Development, genetic mapping and QTL association of cotton PHYA, PHYB, and HY5-specific CAPS and dCAPS markers.

BACKGROUND: Among SNP markers that become increasingly valuable in molecular breeding of crop plants are the CAPS and dCAPS markers derived from the genes of interest. To date, the number of such gene-based markers is small in polyploid crop plants such as allotetraploid cotton that has A- and D-sub-genomes. The objective of this study was to develop and map new CAPS and dCAPS markers for cotton developmental-regulatory genes that are important in plant breeding programs.
RESULTS: Gossypium hirsutum and G. barbadense, are the two cultivated allotetraploid cotton species. These have distinct fiber quality and other agronomic traits. Using comparative sequence analysis of characterized GSTs of the PHYA1, PHYB, and HY5 genes of G. hirsutum and G. barbadense one PHYA1-specific Mbo I/Dpn II CAPS, one PHYB-specific Alu I dCAPS, and one HY5-specific Hinf I dCAPS cotton markers were developed. These markers have successfully differentiated the two allotetraploid genomes (AD1 and AD2) when tested in parental genotypes of 'Texas Marker-1' ('TM-1'), 'Pima 3-79' and their F1 hybrids. The genetic mapping and chromosome substitution line-based deletion analyses revealed that PHYA1 gene is located in A-sub-genome chromosome 11, PHYB gene is in A-sub-genome chromosome 10, and HY5 gene is in D-sub-genome chromosome 24, on the reference 'TM-1' x 'Pima 3-79' RIL genetic map. Further, it was found that genetic linkage map regions containing phytochrome and HY5-specific markers were associated with major fiber quality and flowering time traits in previously published QTL mapping studies.
CONCLUSION: This study detailed the genome mapping of three cotton phytochrome genes with newly developed CAPS and dCAPS markers. The proximity of these loci to fiber quality and other cotton QTL was demonstrated in two A-subgenome and one D-subgenome chromosomes. These candidate gene markers will be valuable for marker-assisted selection (MAS) programs to rapidly introgress G. barbadense phytochromes and/or HY5 gene (s) into G. hirsutum cotton genotypes or vice versa.

Background

Single nucleotide polymorphisms (SNPs) and small insertion/deletion (indel) polymorphisms are widely-used molecular marker systems in plants [1]. SNP markers have several advantages including their abundance and stability, as well as opportunity for high-throughput genotyping assays [2]. Because SNPs occur in both coding and noncoding regions, they can be used for genetic diversity assessment, molecular evolutionary studies, and genetic mapping for traits of interest in crop species. In particular, ‘candidate’ gene SNP polymorphisms are of great interest to reliably associate phenotypes with potentially causal polymorphisms in crops [1]; therefore, SNPs, in particular ‘candidate’ gene-based markers are valuable tools for association mapping and marker-assisted selection (MAS) [3].

A SNP can be detected and utilized through different methods that include, but are not limited to, enzymatic and chemical mismatch assays, allele-specific PCR (ASP), nucleotide-amplified polymorphisms (SNAP), ligase chain reaction, single stranded confirmation polymorphism analysis (SSCP), di-deoxy fingerprinting, cleaved amplified polymorphic sequences (CAPS) and derived-CAPS [2, 4–6], and genotyping by sequencing (GBS) using next generation sequencing technology [7]. Each method has particular advantages and disadvantages, and the use of particular SNP detection methods depends on many factors including prior expertise and the availability of the suitable platform and equipment [2].

One of the most widely used SNP genotyping systems is composed of the CAPS [4] and dCAPS [5, 8, 9] methods. CAPS are based on restriction enzyme site polymorphisms detected after amplification of a locus by PCR. When such restriction sites are not available within the SNP locus, restriction site can be created during PCR amplification by using primer design to introduce new nucleotides adjacent to the SNPs of interest, making a synthetic restriction site in the amplified product allele (dCAPS). CAPS and dCAPS markers are widely used because they are (1) usually based on a known gene, (2) easy to develop and genotype using PCR and agarose gel electrophoresis, (3) needing only small amount of starting DNA, (4) feasible in a typical molecular biology laboratory, and (5) easy to score in a co-dominant/dominant fashion. Among them, the most important advantage is the ‘candidate’ gene-based feature of genotyped CAPS/dCAPS polymorphisms that increases the power of genetic mapping and reliable marker utilization in breeding programs [3]. As with other SNP genotyping methods, the application of CAPS and dCAPS genotyping is complicated in complex polyploid genomes (such as cotton and wheat) due to the presence of both paralogous and homeologous gene copies. CAPS and dCAPS markers can detect polymorphisms between homeologous sub-genomes (inter-homeologous SNPs) within individuals, as well as orthologous SNPs between individual genotypes (known as genome-specific polymorphisms or GSPs). CAPS and dCAPS markers are effectively target the GSPs that differentiate polymorphisms from only a single sub-genome of allopolyploid species, providing the opportunity to analyze polyploids as diploid organisms [10, 11].

