Literature DB >> 27800178

The Prevalence of S. aureus Skin and Soft Tissue Infections in Patients with Pemphigus.

Zeinab Fagheei Aghmiyuni1, Ahmad Khorshidi1, Rezvan Moniri2, Tahereh Soori3, Seyed Gholam Abbas Musavi4.   

Abstract

Pemphigus vulgaris are autoimmune blistering diseases that may result in significant morbidity and death. Immunosuppressive therapy of pemphigus vulgaris would predispose the patients to infections. The aim of this study was to assess the prevalence of S. aureus infection and PVL gene in patients with pemphigus admitted to dermatology clinic. Materials and Methods. This descriptive study was conducted on 196 pemphigus vulgaris patients (119 males, 77 females) admitted to dermatology clinic between 2014 and 2015. In this study, the diagnosis of pemphigus vulgaris was made by histology, immunofluorescence pattern of perilesional skin, and indirect immunofluorescence testing of serum. Data were collected through a questionnaire. Results. 59.1% of pemphigus vulgaris patients had S. aureus infection. 49 out of 116 were methicillin-resistant. PVL gene was detected in 25 out of 116 S. aureus positive patients. Conclusion. This is the first report of S. aureus infection in pemphigus patients in Iran. More than forty percent of isolates were methicillin-resistant S. aureus. PVL gene carried by methicillin-resistant S. aureus was high in this study.

Entities:  

Year:  2016        PMID: 27800178      PMCID: PMC5075296          DOI: 10.1155/2016/7529078

Source DB:  PubMed          Journal:  Autoimmune Dis        ISSN: 2090-0430


1. Introduction

Pemphigus is defined as a group of life-threatening blistering disorders which results in the formation of intraepithelial blisters in mucous membranes and skin [1-3]. The four major types of pemphigus are pemphigus vulgaris, pemphigus foliaceus, IgA pemphigus, and paraneoplastic pemphigus. Incidence rates between 0.1 and 0.5 per 100,000 people per year have been described; however, higher rates have been reported in certain populations [4]. Inhabitants of India, Southeast Europe, and the Middle East have the greatest risk for pemphigus vulgaris. Pemphigus occurs in men and women with equal frequency. In most geographic locations, pemphigus vulgaris is more common than pemphigus foliaceus. However, in certain locations, such as North Africa, Turkey, and South America, the prevalence of pemphigus foliaceus goes over pemphigus vulgaris [5]. Pemphigus vulgaris and pemphigus foliaceus are potentially life-threatening disorders. First-line treatment for these diseases consists of a systemic glucocorticoid with or without an adjuvant immunosuppressant. Local skin care measures may reduce the risk for infection. The possibility of secondary infection should be considered when lesions fail to respond to therapy, and infection should be treated appropriately if it is detected [6-8]. Bacterial infection was not reported as an inducing factor of pemphigus, while septicemia of Staphylococcus aureus dose occurs, as a complication of immunosuppressive therapy. There are a number of possible clarifications for the association of pemphigus with bacterial infection [9, 10]. The bacteria could simply be an opportunistic infection, because pemphigus patients are treated with immunosuppressive therapy for a long time. Early recognition of concurrent pemphigus and bacterial infection, especially S. aureus, is extremely important because of the possible fatal consequences of the disease. The aim of this study was to assess the prevalence of S. aureus infection and PVL gene in patients with pemphigus.

2. Materials and Methods

2.1. Study Population and Strain Collection

This cross-sectional study was performed on 338 patients with skin and soft tissue infection who were admitted to Tehran dermatology service of Razi Hospital affiliated to the Tehran University of Medical Sciences. Patients with a clinical diagnosis of pemphigus with compatible histopathology and direct immune fluorescence (DIF) findings confirming the clinical diagnosis of pemphigus entered the study. The diagnosis of pemphigus vulgaris was made by histology, immunofluorescence pattern of perilesional skin, and indirect immunofluorescence testing of serum. A questionnaire was completed to collect the patient's data. Clinical Staphylococcus aureus samples which were collected from pemphigus patients with skin and soft tissue infection who were admitted to Tehran dermatology service of Razi Hospital affiliated to the Tehran University of Medical Sciences were taken to the microbiology lab of Kashan Medical Faculty to approve the diagnosis of S. aureus. Samples from the skin and soft tissue infection were collected from all patients and were cultured on sheep blood agar and mannitol salt agar incubated for 24–48 h at 37°C. The isolates confirmed to the species level by gram staining, catalase activity, DNase, slide coagulase, and free coagulation of citrated rabbit plasma in tube.

2.2. S. aureus Identification

All swabs were inoculated onto mannitol salt agar, incubated at 37°C. Any suspected colony was subcultured on tryptic soy agar and the isolates were confirmed as being S. aureus by colonial morphology, Gram staining, catalase activity, DNase tests, slide coagulase test, and free coagulation of citrated rabbit plasma in tube [11, 12].

