Literature DB >> 27672523

Isolation and characterization of microsatellite loci for the endangered wetland plant Adenophora palustris (Campanulaceae).

Kuniaki Otake1, Toshiaki Kondo2, Sonoko Watanabe2, Ikuko Masumoto1, Katsumi Iwahori3, Yuji Isagi4.   

Abstract

PREMISE OF THE STUDY: Adenophora palustris (Campanulaceae) is an endangered wetland plant species in Japan. Although it is widely distributed in East Asia, only six extant populations are known in Japan, with fewer than 1000 individuals in total. We developed 15 microsatellite markers for this species and confirmed their utility for the closely related species A. triphylla var. japonica. METHODS AND
RESULTS: Ten polymorphic loci were characterized for genetic variation within three populations of A. palustris. The number of alleles per locus ranged from four to 15, with an average of 9.3; the expected heterozygosity ranged from 0.48 to 0.89, with an average of 0.74. Nine loci were successfully amplified in A. triphylla var. japonica, and three of these loci showed polymorphism.
CONCLUSIONS: These markers are useful for investigating genetic diversity and gene flow within and among remnant populations of A. palustris in Japan, and the results will provide crucial information for conservation.

Entities:  

Keywords:  Adenophora palustris; Campanulaceae; endangered plant species; microsatellite; molecular marker

Year:  2016        PMID: 27672523      PMCID: PMC5033367          DOI: 10.3732/apps.1600056

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Adenophora palustris Kom. (Campanulaceae) is a perennial herb that inhabits small wetland areas in hilly regions. Adenophora palustris is widely distributed in East Asia, including eastern China, Korea, and Japan (Miyajima Natural Botanical Garden of Hiroshima University and Hiba Society of Natural History, 1997; Hong et al., 2011). However, only six extant populations are known in Japan—five in western Japan and one in central Japan. Although approximately 800 individuals grow in the largest population, which is located in the Sera region of western Japan, only a few to a few dozen individuals grow in the other populations. Consequently, fewer than 1000 individuals are estimated to remain in Japan, and A. palustris is currently classified as “critically endangered” in the Japanese Red Data Book (Ministry of the Environment Japan, 2015). Therefore, understanding its genetic diversity will play a key role in the future management of the species. Masumoto et al. (2011) developed eight microsatellite markers for A. palustris. Although four of the eight loci showed moderate polymorphism (5–8 alleles among 31 individuals), the other loci had limited polymorphism (2–4 alleles). Therefore, we have newly developed highly polymorphic genomic microsatellite markers to investigate the genetic diversity and gene flow within remnant populations of A. palustris. This paper reports 15 markers developed using next-generation sequencing technology.

METHODS AND RESULTS

A fresh leaf sample was taken from a ramet growing in a native population in the Sera region, Hiroshima Prefecture, Japan (Appendix 1). Genomic DNA was extracted using the hexadecyltrimethylammonium bromide mini-prep procedure (Stewart and Via, 1993) and used for library preparation with a TruSeq Nano DNA Sample Prep Kit (Illumina, San Diego, California, USA). The amplified DNA fragments were sequenced using a MiSeq Benchtop Sequencer (Illumina) in 2 × 300-bp read mode, and the data were assembled into contigs in fastq-join software (Aronesty, 2011), resulting in a total of 1,738,214 contigs. Contigs were screened using Primer3 version 2.2.3 software (Rozen and Skaletsky, 1999) embedded in MSATCOMMANDER version 1.0.8 software (Faircloth, 2008) to identify dinucleotide motifs with a minimum of 15 repeats. Consequently, a total of 5049 primer pairs were designed. In the amplification trial using four ramets of A. palustris, 15 of 48 randomly selected primer pairs showed a clear, strong, single band for each allele. To test the genetic variation of the 15 selected microsatellite markers, we sampled three A. palustris populations in the Sera and Toyosaka regions, Hiroshima Prefecture (western Japan), and the Ena region, Gifu Prefecture (central Japan; Appendix 1). To prevent illegal collection, we have withheld the exact locations of the sites. The sample size ranged from eight to 12 individuals per population, with a total sample size of 32. To confirm the utility of the 15 selected microsatellite markers for a close relative, one population of A. triphylla (Thunb.) A. DC. var. japonica H. Hara (n = 8) was also sampled (34°30′31″N, 132°44′06″E; Appendix 1). PCR amplifications were performed in a final volume of 10 μL, which contained 5 ng of extracted DNA, 0.2 μL of KOD FX Neo polymerase (Toyobo, Osaka, Japan), 5 μL of 2× PCR buffer, 0.4 mM dNTPs, and 0.2 μM primers (forward primer with a bar-coded split tag, reverse primer, and fluorescent bar-coded split tag primer). A bar-coded split tag (BStag), comprising a common basal region among six BStags, a three-nucleotide “bar-code” sequence, and a mismatched nucleotide at the middle position, was added at the 5′ end of the forward primer of each locus to enable postlabeling (Shimizu and Yano, 2011). We labeled the BStag primers with fluorescent dyes to create F9GAC-FAM (5′-CTAGTATCAGGACGAC-3′), F9GTC-VIC (5′-CTAGTATGAGGACGTC-3′), F9TAC-NED (5′-CTAGTATCAGGACTAC-3′), F9GCC-PET (5′-CTAGTATTAGGACGCC-3′), F9CCG-FAM (5′-CTAGTATTAGGACCCG-3′), and F9AGG-VIC (5′-CTAGTATTAGGACAGG-3′) (Shimizu and Yano, 2011). The sequences of forward and reverse primers are listed in Table 1. Amplification was performed with a Veriti Thermal Cycler (Life Technologies, Carlsbad, California, USA) under the following conditions: initial denaturation at 94°C for 2 min; 30 cycles of denaturation at 98°C for 10 s, annealing at 58°C for 30 s, and extension at 68°C for 30 s; 12 cycles of 98°C for 10 s, 49°C for 30 s, and 68°C for 10 s; and a final extension at 68°C for 7 min. The size of the PCR products was measured using an ABI PRISM 3130XL Genetic Analyzer (Life Technologies) by GeneMapper software (Life Technologies). We conducted PCR amplifications twice in four randomly selected individuals because microsatellite markers with a high number of repeat units may cause unstable results due to PCR error (Shinde et al., 2003).
Table 1.

