miR-139-5p regulates proliferation, apoptosis, and cell cycle of uterine leiomyoma cells by targeting TPD52.

BACKGROUND: Uterine leiomyoma is one of the most common benign tumors in women. It dramatically decreases the quality of life in the affected women. However, there is a lack of effective treatment paradigms. Micro-RNAs are small noncoding RNA molecules that are extensively expressed in organisms, and they are interrelated with the occurrence and development of the tumor. miR-139-5p was found to be downregulated in various cancers, but its function and mechanism in uterine leiomyoma remain unknown. The aim of this study was to investigate the role of miR-139-5p and its target gene in uterine leiomyoma.
METHODS: By using a bioinformatic assay, it was found that TPD52 was a potential target gene of miR-139-5p. Then, expressions of miR-139-5p and TPD52 in uterine leiomyoma and adjacent myometrium tissues were evaluated by quantitative real-time polymerase chain reaction and Western blot. Proliferation, apoptosis, and cell cycle of uterine leiomyoma cells transfected by miR-139-5p mimics or TPD52 siRNA were determined.
RESULTS: It was observed that the expression of miR-139-5p in uterine leiomyoma tissues was significantly lower (P<0.001) than that in the adjacent myometrium tissues. Overexpression of miR-139-5p inhibited the growth of uterine leiomyoma cells and induced apoptosis and G1 phase arrest. Dual-luciferase reporter assay and Western blot validated that TPD52 is the target gene of miR-139-5p. Furthermore, downregulation of TPD52 by siRNA in uterine leiomyoma cells inhibited cell proliferation and induced cell apoptosis and G1 phase arrest.
CONCLUSION: Data suggested that miR-139-5p inhibited the proliferation of uterine leiomyoma cells and induced cell apoptosis and G1 phase arrest by targeting TPD52.

Introduction

Uterine leiomyoma is one of the most common tumors in reproductive-age women and it causes a major public health issue worldwide.1 Women who are diagnosed with uterine leiomyoma symptoms usually suffer from pelvic pressure, congestion, bloating, heaviness, dyspareunia, urinary frequency, constipation, reproductive dysfunction, and abnormal bleeding.2,3 Besides its negative effect on the quality of life, uterine leiomyoma also causes a huge financial burden.4–6 However, efficient treatments for uterine leiomyoma are still limited owing to the ambiguous understanding of its molecular mechanism.

Micro-RNAs (miRNAs) are small noncoding RNA molecules ∼22–24 nucleotides in length and are extensively expressed in organisms.7 They repress gene expression by binding to the complementary sequences in the 3′ untranslated region (3′UTR) of mRNAs to induce their degradation and prevent their translation.8 Growing evidences showed that amplification and overexpression of oncomiRs and genetic loss of tumor suppressor miRNA are connected with human cancer.9 miR-139-5p was recently found to be downregulated in various cancers and this downregulation plays a tumorigenic role.10 miR-139-5p was also found to be downregulated in uterine leiomyoma,11 but its function and mechanism in this disease remain unknown.

Human TPD52 was reported to be overexpressed in several human cancers, including breast cancer,12 prostate cancer,13 ovarian cancer,14 pancreatic adenocarcinoma,15 and other cancers. Several studies revealed that TPD52 acts as a tumor promoter by influencing cell survival, proliferation, migration, and invasion.16 It is also linked to the poor prognosis of breast cancer, medulloblastoma, lung cancer, and prostate cancer.17 However, neither the expression pattern of TPD52 in uterine leiomyoma nor its function in uterine leiomyoma formation and development was reported.

This study investigated the expression pattern of miR-139-5p and TPD52, their function, and relationships in both uterine leiomyoma tissues and cells. The results demonstrated that miR-139-5p inhibited the proliferation of uterine leiomyoma cells and induced apoptosis and G1 phase arrest by directly targeting TPD52. These results may provide some clues for exploring new targets and therapies for uterine leiomyoma.