2.3. Determination of Methicillin Resistance

Methicillin resistance was evaluated using two methods. The first method was disk diffusion method using Mueller Hinton agar according to the recommendations of Clinical and Laboratory Standards Institute (CLSI), 30 μg cefoxitin disk (≤21 mm indicated MRSA), and 1 μg oxacillin disk (≤10 mm indicated MRSA). The second method was polymerase chain reaction (PCR) for the detection of mecA gene (positive indicated MRSA) [13, 14].

2.4. Antimicrobial Susceptibility Testing and Determination of MDR

Antimicrobial susceptibility and resistance were determined by disk diffusion method using Mueller Hinton agar according to the recommendations of Clinical and Laboratory Standards Institute (CLSI) [13]. The following disks were used: oxacillin (1 μg), penicillin (1 μg), teicoplanin (30 μg), tetracycline (30 μg), azithromycin (15 μg), clindamycin (2 μg), cefoxitin (30 μg), ciprofloxacin (30 μg), gentamicin (10 μg), linezolid (30 μg), daptomycin (30 μg), amikacin (30 μg), and cefazolin (30 μg). The reference strain S. aureus ATCC 3359 was used as a control. Results were interpreted as susceptible, intermediate, or resistant according to the criteria recommended by the CLSI and the manufacturer protocols (Mast Group Ltd., Merseyside, UK). Defining of MDR in S. aureus isolates was done according to new standardized international document. The isolates were classified as multidrug resistant (MDR) if they were resistant to more than three classes of antimicrobial drugs [15].

2.5. Preparation of Genomic DNA

DNA was prepared by boiling. It was stored at −20°C. Aliquots of 2 μL of template DNA were used for PCR.

2.6. Detection of PVL Gene

The presence of the lukS-PV and lukF-PV genes encoding components of PVL was determined by a polymerase chain reaction- (PCR-) based method with the primer pair described in Lina et al. 2 Primers used in this study were as follows: 5′ATCATTAGGTAAAATGTCTGGACATGATCCA 3′ as forward and 5′GCATCAASTGTATTGGATAGCAAAAGC 3′ as reverse [16]. In this study Staphylococcus aureus strain, ATCC 49775, was used as positive control and distilled water was used as a negative control. DNA amplification was performed on an Eppendorf cycler in a final volume of 20 μL reaction containing 1.5 mM of MgCl2, 250 μM dNTPmix, 1 μM of each primer (20 NM), 1 U of Taq DNA polymerase, 10 mM Tris-HCL (PH 9.0), 30 mM KCL, and 4 μM of template DNA. Amplification was carried out with first denaturation at 94°C for 5 min (first denaturation) followed by 36 cycles according to the following program: denaturation at 94°C for 45 sec, annealing at 61.3°C for 45 sec, and extension at 72°C for 45 sec, plus a final extension at 72°C for 5 min to complete partial polymerization. The PCR products were resolved by electrophoresis through a 1.5% agarose gel containing ethidium bromide (Bio-Rad, UK). The PCR purification kit (Bioneer Co., Korea) was used to purify PCR products and sequencing of forward strand was performed by the Bioneer Company (Korea). The nucleotide sequences were analyzed with Chromas 1.45 software and MEGA-4 software and BLAST in NCBI.

2.7. Statistical Analysis

The statistical analysis was performed with SPSS (version 19, Chicago, IL, USA). The chi-square test or Fisher's exact test was used to compare proportions. A p value of < 0.05 was considered significant.

3. Result

57.9% (196/338) were pemphigus patients and 42.1% (142/338) were other skin infections. 52.9% (179/338) were Staphylococcus aureus isolates. 116 out of 196 (59.1%) pemphigus patients had Staphylococcus aureus skin and soft tissue infection, 55 out of 196 (28%) had S. epidermidis, 3.5% had E. coli, 2.5% had Pseudomonas aeruginosa, 2% had Klebsiella spp., 1% had Proteus spp., 1% had nonhemolytic Streptococcus, 0.5% had Diphtheroids, 0.5% had Citrobacter spp., 0.5% had Providencia spp., 0.5% had Enterobacter spp., and 0.5% had Serratia spp. (Figure 1).
Figure 1

Etiological agents of skin and soft tissue infection of pemphigus patients.

The mean age of 116 patients was 42.5 ± 17.53 years (range: 6–88) including 54.4% male and 45.6% female. 87 out of 116 (75%) pemphigus patients with S. aureus skin and soft tissue were hospitalized. 22 out of 116 (18.9%) had nosocomial infection. The mean days of hospitalization were 4.5 ± 3.9 days (Table 1).
Table 1

Demographic information of S. aureus infection of pemphigus patients in this study.

