OBJECTIVES: Th2 response is related to the aetiology of asthma, but the underlying mechanism is unclear. To address this point, the effect of nebulized inhalation of inactivated Mycobacterium phlei on modulation of asthmatic airway inflammation was investigated. MATERIALS AND METHODS: 24 male BALB/c mice were randomly divided into three groups: control group (Group A), asthma model group (Group B), and the medicated asthma model group (Group C). Group B and C were sensitized and challenged with ovalbumin (OVA). Group C was treated with aerosol M. phlei once daily before OVA challenge. Airway responsiveness in each group was assessed. All the animals were killed, and lung tissues and bronchoalveolar lavage fluid (BALF) were harvested. Inflammatory response, proportion of Th17 and CD4+CD25+ Treg cells, and the levels of cytokines were analyzed in lung tissue. RESULTS: The proportion of Th17 cells and expression level of IL17, IL23, and IL23R were increased, while Foxp3 expression was decreased in Group B. Inhaling inactivated M. phlei inhibited airway inflammation and improved airway hyper-responsiveness, as well as peak expiratory flow (PEF). In addition, it significantly increased Th17 proportion, Foxp3 level, and the proportion of CD4+CD25+ Treg cells in lung tissue in Group C. CONCLUSION: Inactivated M. phlei was administered by atomization that suppressed airway inflammation and airway hyper responsiveness partially via modulating the balance of CD4+CD25+ regulatory T and Th17 cells.
OBJECTIVES:Th2 response is related to the aetiology of asthma, but the underlying mechanism is unclear. To address this point, the effect of nebulized inhalation of inactivated Mycobacterium phlei on modulation of asthmatic airway inflammation was investigated. MATERIALS AND METHODS: 24 male BALB/c mice were randomly divided into three groups: control group (Group A), asthma model group (Group B), and the medicated asthma model group (Group C). Group B and C were sensitized and challenged with ovalbumin (OVA). Group C was treated with aerosol M. phlei once daily before OVA challenge. Airway responsiveness in each group was assessed. All the animals were killed, and lung tissues and bronchoalveolar lavage fluid (BALF) were harvested. Inflammatory response, proportion of Th17 and CD4+CD25+ Treg cells, and the levels of cytokines were analyzed in lung tissue. RESULTS: The proportion of Th17 cells and expression level of IL17, IL23, and IL23R were increased, while Foxp3 expression was decreased in Group B. Inhaling inactivated M. phlei inhibited airway inflammation and improved airway hyper-responsiveness, as well as peak expiratory flow (PEF). In addition, it significantly increased Th17 proportion, Foxp3 level, and the proportion of CD4+CD25+ Treg cells in lung tissue in Group C. CONCLUSION: Inactivated M. phlei was administered by atomization that suppressed airway inflammation and airway hyper responsiveness partially via modulating the balance of CD4+CD25+ regulatory T and Th17 cells.
