Literature DB >> 27762279

Universal stress protein Rv2624c alters abundance of arginine and enhances intracellular survival by ATP binding in mycobacteria.

Qiong Jia1, Xinling Hu2,3, Dawei Shi4, Yan Zhang5, Meihao Sun6, Jianwei Wang1, Kaixia Mi2, Guofeng Zhu7.   

Abstract

The universal stress protein family is a family of stress-induced proteins. Universal stress proteins affect latency and antibiotic resistance in mycobacteria. Here, we showed that Mycobacterium smegmatis overexpressing M. tuberculosis universal stress protein Rv2624c exhibits increased survival in human monocyte THP-1 cells. Transcriptome analysis suggested that Rv2624c affects histidine metabolism, and arginine and proline metabolism. LC-MS/MS analysis showed that Rv2624c affects the abundance of arginine, a modulator of both mycobacteria and infected THP-1 cells. Biochemical analysis showed that Rv2624c is a nucleotide-binding universal stress protein, and an Rv2624c mutant incapable of binding ATP abrogated the growth advantage in THP-1 cells. Rv2624c may therefore modulate metabolic pathways in an ATP-dependent manner, changing the abundance of arginine and thus increasing survival in THP-1 cells.

Entities:  

Year:  2016        PMID: 27762279      PMCID: PMC5071874          DOI: 10.1038/srep35462

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Mycobacterium tuberculosis, a successful ancient pathogen, causes the notorious infectious disease tuberculosis (TB). According to epidemiological data from the World Health Organization, two million deaths per year are caused by TB and approximately one-third of the world’s population is infected with M. tuberculosis1. Only 10% of infected individuals develop active pulmonary disease, the remaining 90%, while asymptomatic, carry latent bacilli. Immunosuppression, such as that caused by the human immunodeficiency virus, ageing and/or malnutrition, can lead to reactivation of latent bacilli, a major cause of adult tuberculosis2. Mechanisms underlying latency and reactivation have yet to be completely defined, and characterization of mycobacterial proteins that play important roles in latency and reactivation may provide insights for designing new therapeutic strategies to treat latent infections. Universal stress proteins, characterized by the presence of a conserved G2 × G9 × GS motif, are present in organisms from bacteria to eukaryotes (but not in animals) and are highly induced under certain stresses, such as heat shock, superoxide-generating agents and heavy metals3. Escherichia coli UspA was the first universal stress protein identified4 and has been shown to respond to a large variety of stress conditions567. Deletion of uspA in E. coli arrests growth at the stationary phase6. Usually there are multiple universal stress proteins in a given species: E. coli, for example, possesses six paralogous genes — uspA, uspC, uspD, uspE, uspF and uspG. Deletion of individual usp genes has shown that they have different roles in response to cellular stresses8. Like E. coli, multiple universal stress proteins have been predicted in the mycobacteria, e.g., M. tuberculosis (NC_000962.3) is predicted to possess 10 universal stress proteins9 which are highly induced when triggered by different stimuli or environmental conditions10. Of these, six, including Rv2624c, are predicted to be in the DosR/Rv3133c regulon1112, suggesting that universal stress proteins modulate latent infection. The M. tuberculosis universal stress protein Rv2623 is known to be involved in mycobacterial persistence13, and Rv1996 in isoniazid susceptibility14. The exact physiological roles of the other mycobacterial universal stress proteins, however, are unknown. A microarray study has shown that rv2624c mRNA is highly induced by nitrosative stress, a host innate immune system-induced natural stressor against infection15. In addition, Rv2624c has been shown to be an immunogenic protein, the antibody against Rv2624c being detected in serum from TB patients serum16. These studies suggest that Rv2624c affects the infected host cell immune response. Knockout of a usp gene is compensated for by other universal stress proteins in mycobacteria17, while overexpression of a universal stress protein provides information about its function as overexpression increases its effect over that of other universal stress proteins. For example, overexpression of rv1996 increased isoniazid susceptibility14. Overexpression of universal stress protein rv2623 arrested growth of both M. smegmatis and M. tuberculosis13. In this study, we overexpressed rv2624c in mycobacteria and investigated the physiological functions of Rv2624c. We showed that Rv2624c increases the survival of mycobacteria in hypoxia and bacillary-infected THP-1 cells. Transcriptome analyses suggested that Rv2624c affects histidine metabolism and arginine and proline metabolism. Furthermore, LC-MS/MS analysis showed that Rv2624c affects the abundance of arginine, a modulator of both mycobacteria and infected THP-1 cells. In addition, biochemical analysis showed that Rv2624c is a nucleotide-binding universal stress protein. The growth advantage in THP-1 cells is ATP dependent, as an Rv2624c mutant incapable of ATP-binding abrogated the growth advantage of M. smegmatis mc2155 cells overexpressing Rv2624c.

