| Literature DB >> 27682075 |
Chris Henning1, Dhiraj Gautam2, Peter Muriana3,4.
Abstract
Twenty-two bacteriocin-producing Enterococcus isolates obtained from food and animal sources, and demonstrating activity against Listeria monocytogenes, were screened for bacteriocin-related genes using a bacteriocin PCR array based on known enterococcal bacteriocin gene sequences in the NCBI GenBank database. The 22 bacteriocin-positive (Bac+) enterococci included En. durans (1), En. faecalis (4), En. faecium (12), En. hirae (3), and En. thailandicus (2). Enterocin A (entA), enterocins mr10A and mr10B (mr10AB), and bacteriocin T8 (bacA) were the most commonly found structural genes in order of decreasing prevalence. Forty-five bacteriocin genes were identified within the 22 Bac+ isolates, each containing at least one of the screened structural genes. Of the 22 Bac+ isolates, 15 possessed two bacteriocin genes, seven isolates contained three different bacteriocins, and three isolates contained as many as four different bacteriocin genes. These results may explain the high degree of bactericidal activity observed with various Bac+ Enterococcus spp. Antimicrobial activity against wild-type L. monocytogenes and a bacteriocin-resistant variant demonstrated bacteriocins having different modes-of-action. Mixtures of bacteriocins, especially those with different modes-of-action and having activity against foodborne pathogens, such as L. monocytogenes, may play a promising role in the preservation of food.Entities:
Keywords: Enterococcus; Listeria monocytogenes; bacteriocin; food preservation; genes
Year: 2015 PMID: 27682075 PMCID: PMC5023226 DOI: 10.3390/microorganisms3010001
Source DB: PubMed Journal: Microorganisms ISSN: 2076-2607
Figure 1Inhibition of indicator lawns of L. monocytogenes 39-2 (R0) by various Bac+ Enterococcus spp. from platings of food or animal-related samples after enrichment. Panel A, E. thailandicus FS92; Panel B, E. faecium 326F; Panel C, E. durans FS707A; Panel D, E. hirae 323F.
Bacteriocin-related primer sequences used in this study.
| Primer | Target Gene | Sequence (5′→3′) | Product Size (bp) | Included Genes | Homologous Genes |
|---|---|---|---|---|---|
| 236 | avicin A precurson (avcA) immunity protein (avcI) divergicin-like bact (avcB) | sakacin X (sakX) | |||
| Forward | ACG CGA AAT GAA GAA TGT TG | ||||
| Reverse | TTT CAT TTC CGC CAG AAA AC | ||||
| 299 | columbicin A (colA) hypothetical protein (orfB) | bovicin A (bovA) | |||
| Forward | TTT TTC TTG GGT TAT TTA CAG GAA | ||||
| Reverse | ATG TGC AAT GGG CAA AAA CT | ||||
| 384 | immunity protein (duqI) durancin Q (duqQ) inducing peptide (duqF) | durancin TW-49 (durM) | |||
| Forward | GCA CTG ATT CCG GCA CTA AT | ||||
| Reverse | CGT AAC TCT AAT GGC GGG AAG | ||||
| 291 | enterocin 96 | - | |||
| Forward | GTG GAG AGG ACG AAA GGA GA | ||||
| Reverse | TTG ATT AGT GGA GAG GAC GGT TA | ||||
| 247 | enterocin mr10A (mr10A) enterocin mr10B (mr10B) | enterocin JSB (entJSB) | |||
| Forward | ATG GGA GCA ATC GCA AAA T | ||||
| Reverse | CAT CCT TGT CCG ATA AAC TGC | ||||
| 506 | enterocin C1 (entC1) enterocin C2 (entC2) enterocin C immunity (entCI) | enterocin 1081A | |||
| Forward | AGG TCC AGC TGC TTA TTG GA | ||||
| Reverse | CCA TTA GAA TGA ATA CGC TAA AGA AA | ||||
| 608 | enterocin SE-K4 (entSE-K4) enterocin precursor (orf7) entSE-K4 homologue (orf8) entSE-K4 immunity (orf9) | bacteriocin II (D78257.1) enterocin TW-21 | |||
| Forward | ATG TAG AAG CCG CCA CGT AT | ||||
| Reverse | AAT CCC AAT CAT CCC ACA AA | ||||
| 104 | enterocin ej97 | - | |||
| Forward | AAA GCG ATG ATT AAG AAG TTT CC | ||||
| Reverse | TCC CAA GGA TAA CGA CCG TA | ||||
| 423 | enterocin W alpha (enwA) enterocin W beta (enw B) | - | |||
| Forward | GGG GTT GAA TTA TTG TAG AAA GGA | ||||
| Reverse | AAC TAG CCT CTA CCG CCA CA | ||||
| 231 | enterocin Q (entqA) | - | |||
