups were calculated using the 2−ΔΔCt method.
Table 1

The primer sequences used for real-time PCR assay in rats.

GeneFull namePrimer (5′-3′)
Caveolin-1Caveolin-1F: GACTTTGAAGATGTGATTGC
R: AGATGGAATAGACACGGCTG

GRGlucocorticoid receptorF: TGTATCCCACAGACCAAAGCA
R: AATCCTCATTCGTGTTCCCTTC

BDNFBrain-derived neurotrophic factorF: ATCCCATGGGTTACACGAAGGAAG
R: AGTAAGGGCCCGAACATACGATTG

TrkBNeurotrophic tyrosine kinase, receptor, type 2F: GATCCTGGTGGCCGTGAA
R: GCTTCGCGATGAAAGTCCTT

FKBP4FK506 binding protein 4F: AGATGACAGCCGAGGAGATG
R: AATTTGTCCTTGCGATCCAG

FKBP51FK506 binding protein 4F: GAGCCGTTTGTCTTTAGCCTTG
R: GCCAGCAGAGCCGTAAGC

GAPDHGlyceraldehyde-3-phosphate dehydrogenaseF: TGCACCACCAACTGCTTAG
R: GATGCAGGGATGATGTTC

2.13. Western Blotting Assay

The PHN cells were plated in 6-well plates and treated; then the cell proteins were collected using appropriate cold lysis buffer containing 1 mM phenylmethylsulfonyl fluoride (PMSF) based on the manufacturer's instructions. Finally, the protein samples were loaded onto the SDS-PAGE gel (10%–15%), separated electrophoretically, and transferred onto a PVDF membrane (Millipore, USA). After blocking nonspecific binding sites for 1 h with 5% dried skim milk in TTBS at 37°C, the membrane was individually incubated for overnight at 4°C with primary anti-Caveolin-1, anti-GR, anti-BDNF, anti-TrkB, anti-FKBP4, and anti-FKBP51. Then the membrane was incubated at room temperature for 2 h with horseradish peroxidase-conjugated antibodies at a 1 : 5,000 dilution. Protein expression was detected by an enhanced chemiluminescence (ECL) method and imaged using ChemiDoc XRS (BIO-RAD, USA). To eliminate the variations of protein expression, the data were adjusted to correspond to internal reference expression (IOD value of target protein versus IOD of corresponding internal reference).

2.14. Electrophoretic Mobility Shift Assay (EMSA)

For determining the bonding abilities of GR with FKBP4 and FKBP51, EMSA was carried out. 1 nM Cy5-labeled DNA, 10 μmol/L FKBP4, and 10 μmol/L FKBP51 were incubated in 10 mM Tris-HCl (pH = 8.0) buffer including 10 μmol/L Histone H1 and 10 μmol/L BSA at 4°C for 1 h. Reactions were run on 20% Native-PAGE with 1x Tris-glycine buffer (pH = 8.3) at 4°C under 200 V voltage for 15 min. The gels were scanned using ChemiDoc XRS (BIO-RAD, USA).

2.15. Dual-Luciferase Reporter Assay

The GRE-tk-Luc and pRL-SV40 plasmids were mixed in the Eppendorf tube and then transfected into PHN cells. After the cells were cultured for 21 h, FKBP4 (10 μg/L) or FKBP51 (10 μg/L) was added for 1 h culturation. Finally, the cell lysis solutions were collected and the effects of FKBP4 and FKBP51 against GRE transcriptional activity were determined using the single photon fluorescence detector (Promega, USA).