In cotton, a SNP marker framework is being developed that is based the analysis of candidate genes [12, 13], EST and transcriptome sequencing [14-18] and whole genome sequencing [19]. With the emergence and application of high-throughput next generation sequencing (NGS) technologies and GBS, a large number of SNPs were detected and made available for the cotton research and breeding [7, 19–21]. SNP markers were used to validate fine mapping QTL regions associated with important fiber traits [22, 23] and genetic male sterility [24] in cotton. However, cultivated cottons have a large and complex tetraplpoid genome with two partially homoeologous sub-genomes: the A-sub-genome consisting of chromosomes 1–13 and D-sub-genome consisting of chromosomes 14–26. To date, only a few examples have been shown for the utilization of CAPS and dCAPS-based SNP genotyping in cotton [13, 25] although the merits and importance of these markers were clearly described in early genetic mapping studies [26]. There is a special need for the development of genome-specific CAPS and dCAPS markers for important cotton genes in order to facilitate rapid MAS programs that can be easily utilized by cotton breeders with limited access to high-throughput, expansive genomic facilities.

Here, the cotton phytochrome gene family and its signal transduction factor sequences were targeted to develop genome-specific CAPS and dCAPS SNP marker sets using comparisons Upland cotton Gossypium hirsutum and G. barbadense genome. Phytochromes and their signal transduction factors are the particular targets because of their multiple effects in plant development, and their involvement in a wide range of genetic/biochemical pathways [27], yield potential and productivity [28-32], plant flowering and architecture [33], cotton fiber quality [34-37], salt tolerance [38, 39], regulation of nitrate reductase [40, 41], in cold/freezing and drought tolerance [42-44], and in fungal disease resistance [45]. Previously, the cotton phytochrome gene family and its signal transduction factor HY5 were characterized, and their molecular evolution was studied by our group [35, 46], and cotton phytochromes were preliminarily associated with cotton fiber quality traits [35]. Recently, the biotechnology potential of phytochromes in the improvement of major fiber quality traits, early flowering and maturity, and increased cotton yield potential in a targeted RNA interference study was also reported by our team [37, 47].

The objective of this study was to develop and map cotton phytochrome (PHYA1 and PHYB) and HY5-specific CAPS and dCAPS markers using GSP sites that are polymorphic between G. hirsutum and G. barbadense. Further, these markers were validated and integrated into a reference genetic map of cotton, constructed by Yu et al. [48, 49], and the chromosomal assignments of CAPS and dCAPS markers were verified using chromosome substitution (CS-B) lines [50-52]. Further, we explored the association of these novel CAPS and dCAPS markers with cotton fiber traits that may be useful for MAS programs.

Results and discussions

Gene-specific CAPS and dCAPS marker development

Previously, one PHYA1 gene specific Bbv I CAPS marker targeting the 213 bp hinge region of cotton PHYA1 genes and detecting a G to A transition, was developed and validated in an interspecific mapping population that was segregating for fiber length [35]. The G. barbadense allele of the D-genome specific PHYA1 locus was co-dominantly digested by BbvI into the ~113 and 100 bp products, while G. hirsutum allele remained undigested.

In this study, to obtain better exploitation phytocrome genes in our breeding programs, the flanking upstream and downstream regions of previously characterized GSTs [35, 36] were sequenced and additional CAPS and dCAPS markers using commonly available restriction enzymes were developed. Upon sequencing upstream and downstream regions of cotton PHYA and HY5 genes, 2.2 kb long GSTs were obtained covering a part of first exons, second exons, and a part of third exon as well as the first and second introns of the cotton PHYA genes. The first, second and a part of third exon as well as first and second intron sequences for cotton HY5 genes (data not shown) also were cloned and sequenced, which then were used to develop GSP-specific CAPS and dCAPS markers. The 2.1 kb cotton PHYB GSTs of cotton corresponding to the part of first exon (covering the hinge region), first intron and part of the second exon of PHYB genes (PHYB1 and PHYB2) were already characterized [46], and these GSTs were searched to find suitable GSPs for marker development.

