Literature DB >> 27756951

Acidosis reduces the function and expression of α1D-adrenoceptor in superior mesenteric artery of Capra hircus.

Ipsita Mohanty1, Sujit Suklabaidya2, Subas Chandra Parija3.   

Abstract

OBJECTIVE: The objective of this study was to characterize the α1-adrenoceptor (α1-AR) subtypes and evaluate the effect of acidosis on α1-AR function and expression in goat superior mesenteric artery (GSMA).
MATERIALS AND METHODS: GSMA rings were mounted in a thermostatically controlled (37.0°C ± 0.5°C) organ bath containing 20 ml of modified Krebs-Henseleit solution, maintained at pHo of 7.4, 6.8, 6.0, 5.5, 5.0, and 4.5. Noradrenaline (NA)- and phenylephrine (PE)-induced contractile response was elicited in the absence or presence of endothelium and prazosin at pHo of 7.4, 6.0, and 5.0. The responses were recorded isometrically by an automatic organ bath connected to PowerLab and analyzed using Labchart 7.1.3 software. Expression of α1D-AR was compared at physiological and acidic pHo using reverse transcription-polymerase chain reaction (RT-PCR).
RESULTS: NA- and PE-induced contractile responses were attenuated proportionately with a decrease in extracellular pH (pHo), i.e. 7.4 → 6.8 → 6.0 → 5.5 → 5.0 → 4.5. Endothelium denudation increased the contractile response at both normal and acidic pHo. Prazosin (1 nM, 10 nM, and 0.1 μM) inhibited the NA- and PE-induced contractile response at pHo 7.4 and the blocking effect of prazosin was potentiated at pHo of 6.0 and 5.0. RT-PCR analysis for α1D-AR in GSMA showed that the mRNA expression of α1D-AR was decreased under acidic pHo as compared to physiological pHo.
CONCLUSION: (i) Adrenergic receptor mediates vasoconstriction in GSMA under normal physiological pHo, and α1D is the possible subtype involved in this event (ii) acidosis attenuates the vasocontractile response due to reduced function and expression of α1D-AR and also increased the release of endothelial-relaxing factors.

Entities:  

Keywords:  Acidosis; Capra hircus; prazosin; superior mesenteric artery; α1D-adrenoceptor

Mesh:

Substances:

Year:  2016        PMID: 27756951      PMCID: PMC4980928          DOI: 10.4103/0253-7613.186199

Source DB:  PubMed          Journal:  Indian J Pharmacol        ISSN: 0253-7613            Impact factor:   1.200


In vascular bed, both the α1- and the α2-adrenoceptor (AR) subtypes are present postsynaptically, where they mediate vasoconstriction and maintain the peripheral vascular resistance, although the α1-AR is the predominant receptor in vascular smooth muscle.[12] The α1 subtypes involved in mesenteric vessel contraction may be α1A or α1B or α1D, or due to the activation of more than one subtype,[3] while α2-AR agonist-mediated contraction is mostly absent or even restricted to small arteries/arterioles.[1] Hence, a great variability does exist for the function and expression of α1-AR subtypes in mesenteric artery of different species. α1-AR subtypes generated vasocontraction in superior mesenteric artery of goat which is far from its functional and molecular identification. Hence, our research was designed to characterize the α1-AR subtype on the basis of functional and reverse transcription-polymerase chain reaction (RT-PCR) analysis in the goat superior mesenteric artery (GSMA). Extracellular pH (pHo) maintains the blood flow through controlling the contractile state of vascular smooth muscle cells (VSMCs).[4] Acidosis exerts a profound effect on the vascular tone by modulating both the vasocontractile and vasodilatory mechanisms.[5] Vascular myocytes are highly sensitive to pHo. Vasodilation by pHo< 7.4 (acidosis) and vasoconstriction for pHo> 7.4 (alkalosis) have been reported in mesenteric artery.[67] The vasodilatory effects of acidosis have been well described in animals both in vivo and in vitro.[89] A series of in vitro studies reveal that acidosis could affect the agonist-induced vasoconstriction by an increase or decrease or no change[1011] in the maximal response or sensitivity to an α-agonist. Thus, the effect of pH on vasocontractile mechanism is often disparate and may vary depending on the species,[12] strain,[11] vascular location, caliber, and experimental model.[9101112] Because acidosis alters vasocontraction mediated by α1-AR, our objective was to assess the effect of acidosis on α1-AR agonist-mediated vasocontraction and α1-AR gene expression in GSMA rings.

Materials and Methods

Ethical Guidelines

This work has been approved by the Institutional Animal Ethical Committee (Registration No: 433/CPCSEA/20/06/2001) vide ID. No. 130/CVS/dt. 31.03.2015 for conducting randomized animal tissue experiments.

