Literature DB >> 27733216

[ARTICLE WITHDRAWN] Upregulation of MicroRNA-935 Promotes the Malignant Behaviors of Pancreatic Carcinoma PANC-1 Cells via Targeting Inositol Polyphosphate 4-Phosphatase Type I Gene (INPP4A).

Cuiyue Wang1, Zhen Feng2, Kaitong Jiang3, Xiuli Zuo1.   

Abstract

THIS ARTICLE WAS WITHDRAWN BY THE PUBLISHER IN NOVEMBER 2020

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27733216      PMCID: PMC7841058          DOI: 10.3727/096504016X14759554689565

Source DB:  PubMed          Journal:  Oncol Res        ISSN: 0965-0407            Impact factor:   5.574


INTRODUCTION

Pancreatic cancer is a common digestive system malignancy with a poor prognosis1,2. It is always diagnosed at an advanced state, and consequently there are few effective therapies3. The 5-year survival rate is reported to be only 2% among patients with metastatic pancreatic cancer4. Moreover, the incidence and mortality of pancreatic cancer are on the rise in recent years5. Therefore, a better understanding of the molecular mechanisms underlying pancreatic cancer will facilitate discovery of novel targeted therapies for this disease. MicroRNAs (miRNAs) are functional noncoding RNAs, which have been widely identified as being associated with tumor progression in pancreatic cancer6. For instance, the miR Let-7c is found to be upregulated after quercetin treatment, which can inhibit the progression of pancreatic cancer via activation of the Notch inhibitor Numbl7. miR-1291 can suppress cell proliferation and tumorigenesis in pancreatic cancer via targeting the FOXA2AGR2 pathway8. miR-891b can also inhibit the growth of pancreatic cancer cells via targeting Cbl-b and thus is considered to be an independent prognostic factor for pancreatic cancer9. In addition, the aberrantly expressed miRNAs are demonstrated to be critically correlated with drug resistance, disease stage, and survival of pancreatic cancer patients, suggesting that targeting the specific miRNAs may provide an efficient strategy for the therapy of pancreatic cancer10. Several serum miRNAs are shown to have potential diagnostic value in patients with pancreatic cancer11. Therefore, identification of the specific miRNAs associated with pancreatic cancer is of significance. In recent studies, miR-935 is observed to be upregulated in pancreatic cancer12,13. However, the potential roles and possible regulatory mechanism of miR-935 in pancreatic cancer progression are largely unknown. In this study, the miR-935 expression in pancreatic cancer tissues and human pancreatic cancer PANC-1 cells was investigated. In addition, miR-935 was overexpressed and suppressed in pancreatic cancer cells. The effects of miR-935 overexpression and suppression on cell proliferation, migration, and apoptosis were then investigated. In addition, the association between miR-935 and inositol polyphosphate 4-phosphatase type I gene (INPP4A) was explored. The objective of our study was to investigate the potential roles and regulatory mechanism of miR-935 in the progression of pancreatic cancer. Our findings are expected to provide new insight in the treatment of pancreatic cancer.

MATERIALS AND METHODS

Patients

From January 2014 to April 2016, a total of 37 patients who were diagnosed with pancreatic cancer and received surgical removal in our hospital were enrolled in this study. The diagnosis of pancreatic cancer was pathologically confirmed. Cancer tissues and their adjacent normal tissues were collected, snap frozen with liquid nitrogen, and stored at −80°C. The patients provided their informed consent, and the procedures in this study were approved by the human ethics committee of Qilu Hospital of Shandong University.

Cell Culture

The normal pancreatic ductal epithelial cell line HPDE6-C7 and human pancreatic cancer cell line PANC-1 were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA). These cells were then cultured in the Dulbecco’s modified Eagle’s medium (DMEM; Sigma-Aldrich, St. Louis, MO, USA), mixed with 10% fetal bovine serum (FBS; Sigma-Aldrich), and incubated in a humidified 37°C incubator with 5% CO2.

Cell Transfection

Vectors including the miR-935 mimic, miR-935 inhibitor, and miR-935 scramble were purchased from Sangon Biotech (Shanghai, P.R. China) and then transfected into cells with Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) based on the instructions of the manufacturer. Cells transfected with the miR-935 scramble and no vector transection were considered as the negative and blank controls.