Materials and methods

Reagents

miR-139-5p mimics, negative control (NC), and TPD52 siRNA were synthesized by GenePharma Co. Ltd. (Shanghai, People’s Republic of China). SiRNA-TPD52 (5′-UUCUCCGAACGUGUCACGUTT-3′), NC (5′-UUCUCCGAACGUGUCACGUTT-3′). The concentrations of both siRNA and NC were 100 nM.

Uterine leiomyoma and myometrium tissue samples and cells

Twenty pairs of uterine leiomyoma and myometrium tissue samples were obtained from patients with uterine leiomyoma after myomectomy in the First Affiliated Hospital of Guangxi Medical University from September 2014 to January 2015. Women in the age group of 29–55 years without hormonotherapy history and other complications were enrolled. Smooth muscle tissues, 0.5 cm distance from tumor tissue, were sampled as adjacent tissues. All the patients had an accurate histological diagnosis according to the clinicopathological criteria of the International Union for Cancer Control. The study was approved by the Ethics Committee of the First Affiliated Hospital of Guangxi Medical University, and written informed consents were obtained from patients. Uterine leiomyoma cells were obtained following the literature with some modifications.18 Tumor tissue samples collected as mentioned earlier were cut into small fragments with scissors and incubated in medium containing 0.1% (w/v) collagenase for 5–6 hours at 37°C. The digested tissues were filtered by 200-mesh sieve and then centrifuged at 1,000 rpm for 8 minutes. Supernatant was removed, and the cell pellets were resuspended and cultured in Dulbecco’s Modified Eagle’s Medium (Hyclone, Logan, UT, USA) containing 10% fetal bovine serum (Gibco, Detroit, MI, USA).

Quantitative real-time polymerase chain reaction

Total RNA was extracted from the cells or tumor tissues, using Trizol reagent (Takara Bio Inc., Tokyo, Japan) according to the manufacturer’s protocol. Complementary DNA was synthesized using Bestar qPCR RT Kit (DBI Bioscience, Ludwigshafen, Rheinland-Pfalz, Germany). The primers used in this study are listed in Table 1. Polymerase chain reaction (PCR) was performed at the conditions of 94°C for 2 minutes, followed by 40 cycles of 94°C for 20 seconds, 58°C for 20 seconds, and 72°C for 20 seconds. U6 or GAPDH was quantified as an internal control. Three replicates were run for each sample. Results were analyzed using the ΔΔCt method.

Table 1

Primers of PCR

Name of gene	Gene-specific primers (5′-3′)
hsa-miR-139-5p	Forward: ACACTCCAGCTGGGTCTACAGTGCACGTG
	Reverse: CTCAACTGGTGTCGTGGA
TPD52	Forward: AACAGAACATTGCCAAAGGGTG
	Reverse: TGACTGAGCCAACAGACGAAA
U6	Forward: CTCGCTTCGGCAGCACA
	Reverse: AACGCTTCACGAATTTGCGT
GAPDH	Forward: TGTTCGTCATGGGTGTGAAC
	Reverse: ATGGCATGGACTGTGGTCAT

Abbreviation: PCR, polymerase chain reaction.

Western blot

Tissue samples were homogenized and lysed. Treated cells were washed with phosphate-buffered saline (PBS) and lysed. By centrifugation for 10 minutes at 14,000 rpm under 4°C, the supernatants were collected, and the protein concentration was determined by Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific). Equal amounts of protein (20 μg) were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene difluoride membranes (EMD Millipore, Billerica, MA, USA). After washing with Tris-buffered saline (TBS), the membranes were blocked with TBS containing 5% skim milk and incubated with primary antibodies (TPD52, 1:1,500; Abcam, Cambridge, UK; GAPDH, 1:1,000; Abcam). After washing with Tris buffered saline with Tween®, the membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibody (HRP Goat anti-Rabbit IgG; Boster Biological Technology Co., Ltd.) Then, the membranes were developed using electrochemiluminescence system. Finally, the densitometry of protein bands was measured using Image-Pro Plus 6.0 system and normalized to relevant controls.