2.16. In Vivo Experiments

The rats were randomly allocated to six groups: (1) the Control group (n = 6), in which they were given an equal volume of 0.5% CMC-Na; (2) the Cort group (n = 6), in which they received administration of corticosterone at a dose of 40 mg/kg per day; (3) the Cort + Low group (n = 6), in which they were given both corticosterone and XYS water extracts at 5.256 g/kg per day; (4) the Cort + Medium group (n = 6), in which both corticosterone and XYS water extracts at 10.053 g/kg per day were administered to them; (5) the Cort + High group (n = 6), in which both corticosterone and XYS water extracts at 20.106 g/kg per day were administered to them; and (6) the Cort + RU-38486 group (n = 6), in which they received administration of corticosterone plus RU-38486 (20 mg/kg per day). Corticosterone was subcutaneously injected once a day, RU-38486 was subcutaneously injected once a day, and XYS (suspended in 0.5% CMC-Na) was administered orally via a gastric tube once a day, with all drugs being given to the animals for 21 days. Finally, rats were anesthetized using intraperitoneal (i.p.) chloral hydrate (350 mg/kg), and hippocampus was quickly dissected out on a cold plate and immediately frozen in liquid nitrogen and stored at −80°C until assayed. Caveolin-1, GR, BDNF, TrkB, FKBP4, and FKBP51 mRNA levels of tissue were detected as above method.

2.17. Statistical Analysis

All the data were analyzed using statistical software SPSS 18.0 and expressed as means ± SEM. Differences among groups were determined using the one-way ANOVA, followed by a post hoc Newman-Keuls test. Comparisons between two groups were performed using unpaired Student's t-test. P < 0.05 and P < 0.01 were considered to be significant.

3. Results

3.1. High Performance Liquid Chromatography (HPLC) Analysis of XYS

Excellent separations were achieved and the chromatograms are shown in Supplementary Figures  1(a) and 1(b) in Supplementary Material available online at http://dx.doi.org/10.1155/2016/5850739, in which peaks 1–4 represent paeoniflorin, liquiritin, ferulic acid, and glycyrrhizic acid, respectively. And the results also showed that the contents of paeoniflorin, liquiritin, ferulic acid, and glycyrrhizic acid in total of XYS crude drugs were 21.53 mg/g, 5.32 mg/g, 4.56 mg/g, and 6.41 mg/g, respectively. Similarity analysis of chromatographic XYS samples was shown in Supplementary Figure  2. The results showed that all the similarity values of the 9 samples were greater than 0.95.

3.2. The Effects of XYS on the Viabilities of Corticosterone Treated PHN Cells

We used different concentrations of corticosterone pretreating PHN cells to mimic stress-induced damage and found the IC50 of corticosterone was 223 μmol/L (Figure 1(a)). As shown in Figure 1(b), there was no remarkable difference between CSF and Control group, which showed that the CSF had no significant effect on PHN cells viabilities. The MTT results also indicated that the viability of PHN cells notably decreased after corticosterone treatment compared with CSF group (P < 0.01). However, the cell viability was significantly restored by XYS cerebrospinal fluid of different concentrations, low (5.256 g/kg), middle (10.053 g/kg), and high (20.106 g/kg), and the positive drug RU-38486 (2 μmol/L). Furthermore, Figure 1(c) showed that PHN cells were exposed to corticosterone exhibiting characteristic of neurodegeneration including a loss of synapses by using the inverted microscope. However, XYS could decrease the synapses injury. In addition, the control and CSF treated cells exhibited higher fluorescence intensity of MAP-2 than that of the Cort group by the observation using fluorescence microscope. XYS pretreatment and RU-38486 increased the fluorescence intensity (Figure 1(c)). However, there was no remarkable difference between CSF and Control group, which showed that the CSF had no significant effect on PHN cells morphology.
Figure 1

The effects of XYS on the viabilities of corticosterone treated PHN cells. (a) The inhibition rate of corticosterone against PHN cells. (b) The effect of XYS on the cell viabilities of PHN cells after corticosterone-induced stress injury. (c) The effects of XYS on the morphological changes and MAP-2-immunopositive neurons (green) of PHN cells (200x magnification) after corticosterone-induced stress injury (n = 3; ## P < 0.01 versus CSF; P < 0.01 versus Cort).