Results and Discussion

Overexpression of Rv2624c increases mycobacterial survival in the Wayne mycobacterial model of latency

In the M. tuberculosis genomic context, rv2624c neighbors rv2623 but is in the opposite orientation (Fig. 1A)17. Rv2623 is the first mycobacterial universal stress protein identified that has been shown to be involved in M. tuberculosis persistence in vivo and to regulate mycobacterial growth in vitro13. Like Rv2623, Rv2624c has been shown to be highly induced under NO and hypoxia, and within infected macrophages91112. However, the function of Rv2624c has not been reported as yet.
Figure 1

Overexpression of rv2624c in M. smegmatis increases survival in the Wayne hypoxia model.

(A) Genetic organization of the rv2624c gene locus. (B) Growth curve of pMV261/mc2155, pMV261-Rv2623/mc2155 and pMV261-Rv2624c/mc2155 cells in 7H9 medium. *p < 0.05, **p < 0.01. (C) Overexpression of Rv2624c increased survival under hypoxia. Growth curves of pMV261/mc2155 and pMV261-Rv2624c/mc2155 under hypoxia. The results shown are representative of three independent experiments. *p < 0.05, **p < 0.01. (D) Overexpression of rv2624c in M. smegmatis increases survival in human monocyte THP-1 cells. *p < 0.05, ***p < 0.001.

We first examined whether overexpression of rv2624c affects mycobacterial growth. Consistent with a previous study showing that Rv2623 overexpression arrests growth11, the pMV261-Rv2623/mc2155 strain grew slowly compared with the control M. smegmatis mc2155 strain harboring an empty vector (pMV261/mc2155) (Fig. 1B). In contrast, under the experimental conditions used here, growth of pMV261-Rv2624c/mc2155 was comparable with pMV261/mc2155, indicating that overexpression of rv2624c did not affect mycobacterial growth (Fig. 1B). As universal stress proteins play roles in latent infection, we investigated the effects of Rv2624c in the Wayne mycobacterial latency model in which mycobacterial cultures are grown under gradual oxygen concentration depletion to force bacilli to enter a physiologically latent state. Bacteria (OD600 of 0.01) were seeded into vials with a headspace: liquid ratio of 1:2 supplemented with the O2 probe methylene blue, sealed and incubated with slow stirring (Fig. 1C). No difference in viability was detected on the first day after inoculation (Fig. 1C). Differences in the viability of pMV261-Rv2624c/mc2155 under hypoxia compared to pMV261/mc2155 were observed on days 3, 5, and 7 after inoculation (Fig. 1C). These results suggest that Rv2624c affects viability under hypoxic conditions.

Overexpression of rv2624c in M. smegmatis increases survival in human monocyte THP-1 cells

Formation of granulomas is a hallmark of the host response to infection with M. tuberculosis. The hypoxic microenvironment within granulomas is an important factor leading to mycobacterial latency1819202122. Rv2624c activity is required for survival under hypoxia, suggesting that latency gene rv2624c likely modulates the host immune system. In addition, studies have shown that Rv2624c is an immunogenic protein1623. Macrophages are central innate immune cells that play a key role in the host response against pathogens. Using a macrophage-killing assay, we evaluated the intracellular survival of mycobacterial strains in the macrophage-like cell line THP-1 after a synchronized infection (Fig. 1D). After extensive washing, cells were lysed and spread on 7H10 medium (T0) to determine how many bacilli had infected the cells. As shown in Fig. 1D, the initial numbers of pMV261/mc2155 bacteria infecting THP1 cells was comparable to that of pMV261-Rv2624c/mc2155, indicating there was no statistical difference between strains in their entry into host cells. At 4 h post-infection, the number of pMV261-Rv2624c/mc2155 CFUs (8.23 × 105 ± 2.4 × 104), was significantly higher than that of pMV261/mc2155 CFUs (2.4 × 105 ± 3 × 104). This result suggests that overexpression of rv2624c increased mycobacterial survival in THP-1 host cells. In contrast, overexpression of Rv2623 attenuated growth in THP-1 cells (1.2 × 105 ± 1.5 × 104 CFUs) (Fig. 1D). Those results showed that overexpression of rv2623 decreased survival and overexpression of rv2624c increased survival in human monocyte THP-1 cells.