Materials

Noradrenaline (NA) (Merck, India), phenylephrine (PE) hydrochloride (Sigma, USA), and prazosin (MP Biochemicals, India) were the drugs employed for isometric contraction study. The drug solutions were prepared fresh in triple distilled water except NA and prazosin, which were soluble in 0.1N HCl solution. The following components such as 100 bp DNA ladder (SRL, India), 1x gel-loading dye (SRL, India), acrylamide (SRL, India), ammonium persulfate (SRL, India), chloroform (SRL, India), diethyl pyrocarbonate (Genetix, India), dNTPs (Applied Biosystem, USA), ethidium bromide (Sigma, USA), high capacity cDNA synthesis kit (Applied Biosystems, USA), isopropanol (E-Merck, India), multi scribe reverse transcriptase (Applied Biosystem, USA), nuclease-free water (Promega, UK), RNAase Zap (Life Technologies, USA), RNAlater (Life Technologies, USA), SYBR Green (Applied Biosystem, USA), Taq DNA polymerase (Applied Biosystem, USA), and trizol reagent (Ambion, USA) were used for RT-PCR study.

Preparation of Superior Mesenteric Artery and Tension Recording

After the careful exposure of goat intestinal mesentery, a branch of the superior mesenteric artery adjacent to the duodenum and jejunum just before its branching into the inferior branch was dissected out and placed in cold aerated modified Krebs-Henseleit solution (MKHS) with the following composition: 118 mM NaCl, 4.7 mM KCl, 2.5 mM CaCl2, 1.2 mM MgSO4, 11.9 mM NaHCO3, 1.2 mM KH2 PO4, and 11.1 mM d-glucose (pH, 7.4). Further, 1N HCl solution was added to MKHS so as to adjust the pH at 6.8 or 6.0 or 5.5 or 5.0 or 4.5.[13] Arteries were cleared of fat and connective tissues. Endothelium was removed by cotton swab method.[14] The arterial ring of 1.5–2 mm was then mounted between two fine stainless steel L-shaped hooks and kept under a resting tension of 1.5 g in a thermostatically controlled (37.0°C ± 0.5°C) automatic organ bath (Pan Lab) of 20 mL capacity containing MKHS and was aerated continuously with carbogen (95% O2+5% CO2). The arterial rings were equilibrated for 90 min before recording of muscle tension. During this period, the bathing fluid was changed for every 15 min. This experiment was repeated for both endothelium intact and denuded vessels. The change of isometric tension was measured by a high-sensitive isometric force transducer (Model: MLT0201, AD instrument, Australia) and analyzed using Chart 7.1.3 software.

Isometric Contraction Study

Phenylephrine- or noradrenaline (1 nM–100 µM)-induced concentration-related contractile response at pHo of 7.4 or 6.8 or 6.0 or 5.5 or 5.0 or 4.5

After equilibrating the arterial ring in MKHS (pHo at 7.4, 6.8, 6.0, 5.5, 5.0, 4.5) for 45 min, NA or PE (1 nM–100 µM) was added to the bath in a cumulative manner at an increment of 1 log unit at 4 min interval to obtain concentration-related contractile (CRC) response. Net tension (gm) due to each concentration was recorded and plotted against Log (M) concentration of NA/PE to elicit a sigmoid CRC response curve for comparison. Mean maximal response (Emax/EBmax), mean threshold concentration, and pD’2/EC50 were calculated for GSMA rings under different pH ranges and compared. About 6–8 GSMA rings were used for each pH.

Noradrenaline- or phenylephrine (1 nM–100 µM)-induced concentration-related contractile response in goat superior mesenteric artery in the absence or presence of prazosin (1 nM, 10 nM, and 0.1 µM) at pHo of 7.4 or 6.0 or 5.0

Arterial rings (6–8) were preincubated with each concentration of prazosin (1 nM, 10 nM, 0.1 µM) for 30 min prior to exposure to NA/PE in each pH. NA/PE (1 nM–100 µM) was added with an increment of 1 log unit in a cumulative manner into the bath at 4 min interval. The CRC response curves of NA/PE were elicited in the presence of prazosin, and shift of the CRCs was compared with nontreated control. Emax/EBmax, mean threshold concentration, and EC50 of agonists in the presence of prazosin were calculated for GSMA rings to evaluate the blocking effect of antagonists under different pH ranges.

Noradrenaline- or phenylephrine (10 µM)-induced contractile response in goat superior mesenteric artery rings in the absence or presence of endothelium at a pHo of 7.4 or 6.0 or 5.0

To assess the influence of acidic pHo on endothelium, a submaximal dose of NA/PE (10 μM) was added to the 20 ml bath to obtain the first phasic followed by a sustained contractile response in both endothelium intact (ED+) and denuded (ED−) GSMA rings. The mean peak tension (gm) and plateau tension (gm) were recorded for both ED+ and ED− rings and compared at pH of 7.4, 6.0, and 5.0. Under each pH, about 6 tissues were used.