3.3. The Effects of XYS on Cell Survival Rate, Cycle, and Apoptosis

As shown in Figure 2(a), the first peak represented live cells, and the second peak represented the dead cell. The results of flow cytometry indicated that there was no significant difference between CSF and Control group. However, corticosterone significantly decreased the cell survival rate, while XYS and RU-38486 could raise the rate compared to the Cort group. The results of Figures 2(b) and 2(c) showed that the content of cells DNA at G0/G1 and G2/M phase was increased, whereas the cells DNA content at S phase was decreased after corticosterone treatment. Furthermore, XYS decreased the cells DNA content at G0/G1 and G2/M phase and increased the cells DNA content at S phase. In the same way, there was no significant difference of the effects produced by CSF and control vehicle. As shown in Figures 3(a) and 3(b), the results of flow cytometry showed that corticosterone notably increased the cell apoptosis; however, XYS and RU-38486 could decrease the rate of apoptotic cells compared to Cort group. Furthermore, there was no significant difference of the effects produced by CSF and control vehicle (P > 0.05).
Figure 2

The effects of XYS on cell survival rate and cycle. (a) The effect of XYS on cell survival rate using flow cytometry detection. (b) The effect of XYS on cell cycle using flow cytometry detection. (c) Data analysis of the effect of XYS on cell cycle (n = 3; # P < 0.05 versus CSF; ## P < 0.01 versus CSF; P < 0.05 versus Cort; P < 0.01 versus Cort).

Figure 3

The effect of XYS on cell apoptosis using flow cytometry detection. (a) The effect of XYS on cell apoptosis using flow cytometry detection. (b) Data analysis of the effect of XYS on cell apoptosis (n = 3; ## P < 0.01 versus CSF; P < 0.05 versus Cort; P < 0.01 versus Cort).

3.4. The Effect of XYS on GR Nuclear Transfer in PHN Cells

The results of immunofluorescent examination shown in Figure 4 indicated that the nuclear to cytosolic translocation of GR (green fluorescence) has no significant difference between CSF and Control group (P > 0.05). However, it was increased after corticosterone injury compared to CSF group. Compared with Cort treated group, XYS and RU-38486 decreased the nuclear translocation of GR, and there was no significant difference between the high dose of XYS and RU-38486.
Figure 4

Immunofluorescence of GR nuclear transfer in PHN cells. FITC-labeled secondary antibodies were used (green fluorescence), and nuclei were stained by DAPI (400x magnification).

3.5. The Effects of XYS on Caveolin-1, GR, BDNF, TrkB, FKBP4, and FKBP51 mRNA Levels In Vitro

As shown in Figures 5(a)–5(f), the results of quantitative real-time PCR assay revealed that Caveolin-1, GR, BDNF, TrkB, and FKBP4 mRNA levels were significantly decreased and the FKBP51 mRNA level was markedly increased in corticosterone treated hippocampal neurons compared to CSF treated cells. However, there was no significant difference of the effects produced by CSF and control vehicle (P > 0.05). Furthermore, in XYS and RU-38486 group, the Caveolin-1, GR, BDNF, TrkB, and FKBP4 mRNA levels were significantly increased, and the FKBP51 mRNA level was notably decreased compared to Cort group. There was no significant difference of the effects produced by high dose of XYS and RU-38486 (P < 0.05).
Figure 5

The effects of XYS on the gene levels of Caveolin-1 (a), GR (b), BDNF (c), TrkB (d), FKBP4 (e), and FKBP51 (f) in PHN cells after corticosterone-induced stress injury (n = 3; ## P < 0.01 versus CSF; P < 0.05 versus Cort; P < 0.01 versus Cort).