mc2155 and pMV261-Rv2624c/mc2155 cells have distinct metabolic patterns

Transcriptional reprogramming plays important roles in bacterial responses to various stressors. To elucidate why pMV261-Rv2624c/mc2155 cells have a growth advantage over pMV261/mc2155 cells under the tested conditions (hypoxia and infection of THP-1 host cells), we examined changes in mRNA expression using RNA sequencing. Comparing the RNA of pMV261-Rv2624c/mc2155 cells to that of pMV261/mc2155 cells showed modest expression differences. Two hundred and eighty-six were upregulated more than 2-fold and 33 genes were upregulated more than 4-fold, respectively (p < 0.01), while 11 genes were downregulated. As different genes cooperate to perform their biological functions, pathway-based analysis gives insight into the Differential Expressed Genes (DEGs) involved in biological functions. KEGG Pathway Analysis24 showed that “arginine and proline metabolism” (Q = 0.004), “tryptophan metabolism” (Q = 0.013) and “histidine metabolism” (Q = 0.013) pathways are significantly enriched in DEGs compared to the whole M. smegmatis genome. As listed in Table 1, 15 DEGs are involved in histidine metabolism (pathway ID ko00380) and 19 upregulated genes are involved in arginine and proline metabolism. Interestingly, using KEGG-User Data Mapping (Fig. 2A), four genes were shown to be involved in “histidine metabolism”, which includes the amino acid synthesis pathway from histidine to glutamate, and seven genes were shown to be involved in “arginine and proline metabolism”, an arginine synthesis pathway. Arginine is an important modulator of infected macrophages and the pathogens which have infected them2526, and arginine as an adjuvant for chemotherapy for active tuberculosis improves clinical outcomes27. There are many catabolic pathways for pathogens to degrade arginine, including the arginine deiminase pathway and the arginase pathway, the former supporting growth under anaerobic conditions and the latter supporting growth under aerobic conditions. Therefore, arginine metabolism is essential for both the host and the pathogen, and competition for arginine and thus may determine the outcome of infection28. Some pathogens have been shown to alter their arginine-dependent metabolic activities when infecting host cells. For example, M. marinum induces argS, an arginine metabolism gene, when it is inside host cells29. Results from our transcriptome analysis suggest that differences in the abundance of arginine may be important in mycobacterial survival within infected macrophages.
Table 1

Fold changes of genes differentially expressed.

Gene NameGene Productlog2 Ratio (pMV261-Rv2624c/pMV261)P-valueFDR
Arginine and proline metabolism
 MSMEI_4735alpha/beta hydrolase fold protein;2.087296641.85E-057.24E-05
 aldAaldehyde dehydrogenase;1.7909036377.18E-073.42E-06
 MSMEI_5246K transporting ATPase KdpC subunit;1.6197917214.22E-050.000155477
 argBacetylglutamate kinase;1.5889369711.08E-1127.83E-111
 MSMEI_3474nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase;1.5412897471.41E-231.85E-22
 MSMEI_6319aldehyde dehydrogenase;1.5248287771.89E-079.60E-07
 MSMEI_38795-oxoprolinase;1.5026834186.55E-135.31E-12
 MSMEI_0270aminotransferase class-III;1.4498667196.83E-050.000242346
 MSMEI_2911amidase;1.4291081593.54E-061.53E-05
 argJArginine biosynthesis bifunctional protein argJ;1.4125455961.55E-1311.31E-129
 argDacetylornithine aminotransferase;1.390973031.56E-1371.44E-135
 MSMEI_2053acetylornithine deacetylase/Succinyl-diaminopimelate desuccinylase-like protein;1.3629586542.43E-111.76E-10
 MSMEI_0432agmatine deiminase;1.2434158420.0003055020.000956325
 MSMEI_0187RpiR-family transcriptional regulator;1.1723327440.0001012640.000348923
 aldAaldehyde dehydrogenase AldA;1.1450121381.47E-055.85E-05
 amiDamidase;1.1161051062.68E-1372.44E-135
 MSMEI_1056Asp-tRNAAsn/Glu-tRNAGln amidotransferase A subunit-like amidase;1.0844151128.54E-602.94E-58
 argCN-acetyl-gamma-glutamyl-phosphate reductase;1.0659769164.85E-481.28E-46
 aldANAD-dependent aldehyde dehydrogenase AldA;1.0024077437.59E-050.000267238
Histidine metabolism
 purUformyltetrahydrofolate deformylase;0.0153034260.8176880.861173926
 MSMEI_1150formiminoglutamate deiminase;1.5509103051.54E-868.22E-85
 MSMEI_1151Imidazolonepropionase;1.5443468567.79E-562.44E-54
 MSMEI_6319aldehyde dehydrogenase;1.5248287771.89E-079.60E-07
 MSMEI_2769nitrilotriacetate monooxygenase;1.498776325.41E-072.61E-06
 MSMEI_3211Adenylate/guanylate cyclase/hydrolase, alpha/beta fold family;1.4815755795.06E-257.20E-24
 MSMEI_3620catalase;1.37985699800
 MSMEI_2508alpha/beta hydrolase fold-3;1.374376522.33E-091.43E-08
 MSMEI_1152histidine ammonia-lyase;1.3332911434.48E-641.73E-62
 MSMEI_6690hypothetical protein;1.2978636263.89E-050.000144317
 MSMEI_1148urocanate hydratase;1.19821235700
 MSMEI_2768nitrilotriacetate monooxygenase;1.1627040431.29E-055.19E-05
 aldAaldehyde dehydrogenase AldA;1.1450121381.47E-055.85E-05
 MSMEI_4521phthalate 4,5-dioxygenase;1.0611205181.08E-201.31E-19
 aldANAD-dependent aldehyde dehydrogenase AldA;1.0024077437.59E-050.000267238
Figure 2

