Literature DB >> 27785385

Isolation and characterization of microsatellite markers in the Lepisorus clathratus complex (Polypodiaceae).

Cun-Feng Zhao1, Myounghai Kwak2, Qiao-Ping Xiang3.   

Abstract

PREMISE OF THE STUDY: Microsatellites were designed and characterized in the Sino-Himalayan fern Lepisorus clathratus complex (Polypodiaceae) to further study the phylogeography and reproductive ecology of this species. METHODS AND
RESULTS: From a genomic library obtained by next-generation sequencing, 10 polymorphic and six monomorphic microsatellite loci were developed. In one population of L. clathratus from Taibaishan in central China, the number of alleles observed for these microsatellites ranged from seven to 29, and observed and expected heterozygosity ranged from 0.463 to 0.919 and from 0.797 to 0.947, respectively. Cross-amplification in other taxa within this complex was successful, but cross-amplification was poor for other congeneric species.
CONCLUSIONS: This set of newly developed microsatellite markers will be useful for assessing genetic diversity, population structure, and mating system, and to infer polyploid origin in the L. clathratus complex.

Entities:  

Keywords:  Lepisorus clathratus complex; Polypodiaceae; ferns; microsatellites; next-generation sequencing; polyploid origin

Year:  2016        PMID: 27785385      PMCID: PMC5077284          DOI: 10.3732/apps.1600069

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Lepisorus clathratus (C. B. Clarke) Ching (Polypodiaceae) is an alpine fern species complex, mainly distributed in the Hengduan Mountains, the Qinghai–Tibetan Plateau and adjacent areas, and in other mountain regions of high latitude in northern China, Russia, and Japan. The monophyly of the L. clathratus complex has been confirmed by phylogenetic study of the genus (Wang et al., 2010). However, morphological variation, especially of the two types of sporangia (dehiscent and indehiscent), has resulted in confusing taxonomic treatments. For example, in the Flora of China, six species of the L. clathratus complex are recorded: L. clathratus, L. thaipaiensis Ching & S. K. Wu, L. crassipes Ching & Y. X. Lin, L. albertii (Regel) Ching, L. waltonii (Ching) S. L. Yu, and L. likiangensis Ching & S. K. Wu (Qi et al., 2013). Moreover, the indehiscent sporangia may promote self-fertilization by reducing the ability of spores to spread out. The hypothesis that these two types of sporangia have different mating systems needs to be tested by suitable molecular tools, such as microsatellite markers. In addition, the phylogeography of the L. clathratus complex has been reconstructed with two chloroplast DNA regions (Wang et al., 2011), but these lack complementary nuclear data. Another recent study (Wang et al., 2012) preliminarily confirmed the occurrence of polyploidy and hybridization in the L. clathratus complex, but its polyploid origin has yet to be studied. Microsatellite markers are considered the most suitable for genetic studies because they are codominant, highly polymorphic, and have abundant, specific, and uniformly distributed loci in plant genomes (Mantello et al., 2012). Simple sequence repeat (SSR) markers are versatile molecular tools for ferns to solve the problem of inferring phylogeography or population genetics (Jiménez et al., 2008) and can be used to infer allopolyploid or autopolyploid origin (Palop-Esteban et al., 2012). However, to date, no microsatellite markers have been developed in the L. clathratus complex. The aim of the current study was to isolate a set of microsatellite markers in the L. clathratus complex to facilitate further study of its genetic structure, gene flow pattern, mating system, and polyploid origin.