3.6. The Effects of XYS on Caveolin-1, GR, BDNF, TrkB, FKBP4, and FKBP51 Protein Levels

As shown in Figures 6(a)–6(f), the Western blotting results revealed that the protein levels of Caveolin-1, GR, BDNF, TrkB, and FKBP4 were notably downregulated, and the FKBP51 protein expression was significantly upregulated after treatment with corticosterone in hippocampal neurons when compared with the CSF group. Furthermore, there was no significant difference of the effects produced by CSF and control vehicle (P > 0.05). However, compared to the Cort group, the protein levels of Caveolin-1, GR, BDNF, TrkB, FKBP4, and FKBP51 were reversed by XYS and RU-38486. Furthermore, there was no significant difference of the effects produced by high dose of XYS and RU-38486 (P < 0.05).
Figure 6

The effects of XYS on the protein levels of Caveolin-1 (a), GR (b), BDNF (c), TrkB (d), FKBP4 (e), and FKBP51 (f) in PHN cells after corticosterone-induced stress injury (n = 3, ## P < 0.01 versus CSF; P < 0.05 versus Cort; P < 0.01 versus Cort).

3.7. The Effects of FKBP4 and FKBP51 against GR and GRE Transcriptional Activity

Notably, a new slow-migrating band was observed by the EMSA, suggesting that FKBP4-GR DNA complexes were present in the reaction (Figure 7(a)). However, as shown in Figure 7(b), the single band indicated that FKBP51 could not combine with GR DNA. As shown in Figure 7(c), FKBP4 could notably increase the GRE transcriptional activity in a dose-dependent manner (P < 0.05 or P < 0.01). Furthermore, the result of Dual-Luciferase Reporter Assay suggested that FKBP51 significantly decreased the GRE transcriptional activity when compared with FKBP4 for the same concentration (P < 0.01) (Figure 7(d)).
Figure 7

The bonding abilities of GR with FKBP4 (a) and FKBP51 (b) and the effects of FKBP4 (c) and FKBP51 (d) on GRE transcriptional activity (n = 3, P < 0.05 versus FKBP4 or FKBP51 = 0 μg, P < 0.01 versus FKBP4 or FKBP51 = 40 μg).

3.8. The Effects of XYS on Caveolin-1, GR, BDNF, TrkB, FKBP4, and FKBP51 mRNA Levels In Vivo

As shown in Figures 8(a)–8(f), the results of quantitative real-time PCR assay revealed that Caveolin-1, GR, BDNF, TrkB, and FKBP4 mRNA levels were significantly decreased and the FKBP51 mRNA level was markedly increased in Cort treated rats compared to control rats. In addition, XYS significantly upregulated the Caveolin-1, GR, BDNF, TrkB, and FKBP4 mRNA levels and downregulated the FKBP51 mRNA level compared to Cort group. There was no significant difference of the effects produced by high dose of XYS and RU-38486 (P < 0.05).
Figure 8

The effects of XYS on the gene levels of Caveolin-1 (a), GR (b), BDNF (c), TrkB (d), FKBP4 (e), and FKBP51 (f) in brain tissue of rats after corticosterone-induced stress injury (n = 3; ## P < 0.01 versus Control; P < 0.05 versus Cort; P < 0.01 versus Cort).