Overview of the differential expression profiles of pMV261/mc2155 and pMV261-Rv2624c/mc2155 cells.

(A) M. smegmatis metabolic pathways in which DEGs are enriched. KEGG-User Data Mapping assigned DEGs to “histidine metabolism” and “arginine and proline metabolism”. (B) Mass spectrometry of arginine (m/z 175, 116, 70). (C) Ion intensities of fragment ions of arginine. *p < 0.05.

Overexpression of Rv2624c increases the abundance of arginine

To examine whether Rv2624c affects arginine synthesis, we measured the abundance of arginine in pMV261 and pMV261-Rv2624c bacterial cells using mass spectrometry. As metabolites are easily altered by simple experimental procedures such as centrifugation, we used the filter-culture approach described by de Carvalho et al.30 to extract metabolites without significantly altering metabolite profiles. We then compared the abundance of arginine in pMV261/mc2155 and pMV261-Rv2624c/mc2155 using LC-MS/MS. The structure of arginine and its two major fragments at m/z 70 and 116 is shown in Fig. 2B. The abundance of arginine was statistically higher in pMV261-Rv2624c/mc2155 than in pMV261 (Fig. 2C).

Rv2624c is a nucleotide-binding universal stress protein

Universal stress proteins are an ancient protein family, present in organisms from bacteria to plants, but absent in animals. Based on their ATP-binding ability, universal stress proteins have been assigned to two subclasses: one whose members do not bind nucleotides and the other whose members bind nucleotides31. A previous study has shown that mycobacterial universal stress protein Rv2623 is an ATP-binding protein and that the ATP binding of Rv2623 regulates bacillary growth13. Alignment of universal stress proteins, including the well-studied Rv2623, predicted that Rv2624c is an ATP-binding protein (Fig. 3), suggesting Rv2624c might have ATP-dependent biological functions. In addition, transcriptome analysis suggested that overexpression of Rv2624c affects the mycobacterial histidine, and arginine and proline metabolic pathways, which both use ATP. To determine if Rv2624c has ATP-dependent biological functions, we investigated the biochemical characteristics of Rv2624c protein to elucidate whether it affects growth in infected host cells in an ATP-dependent manner. M. tuberculosis Rv2624c was cloned and expressed in E. coli. SDS-PAGE analysis of purified His6-tagged Rv2624c protein showed a single band around the predicted molecular mass of ~30 kDa that was confirmed by immunoblotting to be Rv2624c (data not shown). Gel filtration analysis of native His6-Rv2624c proteins showed that the majority of the purified Rv2624c had a molecular mass of ~30 kDa (Fig. 4A), indicating that Rv2624c is a monomer under native conditions. Similar to Rv262313, purified Rv2624c proteins from E. coli bound tightly to ATP and ADP after extensive purification steps (Figure S1), indicating that Rv2624c is a nucleotide-binding protein. To gain insight into the function of ATP binding, the amino acid sequence of Rv2624c was compared with that of Rv2623 (Fig. 3). In a previous study on Rv2623, G117 and D15 were identified as key amino acids for ATP binding13. When we mutated the corresponding amino acids in Rv2624c (D17, equivalent to D15 in Rv2623, and G109, equivalent to G117 in Rv2623) to E and A, HPLC analysis of nucleotides extracted from Rv2624cD17E and Rv2624cG109A showed that both mutations had abrogated the protein’s ATP-binding ability (Fig. 4B). We next compared the growth of mycobacterial strains overexpressing Rv2624c, Rv2624cD17E and Rv2624cG109A. When measuring the OD600 values, no growth differences were detected among the strains (data not shown). Consistent with this result, the size of mycobacterial colonies was similar (Fig. 5A). In contrast, strains overexpressing Rv2623 showed arrested growth13 and formed small colonies (Fig. 5A). We also examined the survival percentage of these mycobacterial strains in infected macrophage cells. In contrast to their growth on 7H10 medium, we observed statistically significant differences in growth between mc2155 cells overexpressing Rv2624c and mc2155 cells overexpressing Rv2624cD17E (p < 0.001), but not mc2155 overexpressing Rv2624cG109A. As in the macrophage killing assay studies, the percentage of M. smegmatis strains overexpressing mutant Rv2624cD17E that survived in infected THP-1 cells was reduced (Fig. 5B). Growth in THP-1 cells infected with cells expressing the G109A mutant was comparable with that of cells expressing wild-type Rv2624c (Fig. 5B). The distinct effects exhibited by the wild type, and the G109A and D17E mutants defective in ATP binding suggest a correlation between survival in infected host cells (THP-1 cells) and ATP binding. Studies on mycobacterial universal stress proteins appear to indicate that they are involved in energy-related biological functions, e.g. Rv2623 regulates bacillary growth by ATP binding13, and Rv1996 regulates NAD/NADH-related isoniazid susceptibility14. Rv1636, another mycobacterial universal stress protein, has also recently been shown to bind ATP and is predicted to function in energy (i.e., ATP)-dependent pathways32. Based on the results of this study, and our understanding of the literature, we suggest that mycobacterial universal stress proteins regulate different energy-related pathways and are thus potential drug targets for antibiotics selection.
Figure 3