METHODS AND RESULTS

Sampling these plants was difficult because populations of this species are usually very small, owing to the extremely alpine habitats. Therefore, we paid particular attention to large populations. Additionally, because polyploidy is widespread in this species, we focused on diploid individuals, for which genotyping was more easily accomplished. According to the requirements noted above, a population of 41 diploid individuals (determined by chromosome counting and flow cytometry, unpublished data) of L. clathratus (regular sporangia type) was collected at Taibaishan, Shaanxi, China, with a minimum interval of 50 m between individuals, to avoid sampling the same clone. Total DNA was extracted from silica gel–dried leaves using the Plant Genomic DNA Kit (Tiangen Biotech, Beijing, China). One individual was used for next-generation sequencing (NGS). The NGS libraries were generated using aliquots of ca. 10 μg of genomic DNA and sequenced on the Roche 454 GS-FLX Titanium platform (454 Life Sciences, Branford, Connecticut, USA). The obtained sequence reads were assembled using Newbler 2.6 (Roche Diagnostics, Mannheim, Germany) with a 96% minimum overlap identity. In total, 440 Mbp of sequence reads were obtained. Dinucleotide and trinucleotide repeats of more than four iterations were searched using the Perl program “SSR_finder.pl” (Tóth et al., 2000; Yu et al., 2011). A pair of primers flanking each repeat was designed to amplify the fragment containing repeats using Primer3 (Untergasser et al., 2012). The optimal primer size was set to a range of 18–26 bases and the optimal melting temperature to 58°C. The optimal product size was set to 100 to 400 bp, and the remaining parameters were left as the default settings. In 10 randomly chosen individuals, we tested 109 primer pairs for amplification using the PCR conditions described below, and 22 of them successfully amplified a single band. PCR reactions were performed in a total volume of 20 μL containing 10 μL of 2× Taq PCR MasterMix (500 μM dNTP, 3 mM MgCl2, 1 unit of Taq DNA polymerase, and 20 mM Tris-HCl; Tiangen Biotech), ca. 25 ng of DNA, and 0.2 μM each of forward primer and reverse primer. The PCR process consisted of the following steps: predenaturation (10 min at 94°C); 35 cycles of denaturation (30 s at 94°C), annealing (30 s at 58°C), and extension (30 s at 72°C); and a final extension of 7 min at 72°C using a Veriti 96-Well Thermal Cycler (Applied Biosystems, Waltham, Massachusetts, USA). To confirm the sequence of each of the 22 primer pairs and their PCR products, we performed cloning with the pEASY-T3 Cloning Kit (Transgen Biotech, Beijing, China). For each individual, four clones were sequenced using primer M13F on an ABI3730 automatic sequencer (Applied Biosystems). Sixteen primer pairs containing real SSRs were confirmed. The 16 primer pairs were further tested for genotyping all individuals using the 5′ fluorescence-labeled forward primers (FAM, HEX, or TAMRA). The PCR reagents used and thermal cycler program were the same as described above. PCR products were run on an ABI 3730XL sequencer with GeneScan 500 LIZ Size Standard (Applied Biosystems). Sizes were determined with GeneMarker version 2.2 (SoftGenetics, State College, Pennsylvania, USA). The number of alleles (A), observed heterozygosity (Ho), expected heterozygosity (He), fixation index (F), and departures from Hardy–Weinberg equilibrium (HWE) were calculated in GenAlEx 6.5 (Peakall and Smouse, 2012). Ten primer pairs proved to be polymorphic while the remaining six were monomorphic (Table 1). Alleles per locus numbered seven to 29 (average 21.1); Ho and He ranged from 0.463 to 0.919 and from 0.797 to 0.947, respectively (Table 2). Five loci (LC019, LC068, LC089, LC090, LC105) departed from HWE (P < 0.05 or P < 0.001) (Table 2).
Table 1.

Characteristics of 16 nuclear microsatellite loci isolated from the Lepisorus clathratus complex.

LocusPrimer sequences (5′–3′)Repeat motifFluorescent labelAllele size range (bp)GenBank accession no.
LC017F: CCAATATCAAAACTCATTGTGC(TG)36FAM123–295KX171640
R: GCTTACTTGCTACACCCAAGG
LC019F: TAGTAGCAGACGAGACAAGCAA(CA)12HEX110–174KX171641
R: GACAATCATTTGTTGTGCATTC
LC038F: TACTTGTGTAAATGACACGGGA(TG)28TAMRA213–285KX171642
R: AAATGCGAGTGAGAGAAAGAGT
LC065F: ATATAGCTTGCGTGAAACACCT(AG)19HEX114–202KX171643
R: CGTCATTTGAGTAAAGAGGGAG
LC067F: TTTTGCTTTCTGTTGGTTAGGT(AG)24TAMRA131–237KX171644
R: ATGAGCATCCCTCACATAGAAG
LC068F: GCATTAATGGGCTTTTCCTT(AG)21HEX125–181KX171645
R: AGTGTGGGATCTGTGGTAGG
LC089F: CATTATTTTGGCTACATGGCTT(AG)20TAMRA163–259KX171646
R: ACATTGTGTCCCCAATATCAAT
LC090F: GCATACGTAAGTGGGTGGAG(AG)21FAM107–207KX171647
R: TTTGCTTTGCCCTCTCTATG
LC092F: CTCCATGCTGACCCTTACAT(AG)24HEX230–330KX171648
R: AAAGAGGAGAGCGCTTCAAT
LC105F: AAACTGCATGGATGTGACAG(AG)27TAMRA179–229KX171649
R: GTAACGGGAGCTAGGGAAAG
LC002F: CCATGAAAAGGTATAGAATGGG(CA)25T(CA)2AT(CA)44FAM273KX171650
R: CCCAACAGATGTAATGGACTTT
LC009F: CCTTGAGGTGCTTGTAGGTAAG(TG)21HEX163KX171651
R: ACAAACTCAAAGCAGTGTAGCA
LC029F: AGATGGGTACGAAGGATTACCT(AG)22TAMRA169KX171652
R: TGAGCCACTCAACTAACACTTG
LC043F: AGTTTGTTGGTGGTTGTGCT(TG)14FAM238KX171653
R: TCTCCCAGGTGATGATGAGT
LC073F: GCATGAGCCATGTCGAGT(AG)25HEX160KX171654
R: ATCCATTCTCTGGCTCTCACT
LC099F: CGTCTATGTAGGAAATTGGAGC(AG)16TAMRA225KX171655