Cell viability

Cell viability was determined by Cell Counting Kit-8 (CCK-8; Dojindo). Briefly, uterine leiomyoma cells were seeded at a density of 1×104 per well in 96-well plates and incubated at 37°C for 24 hours. The medium was removed, and 50 μL of fresh medium was added, and then 50 μL of serum- and antibiotics-free medium containing miR-139-5p mimics, NC or TPD52 siRNA and Lipofectamine TM 2000 (Cat no: 52887; Thermo Fisher Scientific) was added. After incubation at 37°C for 4 hours, the medium was replaced by complete medium and incubated for different times (12 hours, 24 hours, or 48 hours). Supernatant was removed and 100 μL of CCK-8 test solution was added to each well. After 1-hour incubation at 37°C, the optical density value was measured at 450 nm using Multiskan MK3 Microplate Reader (Thermo Fisher Scientific).

Cell apoptosis

Cell apoptosis was determined by flow cytometry using Annexin V/PI Apoptosis Kit (MultiSciences Biotech, Hangzhou City, Zhejiang Province, People’s Republic of China). Briefly, uterine leiomyoma cells were seeded at a density of 2.5×105 per well in six-well plates and incubated at 37°C for 24 hours. Medium was removed and 500 μL of fresh medium was added, then 500 μL of serum- and antibiotics-free medium containing miR-139-5p mimics, NC or TPD52 siRNA and Lipofectamine TM 2000 (Cat no: 52887; Thermo Fisher Scientific) was added. After incubation at 37°C for 4 hours, the medium was replaced by complete medium and incubated for 48 hours. Cells were collected, washed with PBS, and resuspended in 200 μL 1× annexin-binding buffer containing Annexin V-fluorescein isothiocyanate (FITC) and propidium iodide (PI). The cells were incubated for 15 minutes at room temperature. Samples were immediately analyzed by flow cytometry.

Cell cycle distribution

Cell cycle was determined by flow cytometry using PI staining. After treating with miR-139-5p mimics, NC or TPD52 siRNA and Lipofectamine TM 2000 for 4 hours and incubating for 48 hours following the abovementioned apoptosis protocol, the cells were collected and resuspended in 250 μL PBS. The suspension was slowly added to the pre-cooled ethanol solution and incubated at 4°C overnight. Cells were collected, suspended in 200 μL of PI staining solution, and incubated for 15 minutes at room temperature. Samples were immediately analyzed by flow cytometry.

Dual-luciferase reporter assay

The 3′UTR of the TPD52 harboring either the miR-139-5p binding site (TPD52-3′UTR-wild type) or a mutant (TPD52-3′UTR-Mutant) was cloned into the psiCHECK-2 vectors (Promega Corporation, Fitchburg, WI, USA). Plasmid DNA and miR-139-5p mimics/inhibitor were co-transfected into 293T cells by Lipofectamine 2000. miR-139-5p inhibitor was also synthesized from GenePharma Co. Ltd. Luciferase activities were detected using the Luciferase Assay System (Promega Corporation).

Statistical analysis

Student’s t-test or one-way ANOVA was used to compare the differences among groups. P<0.05 was considered statistically significant. All the data were analyzed using Graphpad Prism 5.

Results

miR-139-5p downexpression and TPD52 upregulation coexisted in uterine leiomyoma tissues

To evaluate whether the expression levels of miR-139-5p and TPD52 were altered in patients with uterine leiomyoma, uterine leiomyoma tissues and adjacent myometrium were collected from patients, and the expression level of miR-139-5p and TPD52 was determined using quantitative real-time (RT)-PCR and Western blot. PCR results showed that the leiomyoma issues expressed significantly lower miR-139-5p levels compared with nontumor issues (P<0.001, Figure 1A). RT-PCR and Western blot results showed that TPD52 was significantly upregulated in uterine leiomyoma tissues compared with myometrium tissues (P<0.001, Figure 1B and C).

