Matrix metalloproteinase 14 participates in corneal lymphangiogenesis through the VEGF-C/VEGFR-3 signaling pathway.

The aim of the present study was to investigate the roles of matrix metalloproteinase 14 (MMP-14) in corneal inflammatory lymphangiogenesis. The expression of MMP-14 in vivo was detected by immunohistochemistry, reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blot assays, under various corneal conditions. pCMV-MMP-14 or empty pCMV vectors were injected into mouse corneal stroma, 3 days after suture placement in a standard suture-induced inflammatory corneal neovascularization assay. The outgrowth of blood and lymphatic vessels and macrophage recruitment were analyzed using immunofluorescence. The expression levels of vascular endothelial growth factor (VEGF) subtypes were tested by RT-qPCR. MMP-14 expression was upregulated significantly following various corneal injuries. The results demonstrated, for the first time, that MMP-14 strongly promotes corneal lymphangiogenesis and macrophage infiltration during inflammation. Furthermore, expression levels of VEGF-C and VEGF receptor-3, but not other VEGF components, were significantly upregulated by the intrastromal delivery of MMP-14 during corneal lymphangiogenesis. In conclusion, this study indicates that MMP-14 is critically involved in the processes of lymphangiogenesis. Inhibition of MMP-14 may provide a viable treatment for transplant rejection and other lymphatic disorders.

Introduction

The healthy cornea is devoid of blood and lymphatic vessels. However, vascularization of the cornea can occur during a number of pathological disorders, such as corneal chronic inflammation, alkali burns and graft rejection (1,2). The outgrowth of blood and lymphatic vessels from the limbus into the cornea, which is defined as corneal hemangiogenesis (HG) and lymphangiogenesis (LG), reduces transparency and visual acuity (3,4). It is also widely recognized that corneal HG and LG are strong risk factors for graft failure. Studies have shown that inhibition of corneal neovascularization (NV) can promote graft survival in a murine model of corneal transplantation (5,6). Thus, inhibition of corneal NV is a key point for not only optimal clarity and vision, but also higher graft survival rates.

Unlike blood vessels, corneal lymphatic vessels are not easily visible; therefore, systematic lymphatic research started much later than the study of blood vessels. With the advancement of technologies and the discovery of several lymphatic endothelial-specific markers, such as lymphatic vessel endothelial hyaluronan receptor-1 (LYVE-1), prospero homeobox protein 1 (Prox-1) and vascular endothelial growth factor receptor-3 (VEGFR-3), significant progress has been made (7–9). A number of factors involved in LG have been identified to date, including VEGF-C and VEGF-D (10–12); however, their underlying mechanisms remain unknown.

Matrix metalloproteinases (MMPs), which are a family of zinc-dependent enzymes, play key roles in degrading the extracellular matrix (ECM) associated with metastasis, angiogenesis and tumor invasion (13,14). MMP-14 (also known as membrane type-1 matrix metalloproteinase), a transmembrane type MMP, has been reported to possess a broad spectrum of activity against ECM components such as type I and II collagen, fibronectin, vitronectin, laminin, fibrin and proteoglycans (15,16). A previous study suggested that MMP-14 also enhanced cancer cell migration and invasion by the shedding of cluster of differentiation (CD)44 and syndecan-1 from the cell surface, which indicated that MMP-14 participated in tumor invasion and metastasis (17). MMP-14 may promote angiogenesis by degrading the ECM (18), and may also regulate corneal HG by cleaving decorin, an anti-angiogenic factor in corneas with basic fibroblast growth factor (bFGF)-induced vascularization (19). Furthermore, MMP-14 expression has been shown to be enhanced in wounded corneal epithelium and stroma (20). In contrast to HG, LG is known to also participate in corneal injuries, but the contribution of MMP-14 to this process remains unclear.

Hence, the present study aimed to determine if MMP-14 promotes corneal LG, in vivo. The expression of MMP-14, which is able to induce the outgrowth of lymphatic vessels after various corneal injuries, was determined by immunohistochemistry, reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blot assays. In addition, whether corneal LG was increased in a murine model of suture-induced inflammatory corneal NV was investigated, by the intrastromal injection of MMP-14 plasmid. Finally, whether VEGF signaling was involved in the molecular pathway leading to corneal LG was investigated, through the intrastromal delivery of MMP-14.