Using comparative sequence analysis of characterized GSTs PHYA1, PHYB, and HY5 genes of G. hirsutum and G. barbadense, a total of 10 pairs of CAPS and dCAPS primer pairs were designed (not shown). Out of these 10 primer pairs, one cotton PHYA1-specific CAPS (with Mbo I/Dpn II endonuclease digestion sites), one PHYB-specific dCAPS (with Alu I restriction site), and one HY5-specific (with Hinf I restriction site) dCAPS primer pairs successfully differentiated between A- and D-sub-genomes when tested in parental genotypes of ‘TM-1’ [(AD)1], ‘Pima-3–79’ [(AD)2], and interspecific F1 hybrids (Table 1; Figs. 1 and 2a-c).

Table 1

Cotton phytochrome and HY5-specific CAPS and dCAPS markers

#	CAPS markers	Primer sequences (5’–3’)	PCR products (bp)	Restriction enzyme	Restriction products (bp)
					G. hirsutum (‘TM-1’)	G. barbadense (‘Pima 3-79’)
1.	PHYA1_CAPS	F-5’TGCAAAGCAGGAACTTGGCAR-5’CATCCATTTGATAGTCCTTCCAC 3’	122	Mbo I Dpn II	51/71	122
2.	PHYB_dCAPS	F-5’CAACCTCAAAATCTGATGAAGTAAAC3’R-5’CTATCAAAACTCAGAACTGCTAAAGC3’	149	Alu I	149	125/149
3.	GhHY5-2_dCAPS	F-5’AACTATATCTGGGAATTACCGATT3’R-5’GTTTCGCAACAACCTCTTTTCA3’	97	Hinf I	27/70	97

Fig. 1

Targeted polymorphisms and restriction sites in phytochrome and HY5-specific CAPS and dCAPS markers. Gh - G. hirsutum, Gb - G. barbadense

Fig. 2

Agarose gel electrophoresis for undisgested and digested CAPS and dCAPS marker products: a PHYA1 CAPS, b PHYB dCAPS, and c G.h.HY5 dCAPS. (M) – Molecular-weight size marker of 25 bp ladder, ‘TM-1’ and ‘Pima 3–79’ – parents, F1 – first-generation hybrid. Note: in (b) and (c) there are 27 and 24 bp digestion products, migrating in a primer pair zone; therefore, hard to be relaibly detected

In particular, a PHYA1 CAPS marker was developed for D-genome derived PHYA1 in tetraploid cottons, in which PHYA1 CAPS primer pairs specifically amplified and differentiated from PHYA2 locus. PHYA1 CAPS primer pairs amplified one 122-bp PHYA1 fragment from Gossypium genome, corresponding to a portion 743-bp second exon of the cotton PHYA1 genes. This exon at the position of 334 had G to A transition mutation in G. barbadense that created GATC recognition site (versus GGTC in G. hirsutum). This G334A polymorphic site was recognized and digested by Mbo I/Dpn II endonuclease (Fig. 1) resulting in digestion of the G. barbadense PHYA1 amplicon into 71- and 51-bp fragments. In contrast, G. hirsutum amplicons remained undigested, giving an opportunity to clearly differentiate G. hirsutum amplicon(s) from G. barbadense allele(s) in a co-dominant fashion (Fig. 2a).