CharacteristicsNumber (%)
Age range (year)6–88
Mean age (year) (SD)42.5 ± 17.53
Length of stay (day) range0–15
Mean length of stay (day) (SD)8.3 ± 5.3
Length of stay (day)
 ≤1 week67 (57.7)
 More than one week21 (18.1)
Sex
 Male63 (54.4)
 Female53 (45.6)
Hospitalization
 Yes87 (75)
 No29 (25)
Nosocomial infection
 Yes22 (18.9)
 No94 (81.1)
MRSA49 (42.2)
MSSA67 (57.7)
PVL gene positive25 (18.3)
MRSA carry PVL gene14 (28.5)
MSSA carry PVL gene11 (16.4)
Of the 116 S. aureus isolates from skin infection of pemphigus patients included in this study, 48 (41.3%) were MRSA (OR = 2.3, p = 0.006), 57.7% were MSSA (67/116), and 52.5% were MDR (OR = 1.8, p = 0.036). The prevalence rate of PVL-producing S. aureus infection in pemphigus patients was 21.5% (25/116) (Figure 2). Of these PVL positive S. aureus isolates, 14 (56%) were MRSA and 11 (44%) were MSSA (Table 2).
Figure 2

PCR product of PVL gene (agarose 1.5%). Lane Ladder: molecular size marker. Lane 3: positive control for PVL gene (433 bp). Lane 2: negative control. Lanes 4 and 6–12: positive isolate from patient For PVL gene.

Table 2

Factors associated with S. aureus skin and soft tissue infections in pemphigus patients and other skin infections.

Pemphigus patientsOther skin infectionOR (95% CI) p value
MRSA49 (42.2)29 (46)2.3 (1.2–4.2)0.006
MDR61 (52.5)35 (55.5)1.8 (1.03–3.3)0.036
PVL gene 25 (21.5)10 (15.8)1.1 (0.5–2.3)0.7
Sex (male/female)63/5328/350.6 (0.36–1.15)0.13
Nosocomial infection22 (18.9)17 (26.9)2.28 (1.06–4.9)0.032
Antibiotic usage94 (81.03)53 (84.1)3.28 (1.57–6.81)0.001
Usage of vancomycin22 (18.9)20 (31.7)4.09 (1.7–9.6)0.001
Usage of aminoglycosides42 (36.2)24 (38)3.39 (1.7–6.6)<0.001
Previous antibiotic usage17 (14.6)9 (14.2)2.61 (1.08–6.29)0.028
Corticosteroids usage 79 (68.1)35 (55.5)4.6 (2.5–8.7) <0.001
93.9% of the isolates were penicillin resistant; all of the strains showed sensitivity to linezolid and 99.1% of the isolates were daptomycin susceptible. All isolates were sensitive to vancomycin (Figure 3).
Figure 3

The frequency percent of antibiotic resistance of S. aureus isolated from pemphigus patients.

4. Discussion

Pemphigus is a well-known autoimmune disease [17]. Nowadays, the relationship between autoimmunity, immunodeficiency, and infection is well recognized. It is believed that autoimmunity and immunodeficiency are not separate entities; rather some connection exists between them [18, 19]. On the other hand, hospitalization in addition to immunosuppressive therapy would predispose the PV patients to infection. In some studies bacterial infections have been reported [20, 21]. Most bacterial skin infections detected in our patients were due to Staphylococcus aureus. In other studies in PV patients, skin infections due to Staphylococcus aureus have been reported as well [22]. Kanwar and Dhar reported that sepsis was the most common cause of causes of deaths in PV patients, and S. aureus was the responsible pathogenic agent in 4 cases of death [23]. In our study 53.7% of pemphigus patients had S. aureus skin and soft tissue infections (SSTIs), and 53.6% were MRSA. To date no study has described the clinical spectrum and epidemiology of MRSA and PVL positive infections in the pemphigus patient population in Iran. Our study found association of MRSA with S. aureus SSTIs in pemphigus patients. This study showed that 21.5% of S. aureus isolates from skin or soft tissue infections of pemphigus patients had PVL positive S. aureus. Data from the UK in 2010 found that 20% of S. aureus isolates from skin or soft tissue infections contained PVL positive S. aureus. The result of study of Fogo et al. on PVL positive Staphylococcus aureus skin infections described that the prevalence of PVL is considered to be higher than 2% [24]. The study of Havaei et al. on prevalence of genes encoding bicomponent leukocidins among clinical isolates of methicillin-resistant S. aureus in Iran showed that 24.2% of the isolates were PVL positive and this percentage was higher than that in the European countries [25]. Indeed more than 94% of the patients were PVL positive isolates related to cutaneous samples [25]. PVL gene is carried by 19.2% of isolates of methicillin-resistant S. aureus. The study of Holems et al. on S. aureus isolates carrying Panton-Valentine leucocidin genes in England and Wales reported that PVL gene is carried by <2% of isolates of S. aureus, both methicillin-sensitive S. aureus (MSSA) and methicillin-resistant S. aureus (MRSA) [26]. In summary, more than fifty percent of the pemphigus patients in this study were colonized by MRSA. 3 out of 32 nosocomial MRSA cases were PVL gene positive. Pemphigus was significantly associated with MRSA colonization. The significant difference was seen between S. aureus SSTI in pemphigus patients with male gender, MDR, previous antibiotic usage, especially vancomycin and aminoglycosides, corticosteroids usage, and nosocomial infection.