Isolation of Total RNA from Tissue Samples

Goat arterial rings were incubated in MKHS adjusted to pH of 7.4, 6.0, and 5.0 at 37°C for 3 h and thereafter were collected in RNAlater (Life Technologies, USA). Total RNA was isolated from the mesenteric tissue using Trizol reagent (Ambion, USA) according to the manufacturer's instructions. The purity and concentration of total RNA were measured by a spectrophotometer at 260 and 280 nm. Ratios of absorption (260:280 nm) of all the samples were between 1.8 and 2.0.

cDNA Synthesis and Reverse Transcription Polymerase Chain Reaction

First-strand cDNA synthesis was performed from 2 µg of total RNA using a high-capacity cDNA synthesis kit according to the manufacturer's instructions (Applied Biosystems, USA). Synthesized cDNA was stored at −20°C until further use. Gene-specific primers were designed for α1D-adernoceptor (ADRA1D) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) from the corresponding NCBI Reference Sequence (XM_005688233.1; XM_005680968.1) using online Primer 3 software. Primers for ADRA1D (Forward: TGAAGTACCCCTCCATCAT, Reverse: TAGGCAGGTAGAAAGAGCAC) and GAPDH (Forward: GAGATCAAGAAGGTGGTGAA; Reverse: CATACCAGGAAATGAGCTTG) were commercially procured from Eurogentec, USA. Two microliter of each cDNA samples was used as a template for performing RT-PCR. For all the PCR reactions, the program was as follows: 94°C for 5 min, 94°C for 30 s, 55°C for 20 s, and 72°C for 30 s; and a final extension at 72°C for 5 min. PCR products were resolved on 2% agarose gel at 60 V, and the presence of amplicons (GAPDH-175 bp; ADRA1D-195 bp) was documented using gel documentation system (BioRad, USA). The data shown were obtained with 35 PCR cycles.

Statistical Analysis

Emax and EBmax are the mean maximal responses in the absence and in the presence of the antagonist, respectively. The data were expressed as percentage of the maximum response to agonist obtained in the absence of antagonist (control) and analyzed by the interactive nonlinear regression through the computer program GraphPad Prism (GraphPad Prism Software, San Diego, CA, USA). Emax/EBmax and LogEC50/EC50 were calculated through GraphPad Prism and compared for significance level using a t-test calculator - GraphPad Quick Calcs. P < 0.05 was considered statistically significant.

Results

Noradrenaline- or Phenylephrine (10 µM)-induced Contractile Response at pHo of 7.4, 6.8, 6.0, 5.5, 5.0, and 4.5

NA or PE (10 µM) induced a first phasic contraction followed by a sustained (plateau) contractile response in GSMA rings, which was progressively attenuated with a decrease in pHo. NA (10 µM)-induced sustained contractile response at pHo 7.4 (1.72 ± 0.11 g) was significantly (P < 0.05) decreased at pHo 6.8 (1.28 ± 0.23 g), pHo 6.0 (0.75 ± 0.05 g), pHo 5.5 (0.70 ± 0.19 g), pHo 5.0 (0.22 ± 0.02 g), and pHo 4.5 (0.06 ± 0.02 g). Similarly, PE (10 µM)-induced sustained contractile response at pHo 7.4 (1.12 ± 0.09 g) was significantly decreased at pHo 6.8 (0.71 ± 0.02 g), pHo 6.0 (0.38 ± 0.07 g), pHo 5.5 (0.33 ± 0.03 g), pHo 5.0 (0.17 ± 0.04 g), and pHo 4.5 (0.07 ± 0.01 g) [Figure 1a].
Figure 1

Effect of acidosis on α1 agonist (noradrenaline and phenylephrine)-induced vasocontraction in goat superior mesenteric artery. (a) Noradrenaline and phenylephrine (10 μM)-induced contractile response elicited in goat superior mesenteric artery maintained at pHo 7.4, 6.8, 6.0, 5.5, 5.0, and 4.5. *P < 0.05 versus pH 7.4 (control) in noradrenaline-induced contraction and # P < 0.05 versus pH 7.4 (control) in phenylephrine-induced contraction. (b and c) Noradrenaline and phenylephrine (10 μM)induced contractile response in endothelium intact (ED+) and denuded (ED−) goat superior mesenteric artery rings maintained at pHo 7.4, 6.0, and 5.0. Data were expressed as mean gram tension ± standard error. *P < 0.05 versus ED+ (control) in noradrenaline and phenylephrine (10 μM)-induced contraction

Effect of acidosis on α1 agonist (noradrenaline and phenylephrine)-induced vasocontraction in goat superior mesenteric artery. (a) Noradrenaline and phenylephrine (10 μM)-induced contractile response elicited in goat superior mesenteric artery maintained at pHo 7.4, 6.8, 6.0, 5.5, 5.0, and 4.5. *P < 0.05 versus pH 7.4 (control) in noradrenaline-induced contraction and # P < 0.05 versus pH 7.4 (control) in phenylephrine-induced contraction. (b and c) Noradrenaline and phenylephrine (10 μM)induced contractile response in endothelium intact (ED+) and denuded (ED−) goat superior mesenteric artery rings maintained at pHo 7.4, 6.0, and 5.0. Data were expressed as mean gram tension ± standard error. *P < 0.05 versus ED+ (control) in noradrenaline and phenylephrine (10 μM)-induced contraction