Materials and methods

Plasmid construction

A cDNA encoding the MMP-14 gene was subcloned into the pCMV vector (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) as previously described (21). Plasmids were purified using a Qiagen plasmid purification kit (Qiagen, Inc., Santa Clarita, CA, USA) according to the manufacturer's protocol. The concentration of plasmid was ~2 µg/µl for naked DNA injection.

Animals and anesthesia

All animal protocols were approved by the local animal care committee of the First Affiliated Hospital of Harbin Medical University (Harbin, China), and were in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. A total of 153 male C57BL/6 mice (6–8 weeks old; 18–20 g) were purchased from the Laboratory Animal Center of Harbin Medical University (Harbin, China). All the mice were raised in constant room temperature and free for food and water. The room was in 12-h light/dark cycle. Mice were anesthetized with an intraperitoneal injection of a combination of ketamine and xylazine (120 and 20 mg/kg bodyweight, respectively). The mice were sacrificed by CO2 inhalation overdose at the end of the experiment.

Suture-induced corneal NV and corneal intrastromal injections

The mouse model of suture-induced inflammatory corneal NV was established as previously described (22). The central cornea was marked with a 2-mm diameter trephine and three 11–0 nylon sutures (Lingqiao; Ningbo Medical Needle Co., Ltd., Ningbo, China) were placed in the intrastromal position. The outer point of suture placement was near the limbus, and the inner point was near the corneal center equidistant from the limbus. Sutures were removed after 7 days. Corneal intrastromal injections were performed on day 3 after suture placement, as previously described (23). A 0.5-inch 33-gauge needle on a 10-µl gas tight syringe (Hamilton Robotics, Reno, NV, USA) was introduced into the corneal stroma, and plasmid (5 µg pCMV-MMP14 or pCMV) solution was injected into the stroma to separate corneal lamellae and disperse the plasmid. Thus, MMP-14 and empty vector (pCMV) groups were established. Normal mice were entirely untreated, and saline control mice received only standard suture placement, and treated eyes were then rinsed with sterile physiological saline (0.9% NaCl, 1 ml, twice daily for 1 week). A total of 35 male C57BL/6 mice were used, including 8 mice in untreated group, 7 mice in saline control group, 8 mice in empty vector group and 10 mice in the MMP-14 group.

Mouse alkali injury model

The alkali burn injury model in the mouse cornea was used, as described previously (n=9) (24). In brief, a 2-mm diameter filter paper disc was wetted with 1 mol/l NaOH solution for 20 sec and placed on the central cornea of the mouse for 30 sec. Injured eyes were rinsed with sterile physiological saline (0.9% NaCl, 20 ml) immediately.

Immunohistochemistry

Corneas were cut and fixed in 10% neutral buffered formalin for 24 h. Paraffin-embedded tissue sections (4 µm) were deparaffinized, rehydrated, and treated with 0.3% hydrogen peroxide in methanol for 30 min, to eliminate endogenous peroxidase activity. The tissue sections were then incubated for 60 min at room temperature with a rabbit anti-mouse MMP-14 monoclonal antibody (1:2,000; ab51074; Abcam, Cambridge, UK). After three washes (3 min each) with phosphate-buffered saline (PBS), a DAB Detection kit (PV9000; ZSGB-Bio, Beijing, China) was used for MMP-14 staining, according to the manufacturer's protocol. Images were acquired with the Leica DM4000B biological microscope equipped with a Leica DFC 550 digital camera and Leica Application Suite version 4.2.0 software (Leica Biosystems, GmbH, Heidelberg, Germany).

RNA isolation and RT-qPCR

Total RNA was extracted from the corneas using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Total RNA (400 ng) was reverse transcribed using the PrimeScript™ RT reagent kit with gDNA Eraser (Takara Biotechnology Co., Ltd., Dalian, China). qPCR was performed using SYBR® Premix Ex Taq™ II (Takara Biotechnology Co., Ltd.) with a LightCycler 480 Real-time PCR System (Roche Diagnostics, Basel, Switzerland). qPCR was performed under the following conditions: Initial denaturation step of 95°C for 30 sec, 40 cycles of 95°C for 5 sec, and of 60°C for 30 sec, followed by an additional denaturation step of 95°C for 5 sec and 60°C for 60 sec, as a subsequent melt curve analysis to check amplification specificity. All assays were conducted three times, and were performed in triplicate. Results were derived from the comparative threshold cycle method (25,26) and normalized by glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal control. The primers used for qPCR were as shown in Table I.