Asthma is a chronic respiratory disease which is characterized by airway inflammation and hyper-reactivity. Although the pathogenesis of asthma remains to be determined, newly emerging CD4+ Th cell subsets have been linked to general disease pathogenesis, including regulatory T cells (Treg) (1), Th17 cells (2), and the Th cells which produce IL9 (Th9 cells) (3).IL17 has been implicated in asthma develop-ment (4) and Th17 cells are now accepted to represent a third CD4+ Th subset, which has led to the resolution of some inconsistencies in the Th1/Th2 paradigm (5). Regulatory T cells are characterized by the expression of the transcription factor Foxp3 (Forkhead Foxp3) and the IL2 receptor (CD25), and are known to produce the inhibitory cytokines IL10 and TGF-β (6). The Treg cells have an ability to suppress allergic inflammation and asthma manifestations upon allergen provocation in mouse model of allergic asthma. The development of Treg cells can suppress airway inflammation viamediating the tolerance of respiratory mucosal surfaces to environmental allergens (7-9). The balanced action between Th17 and Treg cells may be important for the development/prevention of inflammatory and autoimmune diseases such as asthma (10). Therefore, inducing both Th17 and Treg cells using immunological tools might be a promising treatment for asthma, but technically it is difficult.The global prevalence of asthma and allergic disease is continuously increasing, especially in population-dense countries in Africa, Latin America, and part of Asia (11, 12). In recent years, it was recognized that Th1/Th2 imbalance does not fully explain the aetiology of asthma, because reversing the Th1/Th2 imbalance does not fully control asthmatic symptoms in human. Some studies have suggested that other CD4+ T cell subsets may play a role in asthma, including Th1, Th17, and regulatory T cells (Treg) (13). In terms of regulation and restriction of immune responses, researchers are particularly interested in exploring the roles of T regulatory cells and Th17 cells. Extensive investigations have shown that Mycobacterium bovis bacille Calmette-Guérin (BCG) and other mycobacterial infections suppress airway hyperresponsiveness (AHR) and eosinophilic inflammation, likely through T-helper 1 (Th1) or regulatory T cell (Treg) responses (14-19). Our previous study showed the inhalation of Mycobacterium phlei reduces airway inflammation in asthmatic mice via altering the balance of the Th1/Th2 responses (20).This study aimed to determine whether M. phlei administered by atomization, affect CD4+CD25+ regula-tory T cells/Th17 balance in a mouse model of asthma.
Materials and Methods
Animals
Male BALB/c mice (6 weeks old, pathogen free) were obtained from Laboratory Animal Center of Guangxi Medical University. All experiments were approved by the Animal Care Committee at Guangxi Medical University (Nanning, Guangxi, China). 24 male BALB/c mice were randomly divided into 3 experimental groups: the control group (Group A), the asthma model group (Group B), and the prevention group (Group C). All mice were maintained in an air-conditioned room at 23±3°C and 55.5±10% humidity, and fed a standard laboratory diet with ad libitum access to food and water.
Sensitization and airway challenge
BALB/c mice were sensitized and challenged with ovalbumin (OVA) to establish a murine model of asthma (10). In brief, Group B and Group C were sensitized by IP injection of 25 mg OVA (grade V; Sigma) emulsified in 1 mg of aluminum hydroxide (AlumImuject; Pierce, Rockford, IL) in a total volume of 200 μl, on day 1 and 14. Mice were challenged (20 min) via the airways with OVA (2% in saline) for 7 days (from day 21 to day 28) using ultrasonic nebulization (AeroSonic ultrasonic nebulizer; DeVilbiss, Somerset, PA). Group A received only saline (instead of OVA).
Mycobacterial preparations, prevention protocols
Inactivated M. phlei (1.72 µg) was dissolved in 10 ml saline and injected (20). Group C as treated with inactivated M. phlei, once daily before each OVA challenge using ultrasonic nebulization, as described (20). Group A and B were treated with the same dose of saline. Twenty-four hr after the last challenge, AHR was assessed, and the lung tissues were collected for further analysis.
Airway hyper responsiveness assessment
Respiratory resistance (RL, cmH2O.s/ml) was assessed in anesthetized and tracheotomized mice that were mechanically ventilated in response to increasing dose of methacholine inhalation, using the pulmonary function equipment from RC System for Mouse [Buxco Research Systems 2033 Corporate Drive Wilmington, NC 28405 USA] (21).
Histological examination of murine lung tissue
For histopathological analysis, lung tissue was fixed with 10% formalin for 24 hr, after bronchoalveolar lavage fluid (BALF) collection. Lung samples were embedded in the paraffin. Microtome sections were cut in a 5 µm thickness and stained with haematoxylin and eosin (H&E) for analyzing airway inflammation and pathological changes (22).