Noradrenaline- or Phenylephrine (10 µM)-induced Contractile Response at pHo 7.4, 6.0, and 5.0 in Endothelium Intact (ED+) and Denuded (ED−) Goat Superior Mesenteric Artery Rings

NA (10 µM)-induced contractile response in EDGSMA rings was significantly (P < 0.05) increased at pHo 7.4 (1.91 ± 0.05 g), pHo 6.0 (1.68 ± 0.14 g), and pHo 5.0 (0.48 ± 0.07 g) as compared to ED+ GSMA rings (at pHo 7.4: 1.29 ± 0.04 g; pHo 6.0: 0.98 ± 0.04 g; and pHo 5.0: 0.22 ± 0.03 g). Similarly, PE (10 µM)-induced contractile response in EDGSMA rings was significantly (P < 0.05) increased at pHo 7.4 (1.96 ± 0.46 g), pHo 5.0 (0.05 ± 0.01 g), and nonsignificantly increased at pHo 6.0 (0.29 ± 0.03 g), as compared to ED+ GSMA rings (at pHo 7.4: 1.11 ± 0.09 g; pHo 6.0: 0.25 ± 0.04 g; and pHo 5.0: 0.02 ± 0.01 g) [Figure 1b and c].

Noradrenaline- and Phenylephrine (1 nM–100 µM)-induced Concentration-related Contractile Response at pHo of 7.4, 6.8, 6.0, 5.5, 5.0, and 4.5

Table 1 compares the Emax and pD2 of NA and PE at pHo of 7.4, 6.8, 6.0, 5.5, 5.0, and 4.5. The NA-induced CRC response curve elicited at pHo 7.4 (Emax2.28 ± 0.20 g) was shifted to the right with a significant (P < 0.05) decrease in Emax at pHo 6.8 (1.81 ± 0.14 g), pHo 6.0 (1.62 ± 0.14 g), pHo 5.5 (1.37 ± 0.14 g), pHo 5.0 (0.49 ± 0.02 g), and pHo 4.5 (0.12 ± 0.01 g) [Figure 2a].
Table 1

Noradrenaline- and phenylephrine (1 nM- 100 μM)-induced maximal contractile response at pHo 7.4 (control), 6.8, 6.0, 5.5, 5.0, and 4.5 in goat superior mesenteric artery rings

Figure 2

Effect of acidosis on α1 agonist (noradrenaline and phenylephrine)-induced concentration-related contractile response curve in goat superior mesenteric artery. (a) Noradrenaline (1 nM–100 μM)-induced concentration-related contractile response curve elicited at pHo 7.4, 6.8, 6.0, 5.5, 5.0, and 4.5. (b) Phenylephrine (1 nM–100 μM)-induced concentration-related contractile response curve elicited at pHo 7.4, 6.8, 6.0, 5.5, 5.0, and 4.5. Data were expressed as mean gram tension ± standard error. *P < 0.05 versus pH 7.4 (control)

Noradrenaline- and phenylephrine (1 nM- 100 μM)-induced maximal contractile response at pHo 7.4 (control), 6.8, 6.0, 5.5, 5.0, and 4.5 in goat superior mesenteric artery rings Effect of acidosis on α1 agonist (noradrenaline and phenylephrine)-induced concentration-related contractile response curve in goat superior mesenteric artery. (a) Noradrenaline (1 nM–100 μM)-induced concentration-related contractile response curve elicited at pHo 7.4, 6.8, 6.0, 5.5, 5.0, and 4.5. (b) Phenylephrine (1 nM–100 μM)-induced concentration-related contractile response curve elicited at pHo 7.4, 6.8, 6.0, 5.5, 5.0, and 4.5. Data were expressed as mean gram tension ± standard error. *P < 0.05 versus pH 7.4 (control) The PE-induced CRC response curve elicited at pHo 7.4 (Emax2.18 ± 0.24 g) was shifted to the right with a significant (P < 0.05) decrease in Emax at pHo 6.8 (0.79 ± 0.07 g), pHo 6.0 (0.68 ± 0.06 g), pHo 5.5 (0.67 ± 0.1 g), pHo 5.0 (0.38 ± 0.03 g), and pHo 4.5 (0.31 ± 0.01 g) [Figure 2b].