Cell Proliferation Assay

Cell proliferation ability was assessed by the MTT assay and clonogenic assay. For the MTT assay, cells (adjusted to 5 × 103 cells/ml) at the logarithmic phase were seeded onto 96-well plates. After transfection at different times, 20 μl of MTT solution (Roche) was added to each well, and the plates were then cultured for 4 h. After terminating the reaction, the supernatant was removed by centrifugation and cells were collected. Then 150 μl of dimethyl sulfoxide (DMSO) was added to solubilize the formazan crystals by shaking at low speed for 10 min. Absorbance of cells in each well at 570-nm wavelength (A570) was then measured under a microplate reader (Biotech, Winooski, VT, USA). For the clonogenic assay, after 48 h of transfection, cells were plated into the 60-mm culture dishes with a density of 100 cells/dish. DMEM containing 10% FBS was then added to culture cells for 14 days. Afterward, cells were fixed, stained with Diff-Quik, and air dried. Colonies in each culture dish were then counted under a microscope (IX83; Olympus, Tokyo, Japan), and the cell number in each colony was more than 30 cells. All determinations were conducted in triplicate.

Cell Migration Assay

Cell migration was evaluated using Transwell migration chambers (8-μm pore size; Corning, Corning, NY, USA). In brief, after 48 h of transfection, cells (5 × 104 cells/well) were seeded in the upper portion of the chambers, which were filled with serum-free medium. The lower portion of the chambers was filled with the medium containing 10% FBS as a chemoattractant. After 24 h of incubation at 37°C, the migrated cells were fixed and stained with Diff-Quik staining. The number of migrated cells in each field was then counted using light microscopy. Each experiment was carried out three times with duplicate wells.

Cell Apoptosis Assay

Cell apoptosis was quantified with an annexin V–FITC cell apoptosis kit (Invitrogen) by means of flow cytometry. Briefly, after 48 h of transfection, cells were harvested, washed with ice-cold PBS, and then resuspended in the staining buffer. Cells were then mixed with 5 μl of annexin V–FITC and 5 μl of propidium iodide (PI; 10 mg/L) for 10 min. The mixtures were then analyzed using the FACSCalibur flow cytometer (Becton-Dickinson, San Jose, CA, USA). The apoptotic cells (annexin V+ and PI−) were then analyzed with CellQuest 3.0 software (BD Biosciences, San Jose, CA, USA).

qRT-PCR Analysis

Total RNA was extracted from the tissue samples or cultured cells with TRIzol reagent (Takara, Dalian, P.R. China). After detecting the quality of isolated RNA using SMA 400 UV0VIS (Merinton, Shanghai, P.R. China), cDNA synthesis was performed with the PrimerScript 1st Strand cDNA Synthesis Kit (Invitrogen). With a standard protocol provided by the manufacturer, qRT-PCR was carried out to measure the expressions of targets in tissues or cells using the SYBR Ex Script qRT-PCR Kit (Takara). Each reaction was performed in triplicate. The expressions of targets were normalized to phosphoglyceraldehyde dehydrogenase (GAPDH) and calculated using the comparative threshold (Ct) cycle (2−ΔΔCt) method. Primers used for the amplification of targets are shown in Table 1.
Table 1

Primers Used for Target Amplification

GeneForward Primer (5′–3′)Reverse Primer (5′–3′)
miR-935GATCACAGCAGGATGACATCACTGCCCTGACTGGTCTAAAAC
INPP4AGGAGCAGGTGATGCTTAGAAAATGATGAAGCCGCAGATGAG
E-cadherinAACGCATTGCCACATACACAACGCATTGCCACATACAC
N-cadherinAACTCCAGGGGACCTTTTCCAAATGAAACCGGGCTATC
VimentinTCCAAGTTGCTGACCTCTCTCAACGGCAAAGTTCTCTTC
SnailTTCAACTGCAAATACTGCAACAAGCGTGTGGCTTCGGATGTG
BaxCTGAGCTGACCTTGGAGCGACTCCAGCCACAAAGATG
Bcl-2CTGGTGGACAACATCGCTCTGGGTCTGCTGACCTCACTTGTG
Procaspase 3TGTCATCTCGCTCTGGTACGAAATGACCCCTTCATCACCA
Active caspase 3GGTATTGAGACAGACAGTGGCATGGGATCTGTTTCTTTGC
GAPDHTGACTTCAACAGCGACACCCACACCCTGTTGCTGTAGCCAAA
Primers Used for Target Amplification