Immunohistochemical analysis
For immunohistochemical detection of IL17 and IL23R in lung, the tissue sections were incubated overnight at 4°C with the primary antibodies directed against IL17 (Santa Cruz biotechnology, Inc, USA) and IL23R (R&D Systems, Inc. Minneapolis, MN, USA). Image analysis was performed using a microscope (Leica, Germany). For BALF analysis, mice were anesthetized with chloral hydrate (10%, 0.04 ml/10 g body weight). The trachea was cannulated, and BALF was collected after injections of 0.5 ml saline dissolved in the phosphate buffer, into the lung. The BALF was centrifuged, and the supernatant was used to test the cytokine production. The experiments were followed a protocol as described (23).
Cytokine enzyme-linked immunosorbent assay
The serum concentration of IL17 and IL23 (R&D Systems, Inc.) in the supernatants of the cultured cells as measured by enzyme-linked immunosorbent assay (ELISA) using the ELISA kit (Thermo Fisher Scientific) based on the instructions of the manufacturer.
RNA extraction and RT-PCR
Total RNA from lung tissues was extracted with Trizol reagent (Invitrogen, Gaithersburg, USA) according to the manufacturer’s instructions. Complementary DNA (cDNA) was generated using a cDNA reverse transcription kit (Invitrogen, Gaithersburg, USA) according to the manufacturer’s instructions. Real-time polymerase chain reaction (RT-PCR) was performed by adding SYBR green I (Roche Diagnostics, Mannheim, Germany), and mouseIL17, Foxp3, and β-actin were amplified. Primer sequences were used as follow; IL17 (F: GCAAAGCTGGACCACCACA and R: CACACCCACCAG-CATCTTCTC), Foxp3 (F: TACCACTGGTTCACACGCAT-GT and R: CACCCGCACAAAGCACTTG), and β-actin (F: ATCCACGAAACTACCTTCAA and R: CACCCGCACAA-AGCACTTG), LightCycler™ (Roche Diagnostics). The relative expression levels were calculated by normalizing the IL17 and Foxp3 levels to that of β-actin mRNA.
Detection of Th17 and CD4+CD25+ Treg cells by flowcytometry
Lung tissues were removed and placed in PBS solution. Tissues were dispersed into single-cell suspensions. Peripheral blood monouclear cells (PBMCs) were isolated by a density gradient centrifugation on Ficoll-Hypaque (24).For cell-surface staining, CD4+ (clone GK1.5), CD25+ (clone eBio3C7), and Foxp3 (clone FJK-16S) antibodies were obtained from eBioSciences. For measurement of intracellular cytokines, T cells were stimulated with 500 ng/ml Phorbol dibutyrate (PdBU) and 500 ng/ml ionomycin in the presence of 1 mg/ml Brefeldin A (Sigma), for 2 hr. Cells were then fixed with 3.65% formaldehyde solution (Sigma) and permeabilized in a 0.1% NP40 containing buffer before analysis. IL17A (clone TC11) antibody was obtained from eBioSciences. Intracellular staining and cell-surface staining were performed according to the manufacturer’s instructions.
Measurment of PFP after methacoline stimulation
25 cross-section samples randomly selectedfrom each group at complete peer trachea were used to analyze the score of airway wall inflammatory cell infiltration, as described below (25). The scoring is as follows, 0: no inflammatory cell infiltration; 1: a small amount, intermittent inflammatory cells; 2: airway wall surrounded with a thin layer of inflammatory cells (1-5 cells thin); 3: airway wall surrounded with thick layer of inflammatory cells (more than 5 cell layers).
Statistical analysis
The experimental values were presented as mean± standard deviation. Statistical analysis was performed with the statistical software package SigmaStat (SPSS 17.0, Chicago, IL). Significant differences in expression of IL1, IL23R, and Foxp3 in different groups were analyzed by using the Kruskal-Wallis test. All assays were compared using ANOVA followed by least squares difference analysis. Differences were considered statistically significant when the P-value<0.05.