Noradrenaline (1 nM–100 µM)-induced Concentration-related Contractile Response Either in the Absence or Presence of Prazosin (1 nM, 10 nM, and 0.1 µM) at pHo of 7.4, 6.0, and 5.0

Table 2 compares Emax and EC50 of NA calculated from its CRC response curve in the absence or presence of prazosin at pHo of 7.4, 6.0, and 5.0. NA-induced CRC response curve elicited at pHo 7.4 (Emax2.28 ± 0.20 g) was shifted to the right with a significant (P < 0.05) decrease in EBmax in the presence of 1 nM prazosin (1.56 ± 0.02 g), 10 nM prazosin (1.17 ± 0.16 g), and 0.1 µM prazosin (1.07 ± 0.02 g) [Figure 3a].
Table 2

Noradrenaline- and phenylephrine (1 nM-100 μM)-induced maximal contractile response in the absence and presence of prazosin (1 nM, 10 nM, and 0.1 μM) at pHo 7.4, 6.0, and 5.0 in goat superior mesenteric artery rings

Figure 3

Effect of acidosis on the blocking effect of prazosin on noradrenaline- and phenylephrine-induced concentration-related contractile response in goat superior mesenteric artery. (a-c) Noradrenaline (1 nM–100 μM)-induced concentration-related contractile response curve in the absence or presence of prazosin (1 nM, 10 nM, and 0.1 μM) elicited at pHo 7.4 (a), 6.0 (b), and 5.0 (c). (d-f) Phenylephrine (1 nM–100 μM)-induced concentration-related contractile response curve in the absence or presence of prazosin (1 nM, 10 nM, and 0.1 μM) elicited at pHo 7.4 (d), 6.0 (e), and 5.0 (f). Data were expressed as mean gram tension ± standard error. *P < 0.05 versus nontreated group (control)

Noradrenaline- and phenylephrine (1 nM-100 μM)-induced maximal contractile response in the absence and presence of prazosin (1 nM, 10 nM, and 0.1 μM) at pHo 7.4, 6.0, and 5.0 in goat superior mesenteric artery rings Effect of acidosis on the blocking effect of prazosin on noradrenaline- and phenylephrine-induced concentration-related contractile response in goat superior mesenteric artery. (a-c) Noradrenaline (1 nM–100 μM)-induced concentration-related contractile response curve in the absence or presence of prazosin (1 nM, 10 nM, and 0.1 μM) elicited at pHo 7.4 (a), 6.0 (b), and 5.0 (c). (d-f) Phenylephrine (1 nM–100 μM)-induced concentration-related contractile response curve in the absence or presence of prazosin (1 nM, 10 nM, and 0.1 μM) elicited at pHo 7.4 (d), 6.0 (e), and 5.0 (f). Data were expressed as mean gram tension ± standard error. *P < 0.05 versus nontreated group (control) At a pHo of 6.0, NA-induced CRC response curve (Emax1.62 ± 0.14 g) was shifted to the right with a significant (P < 0.05) decrease in EBmax in the presence of 1 nM prazosin (0.72 ± 0.11 g), 10 nM prazosin (0.38 ± 0.04 g), and 0.1 µM prazosin (0.23 ± 0.05 g) [Figure 3b]. NA-induced CRC response curve elicited at a pHo of 5.0 (Emax0.49 ± 0.02 g) was shifted to the right with a nonsignificant decrease in EBmax in the presence of 1 nM prazosin (0.46 ± 0.01 g), 10 nM prazosin (0.41 ± 0.02 g), and shifted to the right with a significant (P < 0.05) decrease in EBmax(0.06 ± 0.02 g) in the presence of 0.1 µM prazosin [Figure 3c].

Phenylephrine (1 nM–100 µM)-induced Concentration-related Contractile Response Either in the Absence or Presence of Prazosin (1 nM, 10 nM, and 0.1 µM) at pHo of 7.4, 6.0, and 5.0

Table 2 compares Emax and EC50 of PE calculated from its CRC response curve in the absence or presence of prazosin (1 nM, 10 nM, and 0.1 µM) at pHo of 7.4, 6.0, and 5.0. PE (1 nM–100 µM)-induced CRC response curve elicited at pHo 7.4 (Emax2.18 ± 0.24 g) was shifted to the right with a significant (P < 0.05) decrease in EBmax in the presence of 1 nM prazosin (1.18 ± 0.04 g), 10 nM prazosin (1.08 ± 0.02 g), and 0.1 µM prazosin (1.02 ± 0.12 g) [Figure 3d]. PE-induced CRC response curve elicited at pHo 6.0 (Emax0.68 ± 0.06 g) was shifted to the right with a significant (P < 0.05) decrease in EBmax in the presence of 1 nM prazosin (0.45 ± 0.06 g), 10 nM prazosin (0.30 ± 0.00 g), and 0.1 µM prazosin (0.19 ± 0.06 g) [Figure 3e]. PE (1 nM–100 µM)-induced CRC response curve elicited at pHo 5.0 (Emax0.38 ± 0.03 g) was shifted to the right with a significant (P < 0.05) decrease in EBmax in the presence of 1 nM prazosin (0.39 ± 0.003 g), 10 nM prazosin (0.39 ± 0.004 g), and 0.1 µM prazosin (0.21 ± 0.01 g) [Figure 3f].