Restriction enzyme recognition site polymorphisms targeted region of cotton PHYB genes were not found targeted region of cotton PHYB genes, although GSPs between G. hirsutum and G. barbadense were present. When an additional nucleotide (C157T) was incorporated nearby one of the existing GSP (A155G) of 388-bp first intron of G. barbadense using dCAPS primer mismatch approach, resulting amplicon had an AGCT Alu I recognition site in G. barbadense allele (Fig. 1). Thus, the PHYB dCAPS primer pair (Table 1) amplified 149-bp PHYB PCR product from both cotton species. When digested, G. barbadense allele yielded both the149-bp (undigested) fragment, as well as 125- and 24-bp digested bands, while G. hirsutum amplicon(s) showed no digestion (Fig. 2b; the 24-bp fragment migrates along with primers and primer-derived artifacts, and was not distinguished in the agarose gel). Therefore, PHYB dCAPS marker could only be scored as a dominant marker and heterozygotes could not be distinguished. It is noteworthy to mention here that one additional PHYB marker, designated PHYBdCAPS-2 with a Hpa I restriction polymorphism (refer to the Additional file 1: Figure S1a) was also designed. This dCAPS marker amplified 180-bp product from both G. hirsutum and G. barbadense genotypes (Fig. 5b). Hpa I digestion yielded 36- and 144-bp restricted and 180-bp unrestricted bands in both genotypes. In that, 144-bp band was more intensive in G. hirsutum and the unrestricted 180 bp band was more intensive in G. barbadense genotypes while 36-bp band was not visible to detect in agarose gel. Heterozygotes showed both intensive bands of 180- and 144-bp. This marker information is not included in main part of this paper because of complexity and a need for ‘band-intensity-based’ genotyping of restricted fragments (see Additional file 1: Figure S1a) that may generate inconsistent results by others when genotyped manually.

Fig. 5

Chromosomal localization of cotton a PHYA1 (PHYA1 Alu I CAPS) and b PHYB (PHYB Hpa I dCAPS-2) genes using dCAPS markers on chromosome substitution lines (CS-B) and translocations (NTN). M-50 bp DNA ladder; 1-undigested PCR product; 2-‘TM-1’; 3- ‘Pima 3–79’; 4-F1; 5-CS-B_01; 6-CS-B_02; 7-CS-B_04; 8-CS-B_5sh; 9-CS-B_06; 10-CS-B_07; 11-CS-B_10; 12-CS-B_11sh; 13-CS-B_12sh;14-CS-B_14sh; 15-CS-B_15sh; 16-CS-B_16; 17-CS-B_17; 18-CS-B_18; 19-CS-B_22sh; 20-CS-B_22lo; 21-CS-B_25; 22-CS-B_26lo; 23-NTN_04-15; 24-NTN_10-19; 25-NTN_16-15; and 26-NTN_17-11

Further, using dCAPS approach, one HY5-specific dCAPS marker (Hinf I restriction site) was designed, targeting a T to C transition within the 90-bp second intron of HY5 genes (Fig. 1). This dCAPS marker clearly differentiated G. hirsutum and G. barbadense HY5 gene alleles (Fig. 2c) in dominant marker fashion, where G. barbadense HY5 amplicon remained undigested (about 97 bp), whereas G. hirsutum amplicons were separated into 97-bp (undigested) as well as 70- and 27-bp digested fragments (where 27-bp fragment migrates on primer pair zone and not distinguished in agarose gel).

Linkage mapping and QTL association analyses

Previously, the PHYA1 CAPS marker specific to hinge region and recognized by Bbv I/Bse XI was amplified in fiber length segregating cotton population, an interspecific cross between ‘Pima S-7’ (G. barbadense) and ‘Tamcot SP37’ (G. hirsutum) consisting of 96 F2 individuals. Amplified products were digested with BbvI endonuclease, and polymorphic bands were scored as co-dominant fashion. QTL-mapping of Bbv I CAPS marker polymorphism in a cotton fiber length segregating population revealed that the PHYA1 locus is significantly linked to fiber length with LOD score of 4.27 and p-value of 0.00001 and explained about 6 % phenotypic variation [35]. This QTL association gave the preliminary molecular insights that phytochrome genes, and the PHYA1 gene in particular, could be important in the fiber elongation process in cotton [35, 37].

To study the possible genetic associations of phytochrome and HY5-specific CAPS and dCAPS markers with a suite of multi-environmentally evaluated complex traits (including all major fiber traits), these markers were incorporated into the reference genetic linkage map of cotton constructed using a large number SSR and SNP markers [48, 49]. Toward this goal, our candidate gene-specific CAPS and dCAPS markers were genotyped across all 186 RIL lines (Fig. 3a-c; Additional file 1: Figure S1a) from an interspecific cross between ‘TM-1’ and ‘Pima 3–79’ [48, 49]. Based on these data, the PHYA1 CAPS marker was assigned into linkage group of A-sub-genome chromosome 11 (Fig. 4a). The PHYB dCAPS marker (Fig. 4b) and the PHYBdCAPS-2 marker (genotyped using band-intensity level) were assigned to chromosome 10 in the A-sub-genome, in a very close proximity to each other (Additional file 1: Figure S1b). The HY5 dCAPS marker was assigned to linkage group 24 in the D-sub-genome [48, 49] (Fig. 4c). When the gene-based CAPS markers were placed on these three chromosomes, the mapping accuracy of individual CAPS marker positions was tested. There was no interspecific segregation distortion that would otherwise affect these CAPS loci.