Table I.

Primers used for quantitative polymerase chain reaction.

Gene	Sequence (5′-3′)
GAPDH	F: GTATTGGGCGCCTGGTCACC
	R: CGCTCCTGGAAGATGGTGATGG
VEGF-A	F: ACACGGTGGTGGAAGAAGAG
	R: CAAGTCTCCTGGGGACAGAA
VEGF-C	F: CTACAGATGTGGGGGTTGCT
	R: GATTGGCAAAACTGATTGTGAC
VEGF-D	F: GAGGCTGCTGCAACGAAGA
	R: GCACTTACAACCCGTATGGTT
VEGFR-1	F: CTGGACTGAGACCAAGCCCAAG
	R: GCTCAGATTCATCGTCCTGCAC
VEGFR-2	F: CTGTATGGAGGAAGAGGAAGTG
	R: GGTTCCTCCAATGGGATATC
VEGFR-3	F: CTCTGACCTAGTGGAGATCCTG
	R: CTTCGGTGATATGTAGAGCTGTG
MMP-14	F: GCTTTACTGCCAGCGTTC
	R: CCCACTTATGGATGAAGCAAT

F, forward; R, reverse; VEGF, vascular endothelial growth factor; VEGFR, VEGF receptor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MMP, matrix metalloproteinase.

Western blot analysis

The corneas were harvested and lysed in ice-cold radioimmunoprecipitation assay lysis buffer (Beyotime Institute of Biotechnology, Shanghai, China) with the addition of protease inhibitors. After separation by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, proteins were transferred onto nitrocellulose membranes. The membranes were incubated in blocking solution [2% bovine serum albumin (BSA) in Tris-buffered saline with Tween-20; Beyotime Institute of Biotechnology] for 1 h at room temperature, then incubated with a rabbit anti-mouse MMP-14 monoclonal antibody (1:2,000; ab51074; Abcam) overnight at 4°C. Each step was followed by extensive washing with PBS. The membranes were then incubated with corresponding horseradish peroxidase-conjugated secondary antibody (1:5,000; A0545; Sigma-Aldrich) for 1 h at room temperature, and developed using an enhanced chemiluminescence system (RPN2108; GE Healthcare, Little Chalfont, UK.). β-actin was used as loading control. The antibody was mouse anti-mouse β-actin monoclonal antibody (1:1,000; A00702-100; GenScript, Nanjing, China).

Corneal immunofluorescence microscopy and quantification

The immunofluorescence experiments were performed as previously described (27). The excised corneas were rinsed in PBS and fixed in acetone for 30 min. After washing and blocking with 2% BSA in PBS for 2 h, the corneas were stained overnight at 4°C with a rabbit anti-mouse LYVE-1 antibody (1:500; Abcam) and a rat anti-mouse CD31 antibody (1:100; BD Pharmingen, San Diego, CA, USA). On day 2, the tissue was washed three times with PBS, and was stored at 4°C in the absence of light. The LYVE-1 antibody (ab14917) was detected with an Alexa Fluor 647-conjugated goat anti-rabbit IgG antibody (1:200; A-21244; Invitrogen; Thermo Fisher Scientific, Inc.) and the CD31 antibody (550274) was detected with an Alexa Fluor 488-conjugated goat anti-rat IgG antibody (1:200; A-11006; Invitrogen; Thermo Fisher Scientific, Inc.). The corneas were stained with the Alexa Fluor antibodies overnight at 4°C. To detect the recruitment of macrophages into the inflamed corneas, a fluorescein isothiocyanate-conjugated rat anti-mouse CD11b antibody (1:100; 557396; BD Pharmingen) was used. The excised corneas were rinsed by PBS and fixed in acetone for 30 min. After washing and blocking with 2% BSA in PBS, for 2 h, corneas were stained overnight at 4°C, with a CD11b antibody.