Western Blotting

Cells were first lysed with adioimmunoprecipitation (RIPA; Sangon Biotech) lysate mixed with phenylmethanesufonyl fluoride (PMSF; Sigma-Aldrich). Then the supernatant was collected by means of centrifugation, and protein concentrations were measured with the BCA Protein Assay Kit (Pierce, Rockford, IL, USA). Afterward, 25 μg of protein was subjected to a 12% SDS-PAGE and then transferred onto a polyvinylidene difluoride (PVDF) membrane (Millipore, Billerica, MA, USA). The membranes were blocked with TBST (0.1% Triton in PBS) containing 5% nonfat milk for 1 h. Then the membrane was incubated with primary antibodies to INPP4A, P27, P21, and GAPDH (1:1,000 dilution; Santa Cruz Biotechnology, Santa Cruz, CA, USA), Bax, Bcl-2, caspase 3, E-cadherin, N-cadherin, Snail, and vimentin (1:100 dilution; Invitrogen) overnight at 4°C. The membrane was then probed with horseradish peroxidase-labeled appropriate secondary antibody (1:2,000 dilution; Santa Cruz Biotechnology) at room temperature for 1 h. After incubation with a chromogenic substrate, the protein bands were detected using the enhanced chemiluminescence (ECL) method. GAPDH served as the internal control to normalize the expression of target proteins.

Bioinformatic Method

The target of miR-935 was predicted using the predictive software programs TargetScan (http://www.targetscan.org/).

Luciferase Reporter Assay

To validate whether INPP4A was a target of an miR-935, the pMIR-REPORT™ vectors including INPP4A containing the wild-type miR-935 binding site (LUX-INPP4A 3′-WT) or with a mutated miR-935 binding sequence (LUX-INPP4A 3′-MUT) were used. Cells were plated onto 24-well plates at a cell density of 100 cells/well and were incubated for another 24 h. Then cells were cotransfected with luciferase vectors (LUX-INPP4A 3′-WT or LUX-INPP4A 3′-MUT) together with the miR-935 inhibitor (or control miRNA) and the Renilla control. After 36 h of transfection, luciferase activity was then measured with the Dual-Luciferase® Reporter Assay System (Promega, Madison, WI, USA) and normalized to Renilla luciferase activity.

Statistical Analysis

All data were expressed as mean ± standard error of the mean (SEM), and statistical analyses were performed using the GraphPad Prism 5.0 software (GraphPad Prism, San Diego, CA, USA). The differences between the two groups were measured using the independent sample t-test, and the differences among groups were carried out using the post hoc Tukey test. A statistically significant difference was defined with a value of p < 0.05.

RESULTS

Inverse Expression of miR-935 and INPP4A in Pancreatic Cancer Tissues and Cells

miR-935 expression in pancreatic cancer tissues was significantly increased in comparison with their adjacent normal tissues (p < 0.05) (Fig. 1A). However, the expression of INPP4A mRNA in pancreatic cancer tissues was significantly decreased compared with their adjacent normal tissues (p < 0.05) (Fig. 1B and C). In addition, miR-935 expression was also markedly increased in human pancreatic cancer PANC-1 cells compared with the normal pancreatic ductal epithelial HPDE6-C7 cells (p < 0.05) (Fig. 1D). Inverse expression of INPP4A with miR-935 was also found in human pancreatic cancer PANC-1 cells (p < 0.05) (Fig. 1E and F).
Figure 1

Inverse expression of miR-935 and INPP4A in pancreatic cancer tissues and cells. (A) The expression of miR-935 in pancreatic cancer tissues and their adjacent normal tissues. (B, C) The expression of INPP4A in pancreatic cancer tissues and their adjacent normal tissues. (D) The expression of miR-935 in human pancreatic cancer PANC-1 cells and normal pancreatic ductal epithelial HPDE6-C7 cells. (E, F) The expression of INPP4A in PANC-1 cells and HPDE6-C7 cells. Error bars indicate means ± SD. *p < 0.05 and **p < 0.01.

Inverse expression of miR-935 and INPP4A in pancreatic cancer tissues and cells. (A) The expression of miR-935 in pancreatic cancer tissues and their adjacent normal tissues. (B, C) The expression of INPP4A in pancreatic cancer tissues and their adjacent normal tissues. (D) The expression of miR-935 in human pancreatic cancer PANC-1 cells and normal pancreatic ductal epithelial HPDE6-C7 cells. (E, F) The expression of INPP4A in PANC-1 cells and HPDE6-C7 cells. Error bars indicate means ± SD. *p < 0.05 and **p < 0.01.