Rv2624c sequence analysis.

Alignment of the universal stress protein domain of Rv2624c with other universal stress protein family proteins. The compared universal stress protein sequences are from DNAMAN V6 software. The predicted ATP-binding sites are indicated below the sequence.

Figure 4

Rv2624c is a nucleotide-binding universal stress protein.

(A) Gel filtration analysis of native His6-Rv2624c. The upper panel indicates the retention time of the corresponding standard proteins. The lower panel indicates the retention time of His6-Rv2624c. (B) The ATP-binding capacity of mutant Rv2624c was compared with that of wild-type Rv2624c. *p < 0.05.

Figure 5

ATP binding by Rv2624c is required for its ability to increase survival in infected THP-1 cells.

(A) The ATP-binding deficiencies of Rv2624c mutants did not influence growth on 7H10 medium. The mycobacterial strains indicated were serially diluted and were spotted onto solid 7H10 medium with 10% OADC. Pictures were taken after 3 d of incubation at 37 °C. (B) ATP-binding ability affects the survival of mycobacterial strains in THP-1 cells. Rv2624c mutant D17E with abrogated ATP-binding ability attenuated survival in THP-1 cells. The viability of Rv2624c mutant G109A, which had reduced ATP-binding ability, was comparable with that of wild-type Rv2624c. All results presented are representative of three independent experiments. p < 0.001.

Conclusions

We have shown that Rv2624c overexpression in mycobacteria increases their survival in the Wayne mycobacterial latency model and in human monocyte THP-1 cells. Transcriptome analysis suggests that Rv2624c affects histidine metabolism, and arginine and proline metabolism. Further studies using LC-MS/MS showed that Rv2624c modulated the abundance of arginine, a modulator of both mycobacteria and infected macrophages. In addition, biochemical characterization showed that Rv2624c is a nucleotide-binding universal stress protein and modulates metabolic pathways in an ATP-dependent manner, changing the abundance of arginine and thus increasing survival in THP-1 cells.

Materials and Methods

Reagents and growth media

Mycobacterial strains were grown in liquid Middlebrook 7H9 medium (Becton Dickinson, Sparks, MD, USA) containing 10% OADC supplement (oleic acid, albumin, dextrose, catalase; Becton Dickinson, Sparks, MD, USA) and 0.05% Tween 80 (Sigma, St. Louis, MO, USA), or on solid 7H10 medium (Becton Dickinson, Sparks, MD, USA) containing 10% OADC supplement. When needed, kanamycin (50 mg/L; AMRESCO, Shanghai, China) was added to the medium. Escherichia coli strains were grown in Luria-Bertani medium. Kanamycin (50 mg/L) and ampicillin (100 mg/L) were used as needed.

Construction of the rv2624c-overexpressing mycobacterial strain and E. coli expression strain

The full-length rv2624c gene was amplified from M. tuberculosis H37Rv genomic DNA using sense (Rv2624c-F) and antisense primers (Rv2624c-R) (Table S1). The PCR reaction conditions were 98 °C for 30 s, followed by 30 cycles of 98 °C for 10 s, 60 °C for 30 s and 72 °C for 30 s, and then 72 °C for 10 min. The PCR-amplified fragments were purified, digested and cloned into E. coli expression vector pQE80L (Qiagen, Frankfurt, Hesse-Darmstadt, GER), named pQE-Rv2624c for expression of His6-Rv2624c, and mycobacterial vector pMV261, named pMV261-Rv2624c. pQE-Rv2624c was transformed into BL21 (DE3) for expression of in-frame 6xHis-tag recombinant Rv2624c and pMV261-Rv2624c was transformed into M. smegmatis wild-type strain mc2155 for overexpression of Rv2624c in mycobacteria.