The stained whole mounts were analyzed with a fluorescence microscope (EVOS f1; AMG; Thermo Fisher Scientific, Inc.). Each whole mount image was quantified using ImageJ software (National Institutes of Health, Bethesda, MD, USA), and the version was 1.24o. A detailed explanation of this method has been described previously (28). The mean vascularized area of the control groups was defined as being 100%; vascularized areas were then related to this value (vessel ratio). For macrophage analysis, the mean number of macrophages of the control groups was set as 100%; the numbers of macrophages per whole mount were then related to this value (cell ratio).

Statistical analysis

Statistical analysis was performed using Student's t-test with SPSS version 13.0 software (SPSS, Inc., Chicago, IL, USA). Results were expressed as the mean ± standard error of the mean, and a value of P<0.05 was considered to indicate a statistically significant difference. Graphs were drawn using GraphPad Prism, version 5.0 software (GraphPad Software, Inc., La Jolla, CA, USA).

Results

MMP-14 expression in the cornea

Immunohistochemical staining revealed weak expression of MMP-14 in normal cornea, and high expression levels of MMP-14 in the cornea on day 3 after standard suture placement or after alkali injury (Fig. 1A-C). As shown, these corneal injuries resulted in evident corneal NV. Moreover, the levels of corneal MMP-14 expression were also increased on the first day after the intrastromal injection of MMP-14 plasmid when compared with that of normal cornea, but increased levels were not detected in the vector-injected cornea. The data indicated that the intrastromal delivery of MMP-14 plasmid resulted in increased MMP-14 expression. The levels of MMP-14 expression were almost returned to normal at 3 days after the injection of MMP-14 DNA (Fig. 1D-F).

Figure 1.

Immunohistochemical staining of MMP-14. (A) Immunohistochemical staining shows weak expression of MMP-14 in normal mouse cornea. MMP-14 expression was markedly upregulated on (B) day 3 after corneal suture placement and (C) day 3 after corneal alkali injury. (D) MMP-14 expression was also significantly increased on day 1 after the intrastromal injection of MMP-14 vector, but (E) was not increased in the vector-injected cornea. (F) MMP-14 overexpression diminished 3 days after MMP-14 DNA injection. The yellow areas represent the expression of MMP-14. 3,3′-Diaminobenzidine staining. Original magnification, ×400. MMP, matrix metalloproteinase.

The results of the RT-qPCR assays demonstrated that MMP-14 expression was significantly upregulated in corneas treated with an intrastromal injection of MMP-14 plasmid (P=0.007), suture placement (P=0.003) or alkali injury (P=0.002), whereas MMP-14 expression in corneas treated with empty vector injection (P=0.442) or in corneas 3 days after MMP-14 vector injection (P=0.239) showed no significant changes, in comparison with the normal cornea (Fig. 2A). Furthermore, western blot assay confirmed the significant upregulation of MMP-14 expression in the aforementioned corneas (Fig. 2B).

Figure 2.

MMP-14 expression in normal and treated corneas. (A) Reverse transcription-quantitative polymerase chain reaction analysis of MMP-14 mRNA was performed in corneas after various treatments, in comparison with normal cornea (*P<0.01 vs. normal group). (B) Western blot assays confirmed the different levels of corneal MMP-14 expression under various conditions. Images are representative of three independent experiments. β-actin was used as a loading control. MMP, matrix metalloproteinase.

Intrastromal delivery of MMP-14 DNA promotes corneal LG and HG following suture placement

The standard suture-induced corneal NV assay and corneal intrastromal injection model were used to investigate the effect of MMP-14. Mice were randomized to receive intrastromal injections of either pCMV-MMP-14 or pCMV empty vector on day 3 after suture placement. On day 7, the densities of CD31-positive blood vessels and LYVE-1-positive lymphatic vessels were detected by immunohistochemistry as described previously (29). Quantitative immunohistochemical and morphometric analyses clearly revealed that corneal LG and HG were induced by standard suture placement, and injection of MMP-14 led to a significant promotion of LG and HG (Fig. 3A-I). The numbers of lymphatic vessels in mice treated with MMP-14 were significantly increased (P=0.009), and the numbers of blood vessels were also markedly increased (P=0.011), in comparison with those in the mice treated with empty vector (Fig. 3J and K).