Reverse Transcription Polymerase Chain Reaction

To investigate the effect of acidosis on the expression of α1D-AR, RT-PCR analysis was carried out. The analysis clearly showed the downregulation of α1D-AR expression with a decrease in pHo level or increase in acidosis. GAPDH was used as an internal control [Figure 4].
Figure 4

Quantitative polymerase chain reaction analysis showing α1D-adrenoceptor (ADRA1D) expression levels for goat superior mesenteric artery rings incubated at normal and acidic pH (pH 7.4, 6.0, and 5.0). Glyceraldehyde-3-phosphate dehydrogenase was used as an internal control

Quantitative polymerase chain reaction analysis showing α1D-adrenoceptor (ADRA1D) expression levels for goat superior mesenteric artery rings incubated at normal and acidic pH (pH 7.4, 6.0, and 5.0). Glyceraldehyde-3-phosphate dehydrogenase was used as an internal control

Discussion

The important observations relating to the influence of acidosis on functional and molecular characterization of α1-AR in GSMA rings are (i) vasotonic response mediated by NA and PE at normal physiological pHo exhibited a relative affinity to α1 receptor (NA > PE), (ii) graded reduction in pHo(7.4 → 6.8 → 6.0 → 5.5 → 5.0 → 4.5) attenuated the vasotonic response for NA and PE, (iii) endothelium denudation significantly increased the contractile response to NA and PE (10 µM) at pHo 7.4 and pHo 5.0, respectively, as compared to their respective endothelium intact GSMA rings, (iv) prazosin, a selective α1-AR blocker, inhibited NA- and PE-induced contractile response in a dose-dependent manner (1 nM, 10 nM, and 0.1 µM) at physiological pHo 7.4, (v) blocking potency of prazosin on NA- and PE-induced contractile response was increased with a decrease in pHo(7.4 → 6.0 → 5.0), (vi) RT-PCR studies confirmed the presence of α1D-AR in GSMA, and mRNA expression level for α1D-AR was decreased under acidosis. Isolated rings from the mesenteric artery of goat developed almost identical tension in a robust and sustained manner in response to the increasing concentrations of two α1-AR agonists, NA and PE. The maximal contraction developed and pD2 of NA (Emax2.28 ± 0.20 g; pD25.29 ± 0.14) and PE (Emax2.18 ± 0.24 g; pD25.58 ± 0.03) are almost identical in GSMA and close to the pD2 values for NA in bovine mammary artery (5.07), bovine oviduct artery (5.67), and calf digital artery (5.92).[151617] However, the contraction developed at a threshold concentration of PE is greater than NA indicating that α1-AR subtypes present in the superior mesenteric artery exhibited a greater sensitivity to PE than NA at a low concentration. A greater contractile response developed by PE at a low concentration than NA and a nonsignificant difference with respect to pD2 and Emax between PE and NA suggested that in GSMA, a particular α1-AR subtype, possibly α1A/D, mediates contractile response to PE and NA, predominantly via high- and low-binding affinities. On the basis of the degree of desensitization of α1-AR subtypes, it is suggested that α1A is moderately desensitized, α1B is highly desensitized, and α1D is least desensitized.[18] In the GSMA, as reported in bovine mammary artery,[19] there was no significant difference in the curve fit parameters after repeating CRC curve to NA and PE at an interval of 45 min (data not shown), suggesting that the adrenergic receptor present in this tissue exhibits the least evidence of desensitization or tachyphylaxis, which could be due to the predominant function of α1D receptor subtypes as suggested in ruminal artery.[20] To confirm the presence of α1D-ARs in accordance to our results in isolated organ bath experiments, we checked for the presence of α1D-ARs in GSMA rings by RT-PCR and observed an appreciable α1D-AR transcript present in this artery. Hence, vasocontractile response is primarily and predominantly mediated by α1D receptor subtype in GSMA. In GSMA at a pHo of 7.4, antagonism of NA- and PE-mediated responses by three different concentrations (1 nM, 10 nM, and 0.1 μM) of prazosin was surmountable and fully consistent with simple competition, as indicated by clear-cut rightward shift with consequent reduction of the Emax and EC50 of NA- and PE-CRC response curve. Decrease in the affinity of NA and PE with an increase in the concentration of prazosin confirms the involvement of α1-AR in mediating the contraction to these agonists. At a pHo of 7.4, a higher dose ratio (EC50 of agonist with antagonist/EC50 of agonist) of NA (1.35) in the presence of lower concentration of prazosin (1 ηM) was increased to 6.2 at its higher concentration (0.1 μM). Similarly, a lower dose ratio of PE (4.13) in the presence of lower concentration of prazosin (1 nM) was increased to 22.7 at its higher concentration (0.1 μM). Hence, the potential blockade properties of prazosin at nanomolar concentration for NA and at micromolar concentration for PE indicate that NA and PE could be inducing contractile response in GSMA by interacting with (i) high- and low-affinity binding sites of a particular α1-AR subtype, (ii) or two different α1-AR subtypes possibly α1A and α1D-AR as reported in the mesenteric artery of rats[2122] and rabbits,[23](iii) or only α1D-AR as reported in goat ruminal artery.