Annealing temperature for all reactions was 58°C.

Table 2.

Genetic properties of 10 polymorphic nuclear microsatellite loci developed in Lepisorus clathratus for 41 individuals sampled in central China.

LocusNAHoHeFb
LC01739210.7950.8720.089
LC019417 0.4630.7970.418***
LC03837270.9190.9470.030
LC06540160.8000.8810.092
LC06740260.7000.9390.255
LC06840230.8000.9390.148*
LC08936290.8330.9470.120***
LC09035230.6860.8990.237***
LC09239180.8210.8830.071
LC10539210.4870.9210.471***

Note: A = number of alleles; F = fixation index; He = expected heterozygosity; Ho = observed heterozygosity; N = number of individuals genotyped.

Voucher and locality information are provided in Appendix 1.

Deviations from Hardy–Weinberg equilibrium: *P < 0.05, **P < 0.01, ***P < 0.001.

Characteristics of 16 nuclear microsatellite loci isolated from the Lepisorus clathratus complex. Annealing temperature for all reactions was 58°C. Genetic properties of 10 polymorphic nuclear microsatellite loci developed in Lepisorus clathratus for 41 individuals sampled in central China. Note: A = number of alleles; F = fixation index; He = expected heterozygosity; Ho = observed heterozygosity; N = number of individuals genotyped. Voucher and locality information are provided in Appendix 1. Deviations from Hardy–Weinberg equilibrium: *P < 0.05, **P < 0.01, ***P < 0.001. Additionally, we performed cross-species amplification to test the transferability of these markers to other members of the L. clathratus complex: L. waltonii (irregular sporangia type, diploid, determined by chromosome counting and flow cytometry, unpublished data; 8 individuals) and L. likiangensis (tetraploid, determined by chromosome counting and flow cytometry, unpublished data; 8 individuals), as well as two distantly related congeneric species, L. scolopendrium (Buch.-Ham. ex Ching) Mehra & Bir (8 individuals) and L. morrisonensis (Hayata) H. Itô (10 individuals) (Appendix 1). Cross-amplification in L. waltonii was moderately successful (Table 3), suggesting a relatively recent divergence from L. clathratus. Low monomorphic pattern in the tetraploid L. likiangensis population revealed extremely low diversity (Table 3). The markers showed quite low transferability in L. scolopendrium and L. morrisonensis, with just two markers successfully amplifying (Table 3).
Table 3.

Cross-amplification results and genetic properties of microsatellite loci developed for Lepisorus clathratus in L. waltonii, L. likiangensis, L. scolopendrium, and L. morrisonensis.

L. waltonii (n = 8)L. likiangensis (n = 8)L. scolopendrium (n = 8)L. morrisonensis (n = 10)
LocusAHoHeAHoHeAHoHeAHoHe
LC01780.6250.797
LC01921.0000.500
LC038
LC065710.76621.0000.50030.1250.53950.3000.730
LC06750.1250.57010.0000.000
LC06870.6250.79721.0000.50041.0000.742610.750
LC0891010.84421.0000.500
LC09010.0000.000
LC09221.0000.500
LC10550.7500.72710.0000.000

Note: — = failed amplification; A = number of alleles; F = fixation index; He = expected heterozygosity; Ho = observed heterozygosity; n = number of individuals sampled.

Voucher and locality information are provided in Appendix 1.

Cross-amplification results and genetic properties of microsatellite loci developed for Lepisorus clathratus in L. waltonii, L. likiangensis, L. scolopendrium, and L. morrisonensis. Note: — = failed amplification; A = number of alleles; F = fixation index; He = expected heterozygosity; Ho = observed heterozygosity; n = number of individuals sampled. Voucher and locality information are provided in Appendix 1.