Figure 3.

Intrastromal injection of MMP-14 DNA significantly promoted suture-induced corneal lymphangiogenesis and hemangiogenesis. (A-I) Representative images showing corneal whole mounts in eyes treated with MMP-14 plasmid (C, F, I: n=10 mice) or empty vector (B, E, H: n=8 mice), compared with the normal eyes (A, D, G: n=8 mice). Lymphatic vessels are shown in red (Alexa Fluor 647 immunofluorescence staining of LYVE-1) and blood vessels in green (Alexa Fluor 488 immunofluorescence staining of CD31). Original magnification, ×40. (J, K) Summarized data showing that the numbers of lymphatic vessels and blood vessels in eyes treated with MMP-14 were significantly increased, in comparison with those in eyes treated with empty vector (*P<0.01 and **P<0.05 vs. empty vector). MMP, matrix metalloproteinase; LYVE-1, .lymphatic vessel endothelial hyaluronan receptor-1; CD, cluster of differentiation.

Treatment with MMP-14 promotes the recruitment of inflammatory macrophages into the cornea

To test whether the lymphangiogenic effect of MMP-14 was also partially caused by an indirect effect on macrophages, CD11b+ macrophage infiltration into inflamed corneas (n=7 mice) was evaluated using standard corneal suture placement and intrastromal injection models. Treatment with MMP-14 resulted in a significantly increased recruitment of CD11b+ compared with empty vector (P=0.019), as shown in Fig. 4.

Figure 4.

Corneal macrophage infiltration was significantly increased by treatment with MMP-14. Representative images of immunofluorescence microscopy assays show the number of CD11b+ macrophages in eyes treated with (A) saline control, (B) empty vector and (C) MMP-14 vector. Fluorescein isothiocyanate immunofluorescence staining. Original magnification, ×200. (D) Summarized data showing that the number of CD11b+ macrophages was increased in eyes treated with MMP-14 vector, compared with that in eyes treated with empty vector (*P<0.05). MMP, matrix metalloproteinase; CD, cluster of differentiation.

Treatment with MMP-14 upregulates the expression of VEGF-C and VEGFR-3

HG and LG are driven by the production of lymphangiogenic growth factors, and the VEGF pathway is central to these processes (30). To further investigate the roles of MMP-14 in HG and LG, RT-qPCR was used to examine the expression of VEGF ligands and receptors. The results showed that VEGF-C (P=0.028) and VEGFR-3 (P=0.011) expression levels were significantly upregulated in mice treated with MMP-14, whereas the expression levels of VEGF-A (P=0.198), VEGF-D (P=0.183), VEGFR-1 (P=0.296) and VEGFR-2 (P=0.321) showed no significant changes, in comparison with those in the empty vector group (Fig. 5).

Figure 5.

Intrastromal injection of MMP-14 significantly promoted the expression of VEGF-C and VEGFR-3. Expression levels of (A) VEGF-A, (B) VEGF-C, (C) VEGF-D, (D) VEGFR-1, (E) VEGFR-2 and (F) VEGFR-3 as measured by reverse transcription-quantitative polymerase chain reaction. VEGF-A, VEGF-D, VEGFR-1 and VEGFR-2 expression levels showed no significant changes (all P>0.05), and VEGF-C and VEGFR-3 expressions levels were significantly increased in eyes treated with MMP-14 vector compared with empty vector (*P<0.05 and **P<0.05). VEGF, vascular endothelial growth factor; VEGFR, VEGF receptor.

Discussion

For the first time, to the best of our knowledge, the present study provides evidence that MMP-14 promotes in vivo LG in a corneal suture-induced mouse model. Although previous studies have reported the effects of MMP-14 on several angiogenesis-related properties, including degradation of ECM and cleavage of decorin (18), its contribution during LG has received less attention and so further investigation is merited.