Overexpression of miR-935 Promoted Pancreatic Cancer Cell Proliferation

To investigate the effect of miR-935, pancreatic cancer cells were transfected with the miR-935 mimic, miR-935 inhibitor, and miR-935 scramble. After transfection, miR-935 expression in the miR-935 mimic group was significantly upregulated compared with the scramble group or control group, while it was obviously downregulated in the miR-935 inhibitor group (p < 0.05) (Fig. 2A), indicating that miR-935 was successfully overexpressed or suppressed in pancreatic cancer cells.
Figure 2

The effects of miR-935 on cell proliferation. (A) The expression of miR-935 in different transfection groups. (B) The MTT assay showed the cell viability of different transfection groups. (C, D) The colony assay showed the number of colonies of different transfection groups. (E) The expression level of p27 in different groups determined by Western blot. Error bars indicate means ± SD. *p < 0.05 and **p < 0.01 (compared with the control group).

The effects of miR-935 on cell proliferation. (A) The expression of miR-935 in different transfection groups. (B) The MTT assay showed the cell viability of different transfection groups. (C, D) The colony assay showed the number of colonies of different transfection groups. (E) The expression level of p27 in different groups determined by Western blot. Error bars indicate means ± SD. *p < 0.05 and **p < 0.01 (compared with the control group). The effects of miR-935 overexpression and suppression on cell proliferation were then assessed. The results of the MTT assay showed that cell proliferation was markedly promoted after miR-935 overexpression and obviously inhibited after miR-935 suppression (p < 0.05) (Fig. 2B), which was in line with the results of the clonogenic assay (Fig. 2C and D). Furthermore, the expression of p27 in different transfected cells was further detected to explore the possible regulatory mechanism of miR-935 in cell proliferation. The results of the Western blot showed that p27 was significantly downregulated in the miR-935 overexpression group, while it was obviously upregulated in the miR-935 suppression group (p < 0.05) (Fig. 2E), indicating that overexpression of miR-935 promoted cell proliferation, possibly via regulating the expression of p27.

Overexpression of miR-935 Promoted Pancreatic Cancer Cell Migration

The effects of miR-935 overexpression and suppression on pancreatic cancer cell migration were also evaluated. In comparison with the control group, the number of migrated cells in the miR-935 overexpression group was significantly increased and markedly decreased in the miR-935 suppression group (p < 0.05) (Fig. 3A and B). Furthermore, the expressions of epithelial–mesenchymal transition (EMT)-related molecules, including N-cadherin, E-cadherin, Snail, and vimentin, were measured to explore the possible regulatory mechanism of miR-935 in cell migration. The expressions of E-cadherin in the miR-935 overexpression group were significantly downregulated, and the expressions of N-cadherin, Snail, and vimentin were markedly upregulated, whereas the opposite effects on the expressions of these EMT-related molecules were obtained in the miR-935 suppression group (p < 0.05) (Fig. 3C and D). These findings suggest that miR-935 overexpression significantly promoted cell migration, possibly via inhibiting EMT.
Figure 3

The effects of miR-935 on cell migration. (A, B) The Transwell assay showed the number of migrated cells in different transfection groups. (C) The expression levels of N-cadherin, E-cadherin, Snail, and vimentin in different groups determined by qRT-PCR. (D) The expression levels of N-cadherin, E-cadherin, Snail, and vimentin in different groups determined by Western blot. Error bars indicate means ± SD. *p < 0.05 and **p < 0.01 (compared with the control group).

The effects of miR-935 on cell migration. (A, B) The Transwell assay showed the number of migrated cells in different transfection groups. (C) The expression levels of N-cadherin, E-cadherin, Snail, and vimentin in different groups determined by qRT-PCR. (D) The expression levels of N-cadherin, E-cadherin, Snail, and vimentin in different groups determined by Western blot. Error bars indicate means ± SD. *p < 0.05 and **p < 0.01 (compared with the control group).