CONCLUSIONS

We successfully developed and amplified the first set of microsatellite markers for the Sino-Himalayan fern, L. clathratus complex. Among them, 10 microsatellite markers display a high level of polymorphism that will help to estimate more reliable genetic diversity parameters and to further reconstruct the population history of the L. clathratus complex. These markers may also be useful tools to study mating system and infer polyploid origin in the L. clathratus complex, and to explore other taxonomic problems.
Appendix 1.

Voucher and locality information of all Lepisorus samples used in this study. Vouchers are deposited at the Chinese National Herbarium of the Institute of Botany, Chinese Academy of Sciences (PE).

SpeciesCollection no.LocalityGeographic coordinates
L. clathratus (C. B. Clarke) ChingChun-Ce Guo & Chong-Wu 080619Taibaishan, Shaanxi, China34.0390°N, 107.7202°E
L. waltonii (Ching) S. L. YuCun-Feng Zhao & Zhong-Shuai Zhang NR1-26Lhasa, Xizang, China29.7130°N, 91.0994°E
L. likiangensis Ching & S. K. WuXian-Chun Zhang 7608Yulong Xueshan, Yunnan, China27.0283°N, 100.2634°E
L. scolopendrium (Buch.-Ham. ex Ching) Mehra & BirYi-Zhen Shao 2622Xizang, ChinaNA
L. morrisonensis (Hayata) H. ItôCun-Feng Zhao & Zhong-Shuai Zhang XZ-25Sejila, Xizang, China29.5663°N, 94.5735°E

Note: NA = not available.

  10 in total

1.  Reproductive and competitive interactions among gametophytes of the allotetraploid fern Dryopteris corleyi and its two diploid parents.

Authors:  Ares Jiménez; Luis G Quintanilla; Santiago Pajarón; Emilia Pangua
Journal:  Ann Bot       Date:  2008-06-21       Impact factor: 4.357

2.  Phylogeny of the paleotropical fern genus Lepisorus (Polypodiaceae, Polypodiopsida) inferred from four chloroplast DNA regions.

Authors:  Li Wang; Xin-ping Qi; Qiao-ping Xiang; Jochen Heinrichs; Harald Schneider; Xian-chun Zhang
Journal:  Mol Phylogenet Evol       Date:  2009-09-06       Impact factor: 4.286

3.  Polyploid origin, genetic diversity and population structure in the tetraploid sea lavender Limonium narbonense Miller (Plumbaginaceae) from eastern Spain.

Authors:  M Palop-Esteban; J G Segarra-Moragues; F González-Candelas
Journal:  Genetica       Date:  2011-10       Impact factor: 1.082

4.  Microsatellites in different eukaryotic genomes: survey and analysis.

Authors:  G Tóth; Z Gáspári; J Jurka
Journal:  Genome Res       Date:  2000-07       Impact factor: 9.043

5.  GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research--an update.

Authors:  Rod Peakall; Peter E Smouse
Journal:  Bioinformatics       Date:  2012-07-20       Impact factor: 6.937

6.  Primer3--new capabilities and interfaces.

Authors:  Andreas Untergasser; Ioana Cutcutache; Triinu Koressaar; Jian Ye; Brant C Faircloth; Maido Remm; Steven G Rozen
Journal:  Nucleic Acids Res       Date:  2012-06-22       Impact factor: 16.971

7.  Microsatellite marker development for the rubber tree (Hevea brasiliensis): characterization and cross-amplification in wild Hevea species.

Authors:  Camila C Mantello; Fernando I Suzuki; Livia M Souza; Paulo S Gonçalves; Anete P Souza
Journal:  BMC Res Notes       Date:  2012-06-25

8.  Phylogeography of the Sino-Himalayan fern Lepisorus clathratus on "the roof of the world".

Authors:  Li Wang; Zhi-Qiang Wu; Nadia Bystriakova; Stephen W Ansell; Qiao-Ping Xiang; Jochen Heinrichs; Harald Schneider; Xian-Chun Zhang
Journal:  PLoS One       Date:  2011-09-30       Impact factor: 3.240

9.  Fast and cost-effective mining of microsatellite markers using NGS technology: an example of a Korean water deer Hydropotes inermis argyropus.

Authors:  Jeong-Nam Yu; Changman Won; Jumin Jun; Youngwoon Lim; Myounghai Kwak
Journal:  PLoS One       Date:  2011-11-01       Impact factor: 3.240

10.  Indehiscent sporangia enable the accumulation of local fern diversity at the Qinghai-Tibetan Plateau.

Authors:  Li Wang; Harald Schneider; Zhiqiang Wu; Lijuan He; Xianchun Zhang; Qiaoping Xiang
Journal:  BMC Evol Biol       Date:  2012-08-28       Impact factor: 3.260

  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.