[20] Reduction of pHo(7.4 → 6.8 → 6.0 → 5.5 → 5.0 → 4.5) attenuated the NA- and PE-induced CRC response successively and significantly in GSMA rings. At a pHo of 4.5, NA- and PE-induced mean maximal response (Emax) was decreased to 5% and 14%, respectively, of the contractile response measured at pHo 7.4 as 100%. A single dose of NA/PE (10 µM)-induced contractile response was decreased (NA: 1: 0.74: 0.43: 0.40: 0.12: 0.03; PE: 1: 0.63: 0.33: 0.29: 0.15: 0.06) with a decrease in pH 7.4 → 6.8 → 6.0 → 5.5 → 5.0 → 4.5. It is interesting to note that there was a progressive development of vascular shock with a decrease in the pHo to 5.0-4.5, which is partially reversible within 90 min after exposing GSMA rings to MKHS maintained at a normal physiological pH. These clearly demonstrate that hyperacidity could induce a state of vascular shock that almost completely abolishes α1-AR-mediated vasotonic function in GSMA. Hence, α1-AR function is suppressed in a proportional fashion by reduction in pH.[8122425] Based on our observation that a moderate inhibition of α1-adrenergic mediated vasotonic response between pHo of 7.4 and 5.0, we selected to assess the impact of acidosis on endothelial factors contributing to reduced vasotonic response of NA and PE and expression of α1-AR mRNA at pHo of 7.4, 6.0, and 5.0. HCl when added in the MKHS reduces the pH to acidic range. With an increase in the acidic pH, the concentration of H+ ion increases in the extracellular medium. This H+ ion enters into the cellular sites to bring about cellular acidosis. Hence, it is the acidic environment but not HCl as a whole does impart any direct change in the receptor. The β1 receptor's number and function have been observed earlier in cardiac muscles and coronary arteries when the pH is reduced to 6.0 by the addition of HCl or ascorbic acid into the perusing medium. Affinity of receptor to its agonist (s) varies with (i) a number of receptors or number of binding sites that bind to agonists and (ii) a number of G-protein coupled receptors that activate second messenger. In addition, the cycle of dephosphorylation and phosphorylation of trimeric G-protein on receptor activation by agonists also indirectly affects the measure of affinity. Hence, HCl-induced change in the affinity of the drug to receptor could be due to alteration in the integration of above cell signaling pathways. Endothelium denudation significantly increased the contractile response to NA at pHo of 7.4, 6.0, and 5.0 by 67%, 84%, and 118%, respectively, indicating that reduced vasotonic response to NA in acidosis is due to increased function of endothelium that, in turn, augments the release of endothelium-dependent relaxing factors,[26] which exert a subtractive influence on vascontractile response. However, such increase in vasotonic response to PE in endothelium-denuded GMSA rings was observed only at a pHo of 5.0. Furthermore, the estimation of mRNA level for α1-AR in the goat mesenteric artery using RT-PCR showed a significant decrease in α1A/D transcript expression as a consequence of acidosis. Thus, our observation reveals that the attenuated contractility, registered in acidosis at the isolated organ bath experiments, could originate from a reduced expression level of α1-ARs. Most studies now agree that acidosis exerts a direct effect on the vascular smooth muscle via ion channels (ATP-sensitive K+ channels, in particular), which may act in conjunction with reduced receptor sensitivity, resulting in attenuated maximal receptor-mediated responsiveness.[67927] Hence, the possibility of alteration of different cell signaling molecules as influenced by acidosis is yet far from a scientific approach that needs further study. In the presence of prazosin, NA- and PE-mediated contractile responses were inhibited differentially at pHo 6.0 and 5.0 in a dose-dependent manner. Prazosin (1 nM, 10 nM, and 0.1 μM) reduced 100% maximal contractile response induced by NA at pHo 7.4-68%, 51%, and 46%; at pHo 6.0-44%, 23%, and 14%; and at pHo 5.0-93%, 84%, and 12%, respectively. Similarly, prazosin (1 nM, 10 nM, and 0.1 μM) attenuated 100% maximal contractile response induced by PE at pHo 7.4-85%, 50%, and 47%; at pHo 6.0-66%, 44%, and 27%; and at pHo 5.0-99%, 98%, and 55%. The α1-AR blocking effect of prazosin is proportionately increased with respect to an increase in its concentration within a particular pHo. While comparing the influence of acidosis on the blocking effect of prazosin, it was interesting to note that the blocking effect of prazosin at different concentrations was further increased at pHo 6.0, but not at pHo 5.0, as compared to pHo 7.4. At pHo 5.0, blocking effect of prazosin was only increased at 0.1 μM. From the above observation, it is quite obvious to mention that in GSMA, the increased blocking effect of prazosin is due to decreased function and expression of α1D-AR under acidosis. Integrating both the results from the functional study and change in gene expression, it could be concluded that a decrease in pHo (7.4 → 4.5) in GSMA attenuated vasotonic response to NA and PE due to an additive effect of (i) enhanced release of endothelial-relaxing factors and (ii) reduced α1D-AR receptor expression in VSMCs of GSMA. An important clinical cardiovascular complication due to extreme acidemia is low blood pressure (hypotension), and this could be attributed to decreased vascular contraction arising from attenuated sympathetic response and reduced expression level of α1-ARs in this vascular bed as evidenced from the present vascular model. The possible clinical implication is that the therapeutic use of vasoconstrictor-like α1-receptor agonist would not be a primary choice to reverse hypotensive crisis arising from the extreme acidemia. The possible therapeutic use of alternative vasoconstrictor agents could be approached with experimental validations to counter cardiovascular complication due to extreme acidemia.