Overexpression of miR-935 Inhibited Pancreatic Cancer Cell Apoptosis

The effects of miR-935 on pancreatic cancer cell apoptosis were investigated using flow cytometry. The results showed that the percentage of apoptotic cells in the miR-935 overexpression group was significantly decreased compared with the control group, while it was markedly increased in the miR-935 suppression group (p < 0.05) (Fig. 4A and B). In addition, in the miR-935 overexpression group, the expression of Bax was significantly decreased, and the expressions of Bcl-2, procaspase 3, and active caspase 3 were obviously increased (Fig. 4C and D). Opposite changes in the expressions of these apoptosis-related molecules were observed in the miR-935 suppression group (Fig. 4C and D). These results implied that miR-935 overexpression significantly inhibited cell apoptosis, possibly via regulating these apoptosis-related molecules.
Figure 4

The effects of miR-935 on cell apoptosis. (A, B) Flow cytometry showed the percentage of apoptotic cells in different transfection groups. (C) The expression levels of Bax, Bcl-2, procaspase 3, and active caspase 3 in different groups determined by qRT-PCR. (D) The expression levels of Bax, Bcl-2, procaspase 3, and active caspase 3 in different groups determined by Western blot. Error bars indicate means ± SD. *p < 0.05 and **p < 0.01 (compared with the control group).

The effects of miR-935 on cell apoptosis. (A, B) Flow cytometry showed the percentage of apoptotic cells in different transfection groups. (C) The expression levels of Bax, Bcl-2, procaspase 3, and active caspase 3 in different groups determined by qRT-PCR. (D) The expression levels of Bax, Bcl-2, procaspase 3, and active caspase 3 in different groups determined by Western blot. Error bars indicate means ± SD. *p < 0.05 and **p < 0.01 (compared with the control group).

INPP4A Was the Direct Target of miR-935

In this study, based on the information of TargetScan, INPP4A was predicted as a target for miR-935 (Fig. 5A). To further verify the predicted results, we performed a luciferase reporter assay. Expected results were obtained, showing that cotransfection of the miR-935 inhibitor significantly suppressed the luciferase reporter activity of the wild-type INPP4A 3′-UTR but not the mutated INPP4A 3′-UTR (p < 0.05) (Fig. 5B), suggesting that INPP4A was a direct target of miR-935. In addition, the expression of INPP4A in different transfected cells was determined. The results showed that, compared with the control and scramble groups, INPP4A expression in the miR-935 overexpression group was significantly decreased, while it was markedly increased in the miR-935 suppression group (p < 0.05) (Fig. 5C and D), displaying a negative regulatory relationship between miR-935 and INPP4A.
Figure 5

INPP4A was a direct target of miR-935. (A) The results of the bioinformatic analysis methods. (B) Luciferase reporter assay showed that miR-935 could directly target the 3′-UTR of INPP4A. (C) The expression of INPP4A in different transfection groups determined by qRT-PCR. (D) The expression of INPP4A in different transfection groups determined by Western blot. Error bars indicate means ± SD. *p < 0.05 and **p < 0.01 (compared with the control group).

INPP4A was a direct target of miR-935. (A) The results of the bioinformatic analysis methods. (B) Luciferase reporter assay showed that miR-935 could directly target the 3′-UTR of INPP4A. (C) The expression of INPP4A in different transfection groups determined by qRT-PCR. (D) The expression of INPP4A in different transfection groups determined by Western blot. Error bars indicate means ± SD. *p < 0.05 and **p < 0.01 (compared with the control group).

miR-935 Regulated Cell Migration and Apoptosis by Targeting INPP4A

To further explore whether miR-935 played a key role in pancreatic cancer via targeting INPP4A, cells were transfected with si-INPP4A and the miR-935 inhibitor simultaneously. INPP4A expression was significantly suppressed by si-INPP4A (p < 0.05) (Fig. 6A and B). In addition, the inhibitory effects of the miR-935 inhibitor on cell migration and the expression of EMT-related molecules were counteracted after cells were transfected with si-INPP4A and the miR-935 inhibitor simultaneously (p < 0.05) (Fig. 6C–F). In addition, the promoted effects of the miR-935 inhibitor on cell apoptosis, as well as the expression of apoptosis-related molecules, were neutralized after cells were transfected with si-INPP4A and the miR-935 inhibitor simultaneously (p < 0.05) (Fig. 6G–J). These results indicated that miR-935 inhibited cell migration and induced cell apoptosis by targeting INPP4A.
Figure 6

The effects of INPP4A on the migration and apoptosis of pancreatic cancer cells. (A, B) The expression of INPP4A after si-INPP4A treatment. (C, D) The Transwell assay showed the number of migrated cells in different groups. (E, F) The expression levels of N-cadherin, E-cadherin, Snail, and vimentin in different groups. (G, H) The flow cytometry showed the percentage of apoptotic cells in different groups. (I, J) The expression levels of Bax, Bcl-2, procaspase 3, and active caspase 3 in different groups. Error bars indicate means ± SD. *p < 0.05 and **p < 0.01 compared with the control group. #p < 0.05 compared with the inhibitor group.