4. Discussion

A number of neurodegenerative and neurodevelopmental diseases involving cognitive injuries are probably linked to hippocampal dysfunction, also leading to dysregulation of neurogenesis [25, 27]. Plenty of researches about hippocampal dysfunction have been carried out in recent decades, but the pathogenesis of hippocampal dysfunction has not been fully clarified, and few medicines are available. Previous research has shown that stress is an integral part of the pathogenesis of hippocampal dysfunction [28]. Briefly, stress triggers important neuroendocrine responses including the rapid activation of HPA axis and sympathoadrenal system, which leads to the release of catecholamines, adrenocorticotropic hormone, and glucocorticoids [29]. Moreover, hippocampal dysfunction is induced by glucocorticoids, which are negatively regulated via GR [30]. GR especially plays an important role in the process of corticosteroids induced stress [28]. Therefore, the decreasing of stress through upregulation of GRs represents a potential therapeutic approach to alleviating hippocampal dysfunction. In this paper, we used different concentrations of corticosterone to pretreat PHN cells to mimic stress-induced damage and found that the IC50 of corticosterone was 223 μmol/L. There is accumulating evidence that corticosterone could induce the apoptosis of PHN cells. XYS is a Chinese herbal formula that has been widely used to treat mental disorders for thousands of years in China, and we found that XYS mainly included paeoniflorin, liquiritin, ferulic acid, and glycyrrhizic acid by the HPLC analysis. Further studies proved that treatment of XYS presented neuroprotective effects against corticosterone-induced insult in PHN cells, which was confirmed by morphological observation and MTT assay, as well as the MAP-2 staining that is known to promote the extension of the dendritic tree and the plasticity of neuronal morphogenesis [31]. Furthermore, the present study demonstrated that corticosterone resulted in reduction of survival rate of PHN cells; however XYS and RU-38486 reversed this change. Cell cycle is a close mechanism that controls cell reproduction and proliferation. It is representatively divided into several phases: the periods associated with DNA synthesis phase (S phase) and mitosis phase (M phase) that are separated by gaps called G1 and G2 phases [32, 33]. In addition, the cells at G0 phase do not proliferate temporarily. The results showed that XYS decreased the cells at G0/G1 and G2/M phases and increased the cells at S phase, which indicated that XYS raised the DNA synthesis of PHN cells. Furthermore, we found that XYS decreased the rate of apoptotic cells by flow cytometry analysis. Our results showed that XYS exhibited potent ability to improve stress injury. Increased corticosterone level is a hallmark of HPA axis feedback inhibition, which is mediated by GR in the brain [34]. The inhibition of BDNF-TrkB signaling pathway is associated with memory impairment in corticosterone treatment animals [35]. Caveolin-1 is localised to the growth cones and dendrites of hippocampal neurons and it promotes neuronal differentiation and maturation [36]. FK506 binding protein of molecular weight 51 (FKBP51) and the related protein FKBP4 are thought to be involved in the regulation of GR signaling [37]. Our results showed that corticosterone resulted in the downregulation of Caveolin-1, which was reversed by XYS. GR, the steroid-activated nuclear receptor, translocates to the nucleus to bind its target DNA sequences when it is triggered, and it is a positive or negative transcription factor to mediate mRNA production of genes related to neuronal plasticity, activation, and metabolism [34, 36]. BDNF is a neurotrophic factor playing an important role in the central nervous system (CNS) and can prevent neuronal cells death induced by corticosterone stress [37]. In this study, we demonstrated that the underlying mechanism of XYS against corticosterone-induced stress in the PHN cells involved the upregulation of the BDNF-TrkB pathway [35]. The FK506 binding proteins (FKBPs) are members of a large superfamily of peptidyl-prolyl isomerases (PPIases) [38, 39]. Particularly, FKBP4 and FKBP51 that possess C-terminal tetratricopeptide repeat (TPR) domains can bind to GR [40, 41], and they play key roles in regulating the activities of transient receptor potential channels and cell microtubule function [41]. In our work, we found that GR DNA could bind with FKBP4 instead of FKBP51 by EMSA. Moreover, the results of Dual-Luciferase Reporter Assay indicated that FKBP4 notably increased the GRE transcriptional activity but FKBP51 significantly decreased the GRE transcriptional activity. XYS upregulated the FKBP4 mRNA and protein levels and downregulated the FKBP51 mRNA and protein levels. These results proved that XYS promoted the GRE transcriptional activity. In summary, XYS conferred direct protective effects on the corticosterone-induced PHN cells by promoting the GRE transcriptional activity and the subsequent BDNF-TrkB pathway in vitro. Accordingly, XYS represents a novel and potent candidate that should be developed as one potent candidate for the treatment of hippocampal dysfunction. Of course, further investigations are needed to investigate the clinical applications of XYS. High performance liquid chromatography analysis of XYS.
  41 in total

1.  [Protective and therapeutic effects of Shugan Lifei Recipe on rats with asthma under stress and the mechanisms].