Financial Support and Sponsorship

This study was funded by DST, GOI.

Conflicts of Interest

There are no conflicts of interest.
  26 in total

Review 1.  Interactions between Ca(2+) and H(+) and functional consequences in vascular smooth muscle.

Authors:  C Austin; S Wray
Journal:  Circ Res       Date:  2000-02-18       Impact factor: 17.367

Review 2.  Alpha1-adrenergic receptors: new insights and directions.

Authors:  M T Piascik; D M Perez
Journal:  J Pharmacol Exp Ther       Date:  2001-08       Impact factor: 4.030

3.  Adrenergic receptors in the bovine mammary artery.

Authors:  Iain F Gow; Evelyn Mitchell; Martin Wait
Journal:  Biochem Pharmacol       Date:  2003-05-15       Impact factor: 5.858

4.  Intact nitric oxide production is obligatory for the sustained flow response during hypercapnic acidosis in guinea pig heart.

Authors:  Anke Heintz; Thea Koch; Andreas Deussen
Journal:  Cardiovasc Res       Date:  2004-12-19       Impact factor: 10.787

5.  Analysis of alpha1-adrenoceptors in rabbit lower urinary tract and mesenteric artery.

Authors:  P H Van der Graaf; V Deplanne; C Duquenne; I Angel
Journal:  Eur J Pharmacol       Date:  1997-05-26       Impact factor: 4.432

6.  [The contractile activity of the isolated mesenteric artery at different pH values of the perfusion solution].

Authors:  V N Iarysev; O V Karachentseva
Journal:  Fiziol Zh Im I M Sechenova       Date:  1996 Aug-Sep

7.  Effect of acidosis on alpha 1- and alpha 2-adrenoceptor-mediated vasoconstrictor responses in isolated arteries.

Authors:  I C Medgett; P E Hicks; S Z Langer
Journal:  Eur J Pharmacol       Date:  1987-03-31       Impact factor: 4.432

8.  Strain-specific effects of acidic pH on contractile state of aortas from Wistar and Wistar Kyoto rats.

Authors:  Dileep Kumar Rohra; Shin-ya Saito; Yasushi Ohizumi
Journal:  Eur J Pharmacol       Date:  2003-08-22       Impact factor: 4.432

Review 9.  Alpha-adrenoreceptor subtypes in blood vessels: physiology and pharmacology.

Authors:  S Z Langer; P E Hicks
Journal:  J Cardiovasc Pharmacol       Date:  1984       Impact factor: 3.105

10.  Calcium channel current of vascular smooth muscle cells: extracellular protons modulate gating and single channel conductance.

Authors:  U Klöckner; G Isenberg
Journal:  J Gen Physiol       Date:  1994-04       Impact factor: 4.086

View more
  3 in total

1.  Acidosis potentiates endothelium-dependent vasorelaxation and gap junction communication in the superior mesenteric artery.

Authors:  Ipsita Mohanty; Subas Chandra Parija; Sujit Suklabaidya; Satish Rattan
Journal:  Eur J Pharmacol       Date:  2018-03-07       Impact factor: 4.432

2.  Proteomic Profiling and Pathway Analysis of Acid Stress-Induced Vasorelaxation of Mesenteric Arteries In Vitro.

Authors:  Ipsita Mohanty; Sudeshna Banerjee; Arabinda Mahanty; Sasmita Mohanty; Nihar Ranjan Nayak; Subas Chandra Parija; Bimal Prasanna Mohanty
Journal:  Genes (Basel)       Date:  2022-04-29       Impact factor: 4.141

Review 3.  The Effects of Acidosis on eNOS in the Systemic Vasculature: A Focus on Early Postnatal Ontogenesis.

Authors:  Dina K Gaynullina; Olga S Tarasova; Anastasia A Shvetsova; Anna A Borzykh; Rudolf Schubert
Journal:  Int J Mol Sci       Date:  2022-05-26       Impact factor: 6.208

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.