Fig. 3

The examples of phytochrome and HY5-specific CAPS and dCAPS markers, segregating among ‘TM-1’ x ‘Pima 3–79’ RIL lines. a PHYA1 CAPS, b PHYB dCAPS, and c Gh_HY5 dCAPS. (M) – Molecular-weight size marker of 25 bp ladder, ‘TM-1’ and ‘Pima 3–79’ – parents, F1 – first-generation hybrid, 13–53 – RIL individuals

Fig. 4

Genetic linkage maps with integration of phytochrome and HY5-specific CAPS and dCAPS markers. a PHYA1 CAPS, A-subgenome chromosome 11, b PHYB dCAPS, A-subgenome chromosome 10, and c Gh_HY5 dCAPS, D-subgenome chromosome 24. QTL designations on the map are follows as: InL - internode length; MsD - main stem diameter; LP - lint percent; GT - gin turnout; SI - seed index; LI - lint index; Ns - nep size; Nn - number of neps; SCN - number of seed coats; UQL - upper quartile of fiber length by weight; SFC - short fiber content by weight g; ALFw - average length of all fiber by weight; 5.0 L - fiber span length; 2.5 L - fiber span length; VFM – visible foreign matter in percentage; FTX - fiber fineness; IFC - immature fiber content by weight g; MR - maturity ratio; MT - mean tenacity; and ME - mean elongation

Detailed study of flanking markers and QTLs associated with regions nearby our candidate gene markers revealed that PHYA1 CAPS marker mapped between two SSR markers JESPER008 and MUCS399 at 3.925 cM distance (Fig. 4a). This region and flanking SSR markers were associated with such important fiber traits as short fiber content by weight (SFC) and an average length of all fibers by weight (ALFw) [48, 49]. In another independent QTL mapping study using testcross mating-design mapping population, Yu et al. [53] found association of one of the flanking markers linked to PHYA1 CAPS, MUCS399, with micronaire (MC) and lint yield (LY). These results indirectly associate the PHYA1 CAPS marker with these fiber quality traits and validate our previous findings on association of PHYA1 Bbv I/Bse XI CAPS with the fiber length trait [35]. Moreover, the results of our targeted RNAi study for PHYA1 gene(s), improved fiber length and other key fiber quality traits, including short fiber content, microniare, strength, and uniformity [36, 37, 47], further support PHYA1 CAPS marker associations with the related fiber QTLs discussed here.

Similarly, the PHYB dCAPS marker, on A-sub-genome chromosome 10, flanked by BNL3071 and Uccg10239_93/MUSS347b markers at 0.766 cM distance (Fig. 4b, Additional file 1: Figure S1b) were reported to be associated with fiber fineness (FTX) by Yu et al. [48, 49]. In another independent QTL mapping effort, Guo et al. [54] reported that BNL3071 marker, also tightly linked with PHYB dCAPS marker, was associated with the node of first fruiting branch (NFB) in a mapping population (F2:5) from the cross between T1107 and T1354, a day-neutral cultivar Deltapine 61 and photoperiodic G. hirsutum accessions, respectively. These findings further suggest the importance of phytochrome and light signal transduction for both fiber development and for flowering time/earliness in cotton.

The HY5 dCAPS marker was flanked by markers JESPR157b and MGHES029 at 10.617 cM distance in the D-sub-genome chromosome 24 (Fig. 4c) [48, 49]. In an independent QTL mapping study mentioned-above, Yu et al. [53] reported the association of these two flanking markers linked to HY5 HinfI CAPS, JESPR157b and MGHES029, with fiber uniformity (FU). A comprehensive meta-QTL analysis conducted by Said et al. [55] associated JESPR157a and CIR026 markers at 3.51 cM distance with a micronaire hotspot (‘c24-Micronaire-Hotspot-15’) including 4 QTLs, (Fig. 4c) [48, 49]. Yu et al. [48, 49] at the same time also associated this distal region of D-sub-genome chromosome 24 around CIR026 with immature fiber content (IFC), fiber fineness (FTX), and mean tenacity (MT). Additionally, Wang et al. [56] associated DPL461 marker with fiber elongation (FE) trait in a mapping population derived from an interspecific cross between G. hirsutum and G. darwinii Watt. The DPL461 is located at 21.255 cM distance to HY5 dCAPS marker in D-sub-genome chromosome 24 (Fig. 4c) [49]. All these observations suggest the potential role of HY5 genes in cotton fiber quality regulation.