5. Conclusion

This is the first report of S. aureus infection in pemphigus patients in Iran. Autoimmune process and immunosuppressive therapy of pemphigus would predispose the patients to infections. S. aureus infection in patients with pemphigus was high compared to other bacteria. PVL gene carried by methicillin-resistant S. aureus was high in this study.
  21 in total

Review 1.  Autoimmune bullous skin diseases. Part 1: Clinical manifestations.

Authors:  Andrea Kneisel; Michael Hertl
Journal:  J Dtsch Dermatol Ges       Date:  2011-10       Impact factor: 5.584

Review 2.  Pemphigus and infectious agents.

Authors:  Lior Sagi; Yaniv Sherer; Henri Trau; Yehuda Shoenfeld
Journal:  Autoimmun Rev       Date:  2008-08-14       Impact factor: 9.754

Review 3.  Mechanisms of blister induction by autoantibodies.

Authors:  Cassian Sitaru; Detlef Zillikens
Journal:  Exp Dermatol       Date:  2005-12       Impact factor: 3.960

4.  Factors responsible for death in patients with pemphigus.

Authors:  A J Kanwar; S Dhar
Journal:  J Dermatol       Date:  1994-09       Impact factor: 4.005

Review 5.  Immune deficiency and autoimmunity.

Authors:  Thomas Prescott Atkinson
Journal:  Curr Opin Rheumatol       Date:  2012-09       Impact factor: 5.006

6.  Involvement of Panton-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia.

Authors:  G Lina; Y Piémont; F Godail-Gamot; M Bes; M O Peter; V Gauduchon; F Vandenesch; J Etienne
Journal:  Clin Infect Dis       Date:  1999-11       Impact factor: 9.079

7.  Staphylococcus aureus isolates carrying Panton-Valentine leucocidin genes in England and Wales: frequency, characterization, and association with clinical disease.

Authors:  A Holmes; M Ganner; S McGuane; T L Pitt; B D Cookson; A M Kearns
Journal:  J Clin Microbiol       Date:  2005-05       Impact factor: 5.948

8.  Pemphigus vulgaris: a 11-year review.

Authors:  N Chmurova; D Svecova
Journal:  Bratisl Lek Listy       Date:  2009       Impact factor: 1.278

9.  Prevalence of Genes Encoding Bi-Component Leukocidins among Clinical Isolates of Methicillin Resistant Staphylococcus aureus.

Authors:  Sa Havaei; S Ohadian Moghadam; Mr Pourmand; J Faghri
Journal:  Iran J Public Health       Date:  2010-03-31       Impact factor: 1.429

Review 10.  Immunopathology and molecular diagnosis of autoimmune bullous diseases.

Authors:  Sidonia Mihai; Cassian Sitaru
Journal:  J Cell Mol Med       Date:  2007 May-Jun       Impact factor: 5.310

View more
  3 in total

1.  Features and associated factors of bacterial skin infections in hospitalized patients with pemphigus: a single-center retrospective study.

Authors:  Furong Li; Yejun Wu; Wenjie Bian; Lei Huang; Xuejun Zhu; Xixue Chen; Mingyue Wang
Journal:  Ann Clin Microbiol Antimicrob       Date:  2020-10-08       Impact factor: 3.944

2.  Pemphigus foliaceus presenting with violaceous, painful nodules and an aberrant auto-antibody expression in a Latino patient.

Authors:  Jeffrey N Li; Parth Patel; Cristian Gonzalez; Travis Vandergriff; Heather Goff
Journal:  JAAD Case Rep       Date:  2021-03-02

3.  Methicillin-resistant Staphylococcus aureus colonization of infectious and non-infectious skin and soft tissue lesions in patients in Tehran.

Authors:  Haniyeh Khalili; Shahin Najar-Peerayeh; Mona Mahrooghi; Parvin Mansouri; Bita Bakhshi
Journal:  BMC Microbiol       Date:  2021-10-18       Impact factor: 3.605

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.