The effects of INPP4A on the migration and apoptosis of pancreatic cancer cells. (A, B) The expression of INPP4A after si-INPP4A treatment. (C, D) The Transwell assay showed the number of migrated cells in different groups. (E, F) The expression levels of N-cadherin, E-cadherin, Snail, and vimentin in different groups. (G, H) The flow cytometry showed the percentage of apoptotic cells in different groups. (I, J) The expression levels of Bax, Bcl-2, procaspase 3, and active caspase 3 in different groups. Error bars indicate means ± SD. *p < 0.05 and **p < 0.01 compared with the control group. #p < 0.05 compared with the inhibitor group.

DISCUSSION

Recently, miR-935 has been shown to be implicated in the tumorigenesis of several human cancers, such as gastric cancer14 and gastric signet ring cell carcinoma15. However, the potential role of miR-935 in the pathogenesis of pancreatic cancer has not been fully investigated. In the present study, miR-935 was significantly upregulated in pancreatic cancer tissues and PANC-1 cells, while inverse expression of INPP4A was observed. Moreover, suppression of miR-935 significantly inhibited pancreatic cancer cell proliferation, suppressed cell migration, and induced cell apoptosis. In addition, INPP4A was confirmed as a direct target of miR-935. Silencing of INPP4A significantly counteracted the effects of miR-935 suppression on cell migration and apoptosis. Accumulating evidence has demonstrated that p27 is a well-known tumor suppressor in various types of cancer. For instance, miR-25 promotes cell proliferation in osteosarcoma by targeting p2716. miR-148a can promote gastric cancer proliferation by inhibiting the expression p2717. Downregulation of miR-429 inhibits cell proliferation in human prostate cancer via targeting p27Kip118. In addition, the reduced p27 expression has been shown to be correlated with poor prognosis in some human cancers, including pancreatic adenocarcinoma19,20. In this study, we found that miR-935 was significantly upregulated in pancreatic cancer tissues and PANC-1 cells. Additionally, suppression of miR-935 significantly inhibited pancreatic cancer cell proliferation and resulted in a significant increase in the expression of p27. Therefore, our results prompted us to speculate that miR-935 may promote pancreatic cancer proliferation, possibly via inhibiting p27 expression. Furthermore, EMT is a key mechanism contributing to the progression of primary tumors toward metastasis21. EMT has been shown to play a crucial role in the malignant metastasis in pancreatic cancer22. E-cadherin, one of the EMT markers, has been found to have a lower expression in pancreatic cancer tissues compared with nontumor tissues23. N-cadherin and vimentin, two other EMT markers, were observed to be upregulated in pancreatic cancer24,25. In our study, overexpression of miR-935 significantly promoted cell migration. Moreover, the expressions of E-cadherin in the miR-935 overexpression group were significantly downregulated and the expressions of N-cadherin and vimentin were markedly upregulated. It can therefore be speculated that miR-935 promotes pancreatic cancer cell migration, possibly via inhibiting EMT. Another aspect of the present analysis showed that miR-935 overexpression significantly inhibited cell apoptosis. In order to investigate miR-935’s effect on apoptosis, the relationships between miR-935 and the expression of apoptotic molecules were conducted. The results showed that, in the miR-935 overexpression group, the expression of Bax was significantly decreased, and the expressions of Bcl-2, procaspase 3, and active caspase 3 were obviously increased. Retinoids can induce cell apoptosis in pancreatic cancer via altered expression of Bcl-2/Bax26. Overexpression of Bax promotes chemotherapeutic agent-induced cell apoptosis in human pancreatic cancer27. The expression of Bcl-2 and Bax proteins is also confirmed to have clinicopathological significance in human pancreatic cancer28. In addition, previous studies have suggested that caspase 3 is a key mediator of mitochondrial events of apoptosis29. Caspase 3 drives pancreatic cancer cell apoptosis after treatment with gemcitabine30. Caspase 3 expression is also shown to be correlated with clinical pathologic features and survival time of patients with pancreatic cancer because it can influence the apoptosis of pancreatic cancer tissues and cells31. In sum, these results imply that miR-935 may inhibit pancreatic cancer cell apoptosis, possibly by altering the expression of Bcl-2/Bax and caspase 3. Intriguingly, one of the important findings in this study was that inverse expression of miR-935 and INPP4A was observed in pancreatic cancer tissues and cells. INPP4A, a PtdIns(3,4)P2 phosphatase, is identified as a suppressor of glutamate excitotoxicity in the central nervous system and thus can protect neurons from excitotoxic cell death32. However, the roles of INPP4A in cancer progression have not been fully investigated until now. In our study, we found that INPP4A was confirmed to be a direct target of miR-935. Silencing of INPP4A significantly counteracted the effects of miR-935 suppression on cell migration and apoptosis via regulating EMT and apoptosis-related molecules. Therefore, we speculate that miR-935 may promote pancreatic cancer progression via targeting INPP4A. In conclusion, our findings indicate that upregulation of miR-935 may promote pancreatic cancer cell proliferation and migration and inhibit cell apoptosis through targeting INPP4A. miR-935 and INPP4A may serve as potential targets in the therapy of pancreatic cancer.
  29 in total