It has previously been shown that proMMP-2 activation can be blocked by a specific monoclonal antibody against MMP-14, which resulted in a marked reduction of lymphatic vessel sprouting (31). However, the impact of MMP-14 on LG in vivo was not determined in that study. In the present study, corneal LG and HG were significantly increased in the suture-induced inflammatory corneal NV model when naked MMP-14 DNA was added. Thus, it may be concluded that MMP-14 plays an important role in the development of new lymphatic vessels.

To assess the association between MMP-14 and corneal NV, MMP-14 expression was investigated under various corneal conditions using immunohistochemical analysis, RT-qPCR and western blot analysis. In the present study, corneal intrastromal injection of MMP-14 plasmid was an effective method of increasing the amount of the protein, consistent with published reports (32). Additionally, the present study showed that significantly increased MMP-14 expression existed in the standard corneal suture model and the alkali burn model. Through the examination of these models, it was shown that corneal HG and LG were significantly induced. This was in agreement with previous results showing that keratocytes and myofibroblasts express MMP-1, −2 and −9 following corneal injuries (33–35). Collectively, these results demonstrate that MMP-14 is involved in corneal NV, at least under certain pathophysiological conditions. The MMP-14 overexpression in corneal tissues implied that MMP-14 plays an important role in corneal HG and LG.

Macrophages are acknowledged to have a key role in corneal LG. Previous studies have confirmed that large numbers of activated CD11b+ macrophages induce LG during corneal inflammation, by transdifferentiating into lymphatic endothelium and by releasing lymphangiogenic growth factors (36,37). As shown in the present study, the numbers of CD11b+ macrophages infiltrating the inflammatory corneas in MMP-14-treated mice were significantly greater than in vehicle-treated mice. It may be speculated that the lymphangiogenic effect of MMP-14 might also be partially caused by an indirect effect on macrophages.

To further investigate the mechanism through which MMP-14 regulates corneal HG and LG, the associations between MMP-14 and VEGF proteins and receptors were examined. A marked upregulation of VEGF-C and VEGFR-3 expression levels was detected in sutured corneas treated with MMP-14, but other members of the VEGF family exhibited no significant changes. The outgrowth of lymphatic vessels is primarily triggered by VEGF-C and its receptor VEGFR-3 (38,39), and the specific inhibition of VEGFR-3 alone is sufficient to block corneal LG (40). In previous studies, corneal LG induced by fibroblast growth factor-2 or hepatocyte growth factor could be blocked by VEGFR-3 inhibition (41,42). These investigations suggest that the VEGFR-3 signaling pathway is critical for corneal LG.

In addition, the data presented in the present study indicate that VEGF-C and its receptor VEGFR-3 might induce corneal HG in addition to LG. Among the VEGFs, VEGF-A is widely studied and has been found to be responsible for HG by binding to its receptors, VEGFR-1 and VEGFR-2 (43,44), while VEGF-C is thought to a dominant factor stimulating LG through binding to VEGFR-3. However, certain studies have provided evidence that VEGF-C is also associated with HG (45–47). An earlier study reported that VEGF-C enhanced microvascular endothelial cell migration, branching and capillary sprouting in association with MMP-14 overexpression (48), which is consistent with the findings of the present study. Several studies have also shown that VEGF-C and VEGFR-3 are associated with angiogenesis in cancer (49,50). A possible mechanism by which VEGF-C induces HG has been shown to be through a RhoA-mediated pathway (51). Furthermore, it may be speculated that increased expression of VEGF-C are associated with the large numbers of activated CD11b+ macrophages in the inflammatory corneas of MMP-14-treated mice. A previous study has shown that significantly increased numbers of dermal CD11b+ macrophages expressed higher levels of VEGF-C (52), which indicates their close association. It is possible, therefore, that MMP-14 induced corneal HG and LG by upregulating the expression levels of VEGF-C and VEGFR-3 in vivo. Additional studies to elucidate the relationship between MMP-14 and VEGF-C/VEGFR-3 are necessary.

In summary, through the use of a corneal suture model, the data in the present study demonstrate that MMP-14 promotes corneal HG and LG. The important role of MMP-14 in corneal LG was closely associated with CD11b+ macrophage infiltration, and with the VEGF-C/VEGFR-3 signaling pathway. Based on these findings, MMP-14 inhibition could be a promising new target for the management of inflammatory corneal disorders and for maintaining the transparency of the cornea.