Figure 1

miR-139-5p was downexpressed and TPD52 was upregulated in uterine leiomyoma tissues compared with adjacent tissues.

Notes: (A) miR-139-5p was downexpressed in uterine leiomyoma tissues. Total RNA was extracted and miR-139-5p expression was determined by quantitative RT-PCR. (B) TPD52 mRNA was upregulated in uterine leiomyoma tissues. Total RNA was extracted and TPD52 mRNA expression was determined by quantitative RT-PCR. (C) TPD52 was upregulated in uterine leiomyoma tissues. TPD52 expression was determined by Western blot. “A” represents adjacent tissues; “T” represents leiomyoma tissues. Relative expressions of TPD52 compared with GAPDH were calculated, and expression levels in tumor and adjacent tissues were compared (***P<0.001).

Abbreviation: RT-PCR, real-time polymerase chain reaction.

Overexpression of miR-139-5p inhibited the proliferation of uterine leiomyoma cells and induced cell apoptosis and G1 phase arrest

To explore the biological function of miR-139-5p in uterine leiomyoma, miR-139-5p mimics were transfected to uterine leiomyoma cells, and its effects on the cell viability, apoptosis, and cell cycle were investigated. Two cultures of primary tumor cells from two different patients were used to confirm the results.

Quantitative RT-PCR was performed to determine the efficacy of transfection of miR-139-5p mimics. As shown in Figure 2A, the transfection of miR-139-5p mimics significantly enhanced the miR-139-5p expression compared with blank control and NC in both cultures (P<0.001).

Figure 2

miR-139-5p overexpression inhibited the proliferation of uterine leiomyoma cell and induced cell apoptosis and G1 phase arrest.

Notes: (A) miR-139-5p expression after transfection of miR-139-5p mimics was determined by RT-PCR (***P<0.001). (B) miR-139-5p overexpression inhibited the cell proliferation. Cells were treated with miR-139-5p mimics or NC. Cell growth was determined by CCK-8 assay at different time points. **P<0.01, compared with blank control and NC. (C) miR-139-5p overexpression induced cell apoptosis. Cells were treated with miR-139-5p mimics or NC and incubated for 72 hours. Apoptosis was measured by Annexin V/PI assay (**P<0.01). (D) miR-139-5p overexpression induced G1 phase arrest. Cells were transfected by miR-139-5p mimics or NC and incubated for 72 hours. Cell cycle distribution was strained by PI and determined by flow cytometry (*P<0.05).

Abbreviations: CCK-8, Cell Counting Kit-8; NC, negative control; OD, optical density; PI, propidium iodide; RT-PCR, real-time polymerase chain reaction.

Then, the effect of overexpression of miR-139-5p on the cell proliferation was determined by CCK-8 assay. As shown in Figure 2B, the overexpression of miR-139-5p inhibited the proliferation of cells after 12-hour incubation, and the cell viability of tumor cells and normal cells was significantly different at 24 hours and 48 hours, respectively (P<0.01). These results demonstrated that the overexpression of miR-139-5p inhibited the uterine leiomyoma cell growth.

To investigate the effect of miR-139-5p on cell apoptosis, the Annexin V-FITC/PI staining method was used to perform apoptosis assays. The data demonstrated that cell apoptosis rate was increased after the transfection of miR-139-5p mimics (P<0.01, Figure 2C).

Cell cycle assay provided more detailed information. As shown in Figure 2D, most miR-139-5p mimics-treated cells were arrested in G1 phase compared with blank control and NC (P<0.01).

TPD52 is a target gene of miR-139-5p in uterine leiomyoma cells

To explore the mechanism how miR-139-5p influenced the cell growth, apoptosis, and cell cycle, bioinformatic tools were used to search for potential targets of miR-139-5p. Among various targets, TPD52 was focused because it was involved in the cancer oncogenesis and metastasis. TargetScan tool demonstrated that the 3′UTR of TPD52 contains a conserved binding site for miR-139-5p (Figure 3A).