1.  microRNA‑25 promotes osteosarcoma cell proliferation by targeting the cell‑cycle inhibitor p27.

Authors:  Xiu-Hui Wang; Pan Cai; Ming-Hui Wang; Zhe Wang
Journal:  Mol Med Rep       Date:  2014-05-21       Impact factor: 2.952

2.  Overexpression of Bax sensitizes human pancreatic cancer cells to apoptosis induced by chemotherapeutic agents.

Authors:  Zhong-Wei Xu; Helmut Friess; Markus W Büchler; Marc Solioz
Journal:  Cancer Chemother Pharmacol       Date:  2002-03-12       Impact factor: 3.333

3.  Caspases 3 and 7: key mediators of mitochondrial events of apoptosis.

Authors:  Saquib A Lakhani; Ali Masud; Keisuke Kuida; George A Porter; Carmen J Booth; Wajahat Z Mehal; Irteza Inayat; Richard A Flavell
Journal:  Science       Date:  2006-02-10       Impact factor: 47.728

Review 4.  MicroRNA in pancreatic cancer.

Authors:  Keiichi Yonemori; Hiroshi Kurahara; Kosei Maemura; Shoji Natsugoe
Journal:  J Hum Genet       Date:  2016-06-02       Impact factor: 3.172

5.  Differential Expression of MicroRNAs in Tissues and Plasma Co-exists as a Biomarker for Pancreatic Cancer.

Authors:  Shadan Ali; Hala Dubaybo; Randall E Brand; Fazlul H Sarkar
Journal:  J Cancer Sci Ther       Date:  2015

6.  miR-148a promoted cell proliferation by targeting p27 in gastric cancer cells.

Authors:  Shui-Long Guo; Zheng Peng; Xue Yang; Kai-Ji Fan; Hui Ye; Zhen-Hua Li; Yan Wang; Xiao-Li Xu; Jun Li; You-Liang Wang; Yan Teng; Xiao Yang
Journal:  Int J Biol Sci       Date:  2011-05-05       Impact factor: 6.580

Review 7.  MicroRNA Targeted Therapeutic Approach for Pancreatic Cancer.

Authors:  Yiwei Li; Fazlul H Sarkar
Journal:  Int J Biol Sci       Date:  2016-01-28       Impact factor: 6.580

8.  MicroRNA-891b is an independent prognostic factor of pancreatic cancer by targeting Cbl-b to suppress the growth of pancreatic cancer cells.

Authors:  Qian Dong; Ce Li; Xiaofang Che; Jinglei Qu; Yibo Fan; Xiaohan Li; Yue Li; Qian Wang; Yunpeng Liu; Xianghong Yang; Xiujuan Qu
Journal:  Oncotarget       Date:  2016-12-13

9.  α-Mangostin suppresses the viability and epithelial-mesenchymal transition of pancreatic cancer cells by downregulating the PI3K/Akt pathway.