Authors:  Yao Tong; Ning-Xia Zhang; Hui-Juan Chen; Li-Qiang Ni
Journal:  Zhong Xi Yi Jie He Xue Bao       Date:  2005-09

Review 2.  Environmental Change, the Stress Response, and Neurogenesis.

Authors:  Lara D LaDage
Journal:  Integr Comp Biol       Date:  2015-05-16       Impact factor: 3.326

3.  Hydrogen sulfide inhibits homocysteine-induced endoplasmic reticulum stress and neuronal apoptosis in rat hippocampus via upregulation of the BDNF-TrkB pathway.

Authors:  Hai-Jun Wei; Jin-Hua Xu; Man-Hong Li; Ji-Ping Tang; Wei Zou; Ping Zhang; Li Wang; Chun-Yan Wang; Xiao-Qing Tang
Journal:  Acta Pharmacol Sin       Date:  2014-04-21       Impact factor: 6.150

4.  Disruption of glucocorticoid receptors in the noradrenergic system leads to BDNF up-regulation and altered serotonergic transmission associated with a depressive-like phenotype in female GR(DBHCre) mice.

Authors:  Piotr Chmielarz; Grzegorz Kreiner; Marta Kot; Agnieszka Zelek-Molik; Marta Kowalska; Monika Bagińska; Władysława Anna Daniel; Irena Nalepa
Journal:  Pharmacol Biochem Behav       Date:  2015-08-07       Impact factor: 3.533

5.  Chronic corticosterone administration facilitates aversive memory retrieval and increases GR/NOS immunoreactivity.

Authors:  Thays B Santos; Isabel C Céspedes; Milena B Viana
Journal:  Behav Brain Res       Date:  2014-03-21       Impact factor: 3.332

Review 6.  Stress effects on the hippocampus: a critical review.

Authors:  Eun Joo Kim; Blake Pellman; Jeansok J Kim
Journal:  Learn Mem       Date:  2015-08-18       Impact factor: 2.460

7.  Corticosterone enhances the potency of ethanol against hippocampal long-term potentiation via local neurosteroid synthesis.

Authors:  Yukitoshi Izumi; Kazuko A O'Dell; Charles F Zorumski
Journal:  Front Cell Neurosci       Date:  2015-07-03       Impact factor: 5.505

8.  Xiao Yao San Improves Depressive-Like Behaviors in Rats with Chronic Immobilization Stress through Modulation of Locus Coeruleus-Norepinephrine System.

Authors:  Xiu-Fang Ding; Xiao-Hua Zhao; Yang Tao; Wei-Chao Zhong; Qin Fan; Jian-Xin Diao; Yuan-Liang Liu; Yu-Yao Chen; Jia-Xu Chen; Zhi-Ping Lv
Journal:  Evid Based Complement Alternat Med       Date:  2014-12-25       Impact factor: 2.629

Review 9.  Stress, glucocorticoid hormones, and hippocampal neural progenitor cells: implications to mood disorders.

Authors:  Tomoshige Kino
Journal:  Front Physiol       Date:  2015-08-19       Impact factor: 4.566

10.  Ablation of hippocampal neurogenesis in mice impairs the response to stress during the dark cycle.

Authors:  Cheng-Yu Tsai; Ching-Yen Tsai; Sebastian J Arnold; Guo-Jen Huang
Journal:  Nat Commun       Date:  2015-09-29       Impact factor: 14.919

View more
  1 in total

1.  Xiaoyaosan Alleviates Hippocampal Glutamate-Induced Toxicity in the CUMS Rats via NR2B and PI3K/Akt Signaling Pathway.

Authors:  Xue-Ming Zhou; Chen-Yue Liu; Yue-Yun Liu; Qing-Yu Ma; Xin Zhao; You-Ming Jiang; Xiao-Juan Li; Jia-Xu Chen
Journal:  Front Pharmacol       Date:  2021-04-12       Impact factor: 5.810

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.