Establishment of the Wayne hypoxia latency model in mycobacteria

M. smegmatis strains were cultured under relatively hypoxic conditions as previously described12. Briefly, cultures of mc2155 strains were grown in 7H9 media at 37 °C to an OD600 of 1.0. Cultures were then inoculated at a concentration of 1 × 106 CFU/ml (initial OD600 of 0.02) in tightly sealed anaerobic bottles. The cultures were set up to achieve a headspace ratio of 0.5 as defined by the Wayne Model19 and methylene blue (1.5 mg/L) was used as an indicator of oxygen concentration. All cultures were set up in triplicate.

Purification of recombinant Rv2624c from E. coli

Recombinant Rv2624c was induced by incubation with 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) at 37 °C for 3 h. Cells were harvested and resuspended in lysis buffer (20 mM Tris-HCl pH 8.0, 200 mM NaCl, 15 mM imidazole). The lysis buffer containing expressed recombinant Rv2624c protein was lysed by sonication, and then centrifuged at 12,000 g for 30 min at 4 °C for clearance. The supernatant was incubated with Ni-NTA agarose (Qiagen) and the agarose with bound Rv2624c proteins was washed using wash buffer (20 mM Tris-HCl pH 8.0, 200 mM NaCl, 50 mM imidazole). The Rv2624c protein was eluted with elution buffer (20 mM Tris-HCl, 200 mM NaCl, 300 mM imidazole) and the enriched Rv2624c protein was passed through a Superdex 200 10/300 GL column (GE Healthcare, Fairfield, Connecticut, USA) in a buffer containing 200 mM NaCl and 20 mM Tris-HCl, pH 7.0, for further purification. Purified Rv2624c proteins were concentrated and stored at −80 °C for further experiments. Mutant Rv2624c proteins were purified using the same protocol as described above for Rv2624c protein purification.

Filter-culture approach for extract of metabolites

M. smegmatis strains (10 ml culture, OD600 of 0.6–0.8) was inoculated onto 10-mm 0.22 μm nitrocellulose filters under vacuum filtration. Corresponding M. smegmatis-laden filters were then placed on top of 7H10 media and incubated overnight at 37 °C. M. smegmatis-laden filter cultures were quenched into 80% methanol precooled to −40 °C. Metabolites were extracted by mechanically lysing with specialized Lysing Matrix beads (MP Bio Lysing Matrix Tubes and FastPrep purification kits, MP Biomedicals LLC, USA) using a Mini-Bead Beater (BioSpec Products Inc.) with five cycles comprising 1 min homogenization and 1 min cooling on ice and lysates were clarified by centrifugation. Bacterial biomass was determined by measuring the residue protein content of individual samples. Bacterial biomasses (~2 mg whole lysate protein) were used for metabolomic analyses.

High-performance liquid chromatography (HPLC) for Quantification of nucleotides bound to Rv2624c protein

Nucleotides bound to Rv2624c protein (or mutant Rv2624c proteins) were extracted by boiling purified Rv2624c for 5 min. Boiled samples were centrifuged and the supernatants were loaded onto an HPLC column (Mono Q HR5/5; GE Healthcare). Samples were eluted using a 1:1 mixture of Buffer A (0.04 M NaH2PO4, pH 5.5) and buffer B (1 M NaH2PO4, pH 5.5). The corresponding nucleotides were characterized based on retention time compared with ADP and ATP, and quantified by peak area calculations. Bovine serum albumin (BSA) was used as a negative control and experiments were performed in triplicate.

Site-directed mutagenesis of Rv2624c

Mutation of specific amino acids in the ATP-binding conserved motif was incorporated in pQE-Rv2624c by mismatched PCR primers (listed below; bold and underline font indicated mutated nucleotides). D17E-F: ATCATTGTTGGTATCGAGGTTCGCACGCGGCG; D17E-R: CGCCGCGTGCGAACCTCGATACCAACAATGAT; G109A-F: GAGATGATCTGCGTCGCTCCGTGGGAATCGGG; G109A-R: CCCGATTCCCACGGAGCGACGCAGATCATCTC. Individual PCR reactions were performed using either pQE-Rv2624c or pMV261-Rv2624c plasmids for Rv2624c protein expression and mycobacterial overexpression. Then, the PCR reaction mixtures were digested with DpnI (New England Biolabs, Ipswich, MA, USA). The mutant plasmid, pMV261-Rv2624cD17E and pMV261-Rv2624cG109A, was correspondingly transformed into M. smegmatis mc2155, and the mutant plasmid, pQE-Rv2624cD17E and pQE-Rv2624cG109A, was transformed into E. coli BL21 (DE3).