Authors:  Qinhong Xu; Jiguang Ma; Jianjun Lei; Wanxing Duan; Liang Sheng; Xin Chen; Ang Hu; Zheng Wang; Zheng Wu; Erxi Wu; Qingyong Ma; Xuqi Li
Journal:  Biomed Res Int       Date:  2014-04-10       Impact factor: 3.411

10.  Up-regulation of microRNA let-7c by quercetin inhibits pancreatic cancer progression by activation of Numbl.

Authors:  Clifford C Nwaeburu; Natalie Bauer; Zhefu Zhao; Alia Abukiwan; Jury Gladkich; Axel Benner; Ingrid Herr
Journal:  Oncotarget       Date:  2016-09-06
View more
  10 in total

1.  Secretory Inositol Polyphosphate 4-Phosphatase Protects against Airway Inflammation and Remodeling.

Authors:  Kritika Khanna; Rituparna Chaudhuri; Jyotirmoi Aich; Bijay Pattnaik; Lipsa Panda; Y S Prakash; Ulaganathan Mabalirajan; Balaram Ghosh; Anurag Agrawal
Journal:  Am J Respir Cell Mol Biol       Date:  2019-04       Impact factor: 6.914

2.  The DNA methylation profile of non-coding RNAs improves prognosis prediction for pancreatic adenocarcinoma.

Authors:  Jie Zhang; Keqing Shi; Weiguo Huang; Wanqing Weng; Zhongjing Zhang; Yangyang Guo; Tuo Deng; Yukai Xiang; Xiaofeng Ni; Bicheng Chen; Mengtao Zhou
Journal:  Cancer Cell Int       Date:  2019-04-23       Impact factor: 5.722

Review 3.  The impact of phosphatases on proliferative and survival signaling in cancer.

Authors:  Goutham Narla; Jaya Sangodkar; Christopher B Ryder
Journal:  Cell Mol Life Sci       Date:  2018-05-03       Impact factor: 9.261

4.  IL-27 inhibits non-small-cell lung cancer cell metastasis by miR-935 in vitro.

Authors:  Tao Wang; Yifei Chen; Hanxiang Nie; Yi Huang; Yang Zhao; Jiong Yang
Journal:  Onco Targets Ther       Date:  2019-02-21       Impact factor: 4.147

5.  Exome sequencing in 51 early onset non-familial CRC cases.

Authors:  Jessada Thutkawkorapin; Annika Lindblom; Emma Tham
Journal:  Mol Genet Genomic Med       Date:  2019-02-27       Impact factor: 2.183

6.  MiR-935 Promotes Clear Cell Renal Cell Carcinoma Migration and Invasion by Targeting IREB2.

Authors:  Fei Liu; Yuedong Chen; Bin Chen; Chunxiao Liu; Jinchun Xing
Journal:  Cancer Manag Res       Date:  2019-12-30       Impact factor: 3.989

7.  MicroRNA-940 Targets INPP4A or GSK3β and Activates the Wnt/β-Catenin Pathway to Regulate the Malignant Behavior of Bladder Cancer Cells.

Authors:  Rong Wang; Yunfeng Wu; Weihua Huang; Weijun Chen
Journal:  Oncol Res       Date:  2017-03-23       Impact factor: 5.574

8.  MicroRNA-935 Directly Targets FZD6 to Inhibit the Proliferation of Human Glioblastoma and Correlate to Glioma Malignancy and Prognosis.

Authors:  Dainan Zhang; Shunchang Ma; Chuanbao Zhang; Peiliang Li; Beibei Mao; Xiudong Guan; Wenjianlong Zhou; Jiayi Peng; Xi Wang; Shaomin Li; Wang Jia
Journal:  Front Oncol       Date:  2021-03-12       Impact factor: 6.244

9.  MicroRNA-935 Inhibits Proliferation and Invasion of Osteosarcoma Cells by Directly Targeting High Mobility Group Box 1.

Authors:  Zhiqiang Liu; Qiang Li; Xin Zhao; Bin Cui; Libo Zhang; Qiang Wang
Journal:  Oncol Res       Date:  2018-02-22       Impact factor: 5.574

10.  A whole-exome case-control association study to characterize the contribution of rare coding variation to pancreatic cancer risk.

Authors:  Yao Yu; Kyle Chang; Jiun-Sheng Chen; Ryan J Bohlender; Jerry Fowler; Di Zhang; Maosheng Huang; Ping Chang; Yanan Li; Justin Wong; Huamin Wang; Jian Gu; Xifeng Wu; Joellen Schildkraut; Lisa Cannon-Albright; Yuanqing Ye; Hua Zhao; Michelle A T Hildebrandt; Jennifer B Permuth; Donghui Li; Paul Scheet; Chad D Huff
Journal:  HGG Adv       Date:  2021-12-10
  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.