Figure 3

TPD52 is a target gene of miR-139-5p in uterine leiomyoma cells.

Notes: (A) Bioinformatic study showed that 3′UTR of TPD52 contains a conserved binding site for miR-139-5p. (B) miR-139-5p overexpression inhibited the expression of TPD52 mRNA. Expression of mRNA was determined by RT-PCR (***P<0.001). (C) miR-139-5p overexpression inhibited the expression of TPD52 protein. miR-139-5p mimics or NC treated cells were incubated for 72 hours. Total protein was extracted and TPD52 expression was determined by Western blot. (D and E) Dual-luciferase reporter assay validated the TPD52 as a target of miR-139-5p (**P<0.01).

Abbreviations: NC, negative control; RT-PCR, real-time polymerase chain reaction; 3′UTR, 3′ untranslated region; WT, wild type; Mut, mutant type.

To validate that TPD52 is a target gene of miR-139-5p, the effect of miR-139-5p on the expression of TPD52 was determined by RT-PCR and Western blot. As shown in Figure 3B and C, RT-PCR and Western blot showed that overexpression of miR-139-5p inhibited the transcription of TPD52 gene and expression of TPD52 protein. Dual-luciferase reporter assay also confirmed TPD52 as a target gene of miR-139-5p (Figure 3D and E). Moreover, the treatment with an miR-139-5p inhibitor abolished the inhibition of luciferase activity induced by miR-139-5p (Figure 3D), which showed the specificity. Overall, these results validated that TPD52 was a target gene of miR-139-5p.

TPD52 downregulation reduced cell proliferation and induced cell apoptosis and G1 phase arrest

To demonstrate the function of TPD52 in the uterine leiomyoma, an siRNA targeting TPD52 was used to silence the expression of TPD52. As shown in Figure 4A, Western blot showed that siRNA treatment drastically reduced the TPD52 expression in uterine leiomyoma cells.

Figure 4

TPD52 downregulation reduced cell proliferation and induced apoptosis G1 phase arrest.

Notes: (A) TPD52 siRNA reduced the expression of TPD52. Cells were treated with siRNA or NC and incubated for 72 hours. TPD52 protein expression was determined by Western blot. (B) TPD52 downregulation reduced cell proliferation. Cells were treated with siRNA or NC and incubated for 48 hours. The cell viability at different time points was determined by CCK-8 assay. **P<0.01, compared with blank control and NC. (C) TPD52 downregulation induced cell apoptosis. Cells were treated with siRNA or NC and incubated for 72 hours. Apoptosis was determined by Annexin V/PI assay (**P<0.01). (D) TPD52 downregulation induced G1 phase arrest. Cells were treated with siRNA or NC and incubated for 72 hours. Cells were strained by PI and cell cycle was determined by flow cytometry (*P<0.05).

Abbreviations: CCK-8, Cell Counting Kit-8; NC, negative control; OD, optical density; PI, propidium iodide.

The effect of TPD52 downexpression on phenotype of uterine leiomyoma cells was further explored. In the cell viability assay, downregulation of TPD52 significantly reduced the proliferation of cells (Figure 4B). Furthermore, siRNA treatment for 48 hours induced the cell apoptosis (Figure 4C). Finally, the effect of TPD52 downregulation was investigated on the cell cycle, which showed that uterine leiomyoma cells were also arrested in G1 phase (Figure 4D).

Discussion

The expression of miR-139-5p in patients with uterine leiomyoma in the experiment was downregulated by 4-fold compared with myometrium. This result was consistent with previous findings of Marsh et al11 that miRNA microarray analysis showed miR-139 is significantly decreased in uterine leiomyoma by 4.29-fold compared with myometrium.