In vitro growth kinetics

To determine the effect of Rv2624c overexpression and its mutations on growth, M. smegmatis strains harboring wild-type or mutant pMV261-Rv2624c (Rv2624cD17E and Rv2624cG109A) were grown in Middlebrook 7H9 medium containing 50 mg/L kanamycin. Log phase cultures (OD600 of 0.8–1.0) of mycobacterial strains were diluted into 7H9 medium to OD600 of 0.5. To generate a growth curve, cells were re-inoculated and OD600 was measured at the indicated times. To compare the size of colonies of different mycobacterial strains, cells were 10x serially diluted (1:10), spotted (5 μL) onto 7H10 medium supplemented with kanamycin (50 mg/L) and incubated at 37 °C. Photographs were taken after 3 days of incubation. The experiments were performed in triplicate.

Macrophage killing assay

The macrophage killing assay was performed as previously described33. Briefly, human monocyte THP-1 cells (ATCC TIB-202) were differentiated by treatment with 100 μg/L phorbo-12-myristate-13-acetate (PMA; Sigma) for 24 h. Infection with various mycobacterial strains was carried out at a multiplicity of infection (MOI) of 10:1 for 4 h at 37 °C and 5% CO2. Unphagocytized bacilli were removed by extensively washing with PBS three times and the samples were incubated for 1 h with RPMI1640 containing 10 mg/L gentamycin to kill extracellular bacteria. The infected cells were lysed with PBS containing 0.05% Tween 20, and then diluted and plated on LB agar. The CFU number is indicated as the infected number of bacilli (T0). Next, infected THP-1 cells were incubated for 4 h, and then collected and diluted on LB agar. The corresponding post-infection CFUs were counted as the number of surviving bacilli (T1). The mc2155 strain with empty vector pMV261 was used as a negative control.

RNA isolation, RNA-sequencing and data analysis

Bacterial cultures (OD600 of 2) of pMV261-Rv2624c/mc2155 and pMV261/mc2155 (negative control) were collected and total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Construction and sequencing of the above two strains was performed by BGI-Shenzhen (Shenzhen, China). Briefly, rRNA was removed from extracted RNA from the various mycboacterial strains using a Ribominus Transcriptome Isolation Kit (Thermo Fisher Scientific, Waltham, MA, USA). NEXTflex RNA Fragmentation Buffer (Bioo Scientific, Austin, Texas, USA) was added to cleave mRNA into short fragments. Using these short fragments as templates, random hexamer primers were used to synthesize the first-strand cDNA. Second-strand cDNA was synthesized using buffer, dATPs, dGTPs, dCTPs, dUTPs, RNase H and DNA polymerase I. Short fragments were purified with a QIAQuick PCR extraction kit (Qiagen) and resolved by electrophoresis for end reparation and addition of poly(A). After ligating the synthetic short fragments to sequencing adapters, UNG enzyme was used to degrade second-strand cDNA, and the product was purified with a MiniElute PCR Purification Kit (Qiagen). The library was sequenced using an Illumina HiSeq2000. Clean reads were mapped to the reference genome and gene sequences using SOAP2. Mismatches of no more than five bases were allowed in the alignment. Gene coverage is the percentage of a gene covered by reads and is equal to the ratio of the number of bases in a gene covered by unique mapping reads to the number of total bases in that gene. The RPKM method (reads per kilobase per million reads)34 was used to calculate gene expression. The algorithm for identifying differentially expressed genes between two samples was developed by BGI Shenzhen, and the false discovery rate (FDR) control was used for correct p values. In this study, differential expression was indicated when the false discovery rate was ≤0.001 and the ratio was larger than 2. Analysis of differentially expressed genes was further carried out using the KEGG Pathway analysis24.

Statistical analysis

GraphPad Prism 6.0c was used to perform statistical analysis. Significant differences in the data were calculated using t-tests. p < 0.05 indicated significant differences.