Results
Inactivated M. phlei administration suppressed airway inflammation
Our previous study identified that the inhalation of M. phlei reduces airway inflammation in asthmatic mice via altering the balance of the Th1/Th2 responses (20). To further monitor the effects of inactivated M. phlei on pathological changes in lung tissues, H&E was used to stain the lung tissues from the normal mice (Group A), asthmatic mice (Group B), and inactivated M. phlei inhaling asthmatic mice (Group C). In Group A, bronchial wall was smooth and complete without inflammatory cells surround the lung tissue, airway, and blood vessels. In OVA-immunized mice (Group B), OVA challenge induced infiltration of inflammatory cells. Inactivated M. phleiadministered by inhalation led to a significant suppression of inflammatory cells recruitment into the airways. To explore pathological differences in three groups, abnormal wall of airway was counted from each group. The results showed that OVA challenge significantly increased percentage of abnormality (96%) than normal group (8%), and inactivated M. phlei treatment slightly rescued it (76%). In addition, histochemical analyses revealed that inactivated M. phlei administration suppressed IL17 and IL23R expressions, and increased Foxp3 level, which were similar with normal mice (Figure 1).
Figure 1
Histological and immunohistochemical assays of lung tissues after administration of inactivated M. phlei by inhalation. (a) The histopathology of lung tissues was assessed by H&E staining and examined by a light microscope. Group A showed that small airway basement membrane is complete with no significant inflammatory cell infiltration and mucosal edema; Group B showed mucosal edema, small airways and small perivascular inflammatory cell infiltration, and increased tracheal mucus secretion; Group C showed less mucosal congestion and reduction of edema, as well as small airways and small perivascular inflammatory cell infiltration, and airway mucus secretion. Black arrows indicate abnormal wall of airway. Percentage in the left of photos indicates the abnormal wall of airway in each group analyzed. 25 sections from each group were analyzed. (b) IL17 and IL23R levels, and promoted Foxp3 expressions in Group C. Group A: normal control group; Group B: asthma model group; Group C: the prevention group
Histological and immunohistochemical assays of lung tissues after administration of inactivated M. phlei by inhalation. (a) The histopathology of lung tissues was assessed by H&E staining and examined by a light microscope. Group A showed that small airway basement membrane is complete with no significant inflammatory cell infiltration and mucosal edema; Group B showed mucosal edema, small airways and small perivascular inflammatory cell infiltration, and increased tracheal mucus secretion; Group C showed less mucosal congestion and reduction of edema, as well as small airways and small perivascular inflammatory cell infiltration, and airway mucus secretion. Black arrows indicate abnormal wall of airway. Percentage in the left of photos indicates the abnormal wall of airway in each group analyzed. 25 sections from each group were analyzed. (b) IL17 and IL23R levels, and promoted Foxp3 expressions in Group C. Group A: normal control group; Group B: asthma model group; Group C: the prevention group
Airway hyper responsiveness was analyzed in three groups (Figure 1). After OVA immunization, airway hyper responsive was significantly increased, while peak expiratory flow (PEF) was decreased in Group B compared to normal mice (P<0.01).However, inactivated M. phlei treatment inhibited the increase of airway sensitivity, as well as increased PEF in OVA immunization asthmatic mice model in Group C (P<0.05) (Figure 2). Similar with OVA challenge, Methacholine-mediated PEF levels were also lower in Group B, but inactivated M. phlei treatment rescued this decrease (Table 1).