Verification of chromosomal locations using CS-B lines

In addition, deletion analysis of dCAPS markers reconfirmed the chromosomal localization of cotton PHYA1 and PHYB genes via linkage mapping analysis (Figs. 4 and 5). In both analyses, PHYBdCAPS-2 marker was assigned to an A-sub-genome chromosome 10 (Fig. 5b; Additional file 1: Figure S1b), with detailed linkage information of this marker with other ordered markers in relation to adjacent cotton QTLs (Fig. 4b) [48, 49]. Chromosomal localization of cotton PHYA1 genes using cytogenetic stocks revealed that chromosomes 2 (not confirmed by mapping results) and 11 may bear PHYA1 as the CS-B02 and NTN17_11 stocks showed the Pima specific band. However, neither CS-B17 (full) nor CS-B11 short arm (only available stock) had Pima specific allele; therefore, considering linkage mapping results it is likely that PHYA1 is located on long arm of chromosome 11 (Fig. 5a).

Conclusions

This study reports the genome mapping of three cotton phytochrome genes with newly developed CAPS and dCAPS markers. The proximity of these loci to fiber quality and other cotton traits was demonstrated in two A-sub-genome, and one D-sub-genome chromosomes. ‘Candidate’ gene specific CAPS and dCAPS markers developed for important plant genes such as PHYA1, PHYB, and HY5 of cotton will be useful for cotton breeding programs worldwide for precise, targeted introgression important fiber and flowering traits from G. barbadense into G. hirsutum cultivars or vice versa. Further, flanking SSR markers closely linked with these CAPS and dCAPS markers, identified herein, and ready exploitation of these CAPS and dCAPS markers by breeders would further enhance the efficiency of MAS programs and foster the development of improved cotton cultivars.

Methods

Plant materials

The ‘Texas Marker-1’ (‘TM-1’, G. hirsutum L.), ‘Pima 3–79’ (G. barbadense L.) and 186 recombinant inbred lines (RILs) derived from an interspecific cross between ‘TM-1’ and ‘Pima 3–79’ were used in this study [48, 49]. These cotton genotypes were obtained from the USDA-ARS Cotton Germplasm Unit, College Station, Texas, USA. The cytogenetic stocks and CS-B line collection of tetraploid cotton [50-52] were used for the verification of chromosomal localizations of CAPS and dCAPS markers. The cytogenetic stocks and CS-B lines were kindly provided by Prof. D.M. Stelly, Texas A&M University, College Station, Texas, USA, and USDA-ARS partner laboratory, Starkville, Mississippi, USA through USDA-Uzbekistan cotton germplasm exchange program.

DNA extraction and sequencing

Genomic DNAs were isolated from young leaves using the cetyltrimethylammonium bromide (CTAB) method [57]. The characterization, cloning, and sequencing of cotton phytochromes and HY5 genes were performed as described by Abdurakhmonov [35] and Abdurakhmonov et al. [46].

CAPS and dCAPS marker development

To develop phytochrome gene-specific CAPS and dCAPS markers, a PCR-walking experiment was designed to sequence upstream and downstream of previously sequenced hinge region [35, 46] of PHYA genes of Gossypium species. We successfully generated 2.2 kb PHYA GST sequences from G. hirsutum, G. barbadense, G. herbaceum and G. raimondii genomes (Abdurakhmonov et al. unpublished) that were aligned to design CAPS and dCAPS markers. Similarly, using PCR-walking approach, the first and second exons, part of the third exon, and first and second introns of Gossypium HY5 were sequenced that include previously characterized HY5 GST [35]. A 2.1 kb long PHYB GSTs of Gossypium species reported by Abdurakhmonov et al. [46] was used for development of PHYB specific markers. Sequencing, cloning and characterization of upstream and downstream regions via PCR-walking from the hinge region of targeted genes were conducted according to detailed methodology described by Abdurakhmonov et al. [46].