LC-MS/MS Analysis of Arginine

An Agilent 1260 HPLC coupled with an AB SCIEX QTRAP 4500 system (AB SCIEX, Foster, CA, USA) was used for LC-MS/MS analysis. The compounds were separated on a Synergi 4 μm Hydro-RP 80 ALC column (2 × 150 mm) at a column temperature of 25 °C. The elution solvent system composed of ultra-pure water (solvent A) and methanol (solvent B). The injection volume of the autosampler was 3 μL. The gradient elution program was applied at a flow rate of 0.4 mL/min as follows: 0 min, 2% B; 5 min, 2% B; 40 min, 100% B; 50 min, 100% B; 52 min, 5% B; 60 min, 5% B. Mass spectrometry was carried out using electrospray ionization (ESI). MS analyses were conducted in positive-ion mode. The operating parameters were optimized as follows: curtain gas (CUR): 20.0; collision gas (CAD): medium; IonSpray voltage (IS): 5500 V; temperature: 500 °C; ion source gas 1 (GS1): 60.0; ion source gas 2 (GS2): 60.0; declustering potential (DP): 50.0; entrance potential (EP): 10; collision energy (CE): 20; collision cell exit potential (CXE): 13.0; Ion detection was performed in multiple reaction monitoring (MRM) mode and the scanning time for every ion pair was 100 ms. MRM transitions monitored for arginine were 175 → 116.

Additional Information

How to cite this article: Jia, Q. et al. Universal stress protein Rv2624c alters abundance of arginine and enhances intracellular survival by ATP binding in mycobacteria. Sci. Rep. 6, 35462; doi: 10.1038/srep35462 (2016).
  34 in total

Review 1.  Immunology of tuberculosis.

Authors:  J L Flynn; J Chan
Journal:  Annu Rev Immunol       Date:  2001       Impact factor: 28.527

2.  Universal stress proteins in Escherichia coli.

Authors:  Deborah A Siegele
Journal:  J Bacteriol       Date:  2005-09       Impact factor: 3.490

3.  Differential roles of the universal stress proteins of Escherichia coli in oxidative stress resistance, adhesion, and motility.

Authors:  Laurence Nachin; Ulf Nannmark; Thomas Nyström
Journal:  J Bacteriol       Date:  2005-09       Impact factor: 3.490

4.  Mapping and quantifying mammalian transcriptomes by RNA-Seq.

Authors:  Ali Mortazavi; Brian A Williams; Kenneth McCue; Lorian Schaeffer; Barbara Wold
Journal:  Nat Methods       Date:  2008-05-30       Impact factor: 28.547

5.  An in vitro model for sequential study of shiftdown of Mycobacterium tuberculosis through two stages of nonreplicating persistence.

Authors:  L G Wayne; L G Hayes
Journal:  Infect Immun       Date:  1996-06       Impact factor: 3.441

6.  Effects of overproducing the universal stress protein, UspA, in Escherichia coli K-12.

Authors:  T Nyström; F C Neidhardt
Journal:  J Bacteriol       Date:  1996-02       Impact factor: 3.490

7.  A universal stress protein (USP) in mycobacteria binds cAMP.

Authors:  Arka Banerjee; Ramona S Adolph; Jayashree Gopalakrishnapai; Silke Kleinboelting; Christiane Emmerich; Clemens Steegborn; Sandhya S Visweswariah
Journal:  J Biol Chem       Date:  2015-03-23       Impact factor: 5.157

8.  Tuberculous granulomas are hypoxic in guinea pigs, rabbits, and nonhuman primates.

Authors:  Laura E Via; P Ling Lin; Sonja M Ray; Jose Carrillo; Shannon Sedberry Allen; Seok Yong Eum; Kimberly Taylor; Edwin Klein; Ujjini Manjunatha; Jacqueline Gonzales; Eun Gae Lee; Seung Kyu Park; James A Raleigh; Sang Nae Cho; David N McMurray; JoAnne L Flynn; Clifton E Barry
Journal:  Infect Immun       Date:  2008-03-17       Impact factor: 3.441

Review 9.  Modulation of the arginase pathway in the context of microbial pathogenesis: a metabolic enzyme moonlighting as an immune modulator.

Authors:  Priyanka Das; Amit Lahiri; Ayan Lahiri; Dipshikha Chakravortty
Journal:  PLoS Pathog       Date:  2010-06-17       Impact factor: 6.823

10.  Expression and role of the universal stress protein, UspA, of Escherichia coli during growth arrest.

Authors:  T Nyström; F C Neidhardt
Journal:  Mol Microbiol       Date:  1994-02       Impact factor: 3.501

View more
  2 in total

1.  Recombinant Expression and Biophysical Characterization of a Druggable Schistosoma mansoni Universal Stress G4LZI3 Protein.

Authors:  Abiola Fatimah Adenowo; Priscilla Masamba; Ndibonani Kebonang Qokoyi; Babatunji Emmanuel Oyinloye; Abidemi Paul Kappo
Journal:  Adv Pharm Bull       Date:  2021-01-31

2.  OhrR of Mycobacterium smegmatis senses and responds to intracellular organic hydroperoxide stress.

Authors:  Omar A Garnica; Kishore Das; Subramanian Dhandayuthapani
Journal:  Sci Rep       Date:  2017-06-20       Impact factor: 4.379

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.