To the best of our knowledge, the biological functions of miR-139-5p in uterine leiomyoma were not reported before. Results demonstrated that overexpression of miR-139-5p inhibited the cell proliferation and induced cell apoptosis and G1 phase arrest. Then, bioinformatics study suggested that miR-139-5p may directly target 3′UTR of TPD52 transcripts to influence the expression of TPD52. This hypothesis was confirmed by RT-PCR, Western blot, and dual-luciferase reporter assay. These interactions were consistent with the phenomenon that miR-139-5p downexpression and TPD52 upregulation simultaneously existed in patients with uterine leiomyoma. Furthermore, TPD52 knockdown by TPD52 siRNA resulted in a similar outcome to that by miR-139-5p overexpression. Overall, it was concluded that miR-139-5p exhibited its antitumor activity by directly targeting TPD52.

The biological function of miR-139-5p and TPD52 in other cancers was extensively explored in the earlier studies. Most of the studies afforded similar conclusions to this study that miR-139-5p acted as an antitumor factor but TPD52 played a pro-tumor role in different kinds of cancers, but their relationships were not reported earlier.

In some types of cancers, miR-139-5p inhibits the proliferation of cancer cells and influences apoptosis and cell cycles For example, in esophageal squamous cell carcinoma, miR-139-5p suppressed EC109 cell proliferation and arrested the cells in G0/G1 phase.19 In glioma, upregulation of miR-139 suppressed the proliferation and enhanced temozolomide-induced apoptosis in U87 and LN229 cells by targeting Mcl-1.20 However, in other types of tumors, miR-139-5p had little effect on the cell growth and apoptosis, but influenced the invasion and migration of cancer cells. For instance, miR-139-5p did not alter the proliferation or DNA profile of human breast cancer MDA-MB-231 cell, but suppressed both invasion and migration of MDA-MB-231 cell by targeting HRAS, NFKB1, PIK3CA, RAF, and RHOT1 gene.21 Therefore, miR-139-5p adjusts different cell behaviors and signal pathways in different cell types.

In accordance with the results, TPD52 in other tumors also induces cell proliferation and apoptosis. The overexpression of TPD52 significantly increased the proliferation of prostate cancer LNCaP cells by 20% after 48 hours of incubation post transfection, but the downregulation of TPD52 led to decreased cell proliferation.22 Moreover, downregulation of TPD52 promoted apoptosis of LNCaP cells by activation of the intrinsic apoptosis pathway.22 Similar results were observed in another prostate cancer cell line C4-2.23

There are few evidences regarding the factors that alter the expression pattern of miR-139-5p in cancers. Future studies will explore the mechanism of miR-139-5p downregulation in uterine leiomyoma. Meanwhile, because a single miRNA species may have hundreds of gene targets and the expression of single protein can be regulated by numerous miRNA species,24 detailed studies should be carried out to find whether miRNA-139-5p can regulate other tumor-related targets and whether TDP52 can be targeted by other miRNAs in uterine leiomyoma. The further findings may provide ideal targets for developing new therapies to treat uterine leiomyoma.

Conclusion

This study demonstrated that miR-139-5p inhibited the proliferation of uterine leiomyoma cells and induced the cell apoptosis and G1 phase arrest by downregulating TPD52, which suggests that miR-139-5p and TPD52 could be potential targets for treating uterine leiomyoma. The determination of primary cell lines and images of these cells are shown in Figure S1. Uterine leiomyoma cells in vitro were determined by staining with monoclonal anti-actin (α-smooth muscle antibody). Positively stained cells were smooth muscle cells, where nucleus is shown in blue color and α-actin filaments in cytoplasm parallel to long cell axis present in red color. In this study, >95% of cells were positive, which demonstrated high purity of uterine leiomyoma cells.

Uterine leiomyoma cells in vitro were determined by staining with monoclonal anti-actin.

Abbreviation: DAPI, 4′,6-diamidino-2-phenylindole.