GSTs were aligned using Sequencher program ver. 4.1 (Gene Codes, USA) and GSP sites polymorphic between G. hirsutum and G. barbadense were determined. The polymorphic sites in cloned candidate genes were used to design gene-specific PCR-based CAPS markers. If identified polymorphism was recognized by commercially available restriction endonuclease CAPS markers were directly generated [4]; otherwise, a new SNP was artificially inserted near the GSP site to create a new restriction endonuclease recognition site using dCAPS Finder 2.0 [5, 9]. Marker primers were synthesized by Integrated DNA technologies Inc., (Iowa, USA) and used for genotyping experiments (Table 1).

CAPS and dCAPS marker genotyping

For genotyping, the PCR amplifications were performed in a 10 μl reaction mixture containing 1 μl 10 × PCR buffer with MgCl2, 0.5 μl 25 mM of a dATP, dGTP, dTTP, and dCTP mix, 0.5 μl 25 ng/ml of each reverse and forward primer, 1 μl 10 ng/μl template DNA, and 0.1 U Taq DNA polymerase. PCR amplification was performed on a GeneAmp 9700 thermal cycler using the program consisting of an initial denaturation at 95 °C for 5 min, followed by 40 cycles of: denaturation at 95 °C for 45 s., annealing at 55–68 °C (depending on primers) for 45 sec. and elongation at 72 °C for 2 min., and finished with a final elongation at 72 °C for 10 min.

PCR products were purified using a 26 % PEG (polyethylene glycol) solution (PEG 8000, 6.5 mM MgCl2, 0.6 M NaOAc - pH 6.0–7.0) and digested with commercial restriction enzymes recognizing CAPS and dCAPS sites. Restriction analysis of each sample was performed in 10 μl of reaction mixture containing 1 μl 10 × restriction enzyme buffer, 2 μl purified PCR product, 0.2 Unit restriction enzyme and 6.5 μl sterile water. The digested products were electrophoresed on 3.5 % high-resolution agarose (HiRes Agarose) gel in 0.5 × TBE buffer, with a mode voltage of 5.3 V/cm. After electrophoresis, gels were stained with ethidium bromide (EtBr) solution for 5–10 min and photo-documented using Gel Imaging Documentation System (Alphaimager 2200, Alpha Innotech, USA) with exposure under the UV light.

Construction of linkage maps and QTL analysis

To incorporate phytochrome and HY5-specific CAPS and dCAPS markers into the tetraploid cotton linkage map, we genotyped these markers in the bi-parental progenies of 186 RILs, which were developed from an interspecific cross between ‘TM-1’ and ‘Pima 3-79’ [48, 49]. The genetic linkage relationships with the reference genetic maps were constructed from the genotypic data of markers in RILs, using the program JoinMap version 3.0 [58]. Assignment of linkage groups to the respective chromosomes was based on the reference genetic maps of Yu et al. [48, 49]. For a graphical representation of QTL maps and linkage groups, the program Map Chart version 2.2 [58] was used. Previously mapped QTL information on specific linkage groups [48, 49] were also placed into CAPS and dCAPS marker-incorporated linkage groups to predict and interpret genetic association of targeted regions of cotton genome.

Deletion analysis using chromosome substitution lines

The CS-B chromosome substitution lines were used for verification of chromosomal localization of CAPS and dCAPS markers. Each individual CS-B line is composed of G. hirsutum cv. ‘TM-1’ with a single chromosome or chromosome segment substituted from G. barbadense cv. ‘Pima 3–79’ [52]. In addition, an individual monosomic or monotelodisomic F1 stocks that lack a chromosome or one arm of a chromosome from the recipient, ‘TM-1’, and have the homologous chromosome or chromosome arm from the donor ‘Pima 3-79’ line was used. Amplified products of CAPS and dCAPS markers were assigned to the substituted chromosomes based on GSP polymorphisms and deletion method, in which the cytogenetic stock exhibited a hemizygous-banding pattern, with the ‘TM-1’ band is missing, in such cases, it could be considered that the locus was situated on that missing or the substituted chromosome or chromosome arm of the aneuploid or CS-B line. DNAs from G. hirsutum cv. ‘TM-1’, G. barbadense cv. ‘Pima 3–79’, and monotelodisomic and monosomic substitution lines (BC0F1) for different chromosomes and chromosome arms of G. barbadense were used to identify the chromosomal location of CAPS and dCAPS markers following the deletion analysis strategy used previously [59, 60]. The DNAs from individual aneuploid substitution lines were provided by Dr. D.M. Stelly at Texas A&M University, College Station, Texas [52].