| Forward | ATC ACA AAG TGA GCC CCT GT | ||||
| Reverse | TGG TAT CGC AAA ATG GAT GA | ||||
| 431 | enterocin P (entP) enterocin P immunity (entQ) | - | |||
| Forward | TTC CCC GAA GAA TAC AAA TGA | ||||
| Reverse | AAT TTC TGG GGT GGC TAA TG | ||||
| 362 | enterocin A (entA) immunity protein (entI) | - | |||
| Forward | AAA ATA AAT GTA CGG TCG ATT GG | ||||
| Reverse | CCA GCA GTT CTT CCA ATT TCA | ||||
| 257 | enterocin B (entB) | enterocin CRL35 | |||
| Forward | CAG AGT TCC CAA CTG TTT GCT | ||||
| Reverse | AGC CCA TGC TAG TGG TCCT T | ||||
| 321 | enterocin X alpha (enxA) enteorcin X beta (enxB) | - | |||
| Forward | GGACAATTTATGGGTAAACAAGC | ||||
| Reverse | TACGTCCACCATTCCAACCT | ||||
| 469 | bacteriocin precursor (bacA) hypothetical immunity protein (bacB) | hiracin JM79 | |||
| Forward | TTGTCTAGCTGGCATCGGTA | ||||
| Reverse | CCAATAGAAGCCCATCCTCT | ||||
| 285 | mundticin KS (munA) | mundticin L (munL) | |||
| Forward | AAA AGG GTG CAG TGT TGA TTG | ||||
| Reverse | TCC ACT GAA ATC CAT GAA TGA | ||||
Enterococcus strains used in this study and highest sequence homology 1 of partially sequenced bacteriocin operons to known bacteriocin operons.
| Isolate | Species | entA | mr10AB | enxAB | bacA | entP | entB | munA |
|---|---|---|---|---|---|---|---|---|
| FS707 | 99% | |||||||
| BJ-12 | 100% 2 | |||||||
| BJ-13 | 99% | |||||||
| BJ-19 | 100% | |||||||
| BJ-27 | 100% | 96% | ||||||
| 326F | 100% | 92% | 99% | 99% | ||||
| FS56-1 | 100% | 97% | ||||||
| FS97-2 | 100% | 99% | 100% | |||||
| JCP B-5 | 97% | 100% | 99% | |||||
| JCP M-2 | 95% | 100% | 99% | |||||
| JCP-9 | 98% | 100% | 99% | |||||
| Milk12 | 100% | 99% | 100% | |||||
| Milk5 | 100% | 99% | 100% | 99% | ||||
| NP-7 | 100% | |||||||
| Pop4 | 100% | 96% | 100% | 99% | ||||
| THYME2 | 100% | 100% | ||||||
| THYME3 | 100% | |||||||
| 323F | 100% | 97% | ||||||
| 323RL1 | 100% | 96% | 99% | |||||
| 341FA | 100% | 93% | 99% | |||||
| FS92 | 100% | 97% | ||||||
| RP-1 | 100% |
1 Homology percentages based on highest “Max Score” by NCBI’s nucleotide BLAST program with our entire partial sequence obtained from sequencing.
Figure 2Real-time PCR and dendrogram of sequence alignment of four bacteriocins from En. faecium 326F. Panel A, real-time PCR amplification of En. faecium 326F using a PCR array of 16 primer pairs (in individual reactions) for known enterococcal bacteriocins, including a 16S rRNA control. Only positive amplification reactions are shown and include primers derived from enterocins enxAB, mr10AB, entA, bacA, and universal 16S rRNA; the 12 other primer sets did not amplify. Insets are for melting curve assays of the positive amplicons (as indicated). Panel B, maximum likelihood homology tree obtained from multiple sequence alignment and phylogenetic analysis of four bacteriocin-related sequences obtained with En. faecium 326F (entA, mr10AB, enxAB, bacA) vs. the GenBank bacteriocin sequences from which the primers were derived: AF240561.1 (entA), AJ223633.1 (mr10AB), AB430879.1 (enxAB), and AB178871.1 (bacA).
Figure 3Maximum likelihood homology tree obtained from multiple sequence alignment and phylogenetic analysis of all bacteriocin-related sequences from the Enterococcus strains examined in this study. The bacteriocin name appearing after the strain designation is indicative of the enterococcal bacteriocin to which the amplimer had the highest homology.
Figure 4Culture spots of various Bac+ Enterococcus strains used in this study (En. faecium FS56-1, FS97-2, 326F, JCP B-5, Milk5; En. thailandicus RP-1) applied onto fresh lawns of wild type Listeria monocytogenes R0 (39-2) and a curvaticin FS47 BacR derivative of strain R0, L. monocytogenes R1 (39-2). Panel A, inhibition by all Bac+ culture spots against wild-type L. monocytogenes 39-2 R0 strain. Panel B, inhibition using the same cultures in panel A against the BacR L. monocytogenes R1 strain.