Figure 2
Airways resistance to increasing concentrations of methacholine. Inhalation of inactivated M. phlei suppressed asthmatic airway hyper-responsiveness (AHR). Compared with Group A, *P<0.01. Compared with Group C, #P<0.01. Group A: normal control group; Group B: asthma model group; Group C: the prevention group
Table 1
PEF (ml/s) in three group (x̄±s, n= 8)
Methacholine(mg/mL)
0
6.25
12.5
25
50
Group A
1.46±0.02
1.06±0.09
0.75±0.10
0.49±0.14
0.39±0.16
Group B
1.04±0.11*#
0.92±0.06Δ#
0.48±0.13Δ#
0.45±0.13
0.31±0.08
Group C
1.42±0.03
1.12±0.08
0.93±0.17
0.65±0.16
0.47±0.12
F
54.925
7.901
12.393
2.659
2.000
P
0.000
0.006
0.001
0.111
0.178
Airways resistance to increasing concentrations of methacholine. Inhalation of inactivated M. phlei suppressed asthmatic airway hyper-responsiveness (AHR). Compared with Group A, *P<0.01. Compared with Group C, #P<0.01. Group A: normal control group; Group B: asthma model group; Group C: the prevention groupPEF (ml/s) in three group (x̄±s, n= 8)
Cytokines (IL17 and IL23) levels in BALF, and IL17 and Foxp3 transcript levels in lung were changed by inactivated M. phlei treatment
To further characterize the effects of inactivated M. phlei inhalation, the concentration of IL17 and IL23 in BALF was measured by ELISA, and the mRNA level of IL17 and Foxp3 was assessed by RT-PCR. As shown in Figure 3, the concentration of IL17 and IL23 in BALF and the level of IL17 mRNA were increased in Group B, but they were decreased by the treatment of inactivated M. phlei in Group C. However, there was no significant change in the Foxp3 mRNA level between the three groups.
Figure 3
Marker expression levels in BALF and lung. (a) The IL17 levels in BALF. (b) The IL23 levels in BALF. (c) The IL17 mRNA level in lung. (d) The Foxp3 mRNA level in lung. Group A: normal control group; Group B: asthma model group; Group C: the prevention group
Marker expression levels in BALF and lung. (a) The IL17 levels in BALF. (b) The IL23 levels in BALF. (c) The IL17 mRNA level in lung. (d) The Foxp3 mRNA level in lung. Group A: normal control group; Group B: asthma model group; Group C: the prevention group
Inactivated M. phlei administration increased percentage of Th17 and CD4+CD25+ Treg cells in lung
Inhalation of M. phlei was known to change the balance of the Th1/Th2 responses (20). To further address its effects on other type of cells in lung, Th17 and CD4+CD25+ Treg cells were monitored in normal mice (Group A), asthmatic mice (Group B), and inhaled inactivated M. phlei asthmatic mice model (Group C). As shown in Figure 4, the percentage of Th17 cells was significantly high and CD4+CD25+ Treg cells were obviously low in Group B. However, the percentage of Th17 cells was significantly low and CD4+CD25+ Treg cells were obviously high in Group C. The percentage of T cell and Th17 cells in lung was also analyzed. Data showed that T/Th17 cell ratio was decreased in Group B compared to Group A, and it was partially recovered in Goup C (Figure 5).
Figure 4
The proportions of T17 and Treg cells. (a) The percentage of Th17 cells in lung by flowcytometry. (b) The percentage of Treg cells in lung by flowcytometry. (c) Comparative analysis of Th17 cells in three groups. (d) Comparative analysis of Th17 cells in three groups. Group A: normal control group; Group B: asthma model group; Group C: the prevention group
Figure 5
The ratio of regulatory T cells and Th17. Comparison of T cell and Th17 cells in lung tissued of three groups were shown as percentage. Group A: normal control group; Group B: asthma model group; Group C: the prevention group. Significant differences between Group A and Group B or Group C and Group B were shown (*P<0.05, **P<0.01)
The proportions of T17 and Treg cells. (a) The percentage of Th17 cells in lung by flowcytometry. (b) The percentage of Treg cells in lung by flowcytometry. (c) Comparative analysis of Th17 cells in three groups. (d) Comparative analysis of Th17 cells in three groups. Group A: normal control group; Group B: asthma model group; Group C: the prevention groupThe ratio of regulatory T cells and Th17. Comparison of T cell and Th17 cells in lung tissued of three groups were shown as percentage. Group A: normal control group; Group B: asthma model group; Group C: the prevention group. Significant differences between Group A and Group B or Group C and Group B were shown (*P<0.05, **P<0.01)
Discussion
Nonspecific immunosuppressive therapy is one of the current treatments of asthma. Immunization with mycobacteria or mycobacteria products has been reported to inhibit the development of allergic disease (16, 17, 26, 27). The most acceptable approach is the exposure to a range of mainly innocuous microorganisms, largely bacteria to trigger protective responses in the developing immune system. These effects are probably activated through innate immune receptors such as TLR2 (28), and might affect the development of responses mediated by several cell types including basophils, natural killer cells (29), dendritic cells (30), and T-regulatory (Treg) cells (31).Extensive studies have reported that mycobacteria such as BCG have suppressive effects on asthma (14-16, 18, 32-36). Many factors affect the induction of immune responses by mycobacteria, such as mycobacteria strains (37) and route of administration. Oral exposure to bacterial extracts, protects animals against the development of experimental models of asthma (30, 31). The present study demonstrated that inhalation of inactivated M phlei is a way to treat asthma. OVA challenge (Group B) increased the levels of IL17 and IL23R, the concentration of IL17 and IL23, and the proportion of Th17 cells, while reduced the level of Foxp3. Our results also showed that inhalation of inactivated M. phlei suppressed the airway inflammation and hyperreactivity, reduced the production of IL17 and IL23, the proportion of Th17, and the expression of IL23R in asthmatic mice. Inhaling inactivated M. phlei promoted the expression of Foxp3 and the proportion of CD4+CD25+ Treg cells in Group C.Previous studies reported the effects of Mycobacterium on Th17 and/or Treg cells (38-41). In which, lower expression of Th17-associated cytokines and higher expression of CD4+CD25+ Treg cells were observed in the treated mice than the untreated asthmaticmice model, which is similar with our findings in current study. However, conflicting results exist when it comes to which T cells produce IL17 and are affected by BCG in asthma. Deng and colleagues (42) showed that BCG neonatal vaccination reduced IL17 production in both the BALF and the lung lymphocytes, in asthmatic mice. They also showed that BCG neonatal vaccination did not reduced Th17 cells. Although effective, immunotherapy by injection of BCG has the potential for systemic side effects including sclerosis, ulcer, fever, and even tuberculosis diffusion. The inhalation of certain drugs was suggested as early as 1946 (43), and now is commonly used for the patients with asthma and chronic obstructive pulmonary disease (44). Inhalation delivery of the drugs to lungs offers several substantial advantages such as simplified administration protocol, reduced drug quantity needed to achieve therapeutic effect, and increased drug concentration at the required sites (45) and is suitable to be used for children especially. Moreover, the initial interactions of microbes with epithelial cells, dendritic cells, and macrophages at the mucosal surface create potential to activate a wide range of different lymphoid types (46). In our study, inhalation of inactivated M. phlei successfully reduced airway inflammatory response and balanced proportion of Th17 and CD4+CD25+ Treg cells, as well as the levels of cytokines in lung tissue after being immunized by OVA. Based on our findings, inhalation of inactivated M. phlei is an efficient approach to treat asthma.
Conclusion
The present study demonstrated that inhaled inactivated M. phlei is able to ameliorate allergic asthma via modulating the balance between CD4+CD25+ regulatory T cells and Th17 cells in mice. Therefore, our data underlines the importance of inhaling inactivated M. phlei as a potential approach for the therapeutic modulation of asthma.
Authors: Torsten Olszak; Dingding An; Sebastian Zeissig; Miguel Pinilla Vera; Julia Richter; Andre Franke; Jonathan N Glickman; Reiner Siebert; Rebecca M Baron; Dennis L Kasper; Richard S Blumberg Journal: Science Date: 2012-03-22 Impact factor: 47.728