Characteristics of the 15 microsatellite markers of Adenophora palustris.

LocusPrimer sequences (5′–3′)Repeat motifFluorescent labelAllele size range (bp)GenBank accession no.
AP01585F: [F9AGG] TGCAAGTACGAGTCGGTCC(AT)16VIC386LC127427
R: GTCACCAACGGGCATTCTAG
AP02665F: [F9CCG] GGGTGTCAACTTCATGTCAGG(AG)25FAM305–353LC122486
R: CGGTCTGCTAACTGGAGAGA
AP04413F: [F9GCC] ACGGGAGGGTAGATAGGTCC(AC)18PET280LC127428
R: GCCAAACATTCTTCCCAAGGT
AP04430F: [F9GTC] GGAACACTGCTCCTTGACTC(GA)17VIC158–206LC122487
R: GTAACACCATTGCTGCCTCC
AP07350F: [F9CCG] TTTGAGATCACCCGAAACGC(GT)19FAM335–355LC122488
R: AAGGGCCGCAAATTGGATTG
AP07489F: [F9AGG] GCTCAAACACCAAATTCAAC(AG)20VIC355–385LC122489
R: ACCTTCCAACCCACTAATCCC
AP08053F: [F9TAC] AAACGGACGGAGGGAGTAG(AG)21NED255–275LC122490
R: TGCGTTATTGGAGGAGGGTG
AP08837F: [F9CCG] CGCGGATCATGAGCTAAACC(CT)24FAM232LC127429
R: GGCGTCTCCTTCAGAAATGG
AP12435F: [F9GAC] ACAAGACTGGGACCACTCTC(AC)18FAM135–175LC127430
R: CTCCAAGGTAGGCAGTGTATTG
AP14144F: [F9GCC] AGTTTCTTTGAGCCGCGTTG(AG)19PET298–316LC122491
R: AAATCTGAGGACTTGTGCGC
AP14331F: [F9GAC] GCCATTCCTCCATCTTC(AG)16FAM138LC122492
R: TCCGCCATGACAAGCAATTC
AP14371F: [F9AGG] ACAGATGCAGATAGGTGGCC(AG)22VIC403–409LC122493
R: ACAGATGCAGATAGGTGGCC
AP15792F: [F9GCC] GTGATTATTCCTGCTGGCCG(AG)19PET288–314LC122494
R: CCTCCGTGCCATTGTGAAAG
AP15867F: [F9GAC] AGTTCATAGCCCGTCGAAATTC(AG)16FAM150LC127431
R: GGGACCTCTTCAACAACCAAC
AP20216F: [F9CCG] GCCGAGATGATATAAAGAGCC(AT)25FAM289–321LC122495
R: AGTGGGTATTCGGGAGCAAG
Characteristics of the 15 microsatellite markers of Adenophora palustris. The genetic polymorphism at each locus was assessed by calculating the observed number of alleles (A), observed heterozygosity (Ho), and expected heterozygosity (He). Deviations from Hardy–Weinberg equilibrium in each population and linkage disequilibrium were tested using FSTAT version 2.9.3 software (Goudet, 1995) and the web version 4.2 of GENEPOP software (Raymond and Rousset, 1995), respectively. Significance levels were adjusted using the Bonferroni correction for multiple comparisons. Of the 15 loci tested, 10 were polymorphic and five were monomorphic. PCR slippage was not observed. The evaluation of polymorphism in all 32 individuals showed that the 10 polymorphic loci had moderate to high levels of polymorphism (Table 2). A ranged from four (AP14371) to 15 (AP02665), with an average of 9.3 alleles per locus. He for each locus was generally high, ranging from 0.48 (AP14371) to 0.89 (AP02665). At the population level, A ranged from one to 13 (average: 5.4), Ho from 0.00 to 1.00 (average: 0.62), and He from 0.00 to 0.89 (average: 0.63). Among all loci in the three populations, five combinations of locus and population deviated significantly from Hardy–Weinberg equilibrium (P < 0.01; Table 2). There was no evidence of significant linkage disequilibrium (P < 0.05) in any pair of loci. Nine loci were successfully amplified in A. triphylla var. japonica, and of these, three loci showed polymorphism (Table 2).
Table 2.

Genetic variation of the 10 polymorphic microsatellite loci for three populations of Adenophora palustris and one population of A. triphylla var. japonica.

A. palustrisA. triphylla var. japonica
Sera (n = 12)Toyosaka (n = 12)Ena (n = 8)Hiroshima (n = 5)
LocusATAHoHeAHoHeAHoHeAbHoHe
AP0266515130.667*0.88690.7500.80961.0000.7814 (1)0.4000.640
AP044301180.6670.58370.7500.69450.5000.624
AP07350980.7500.75660.917*0.75030.7500.594
AP07489840.250*0.64260.3330.65920.8750.4911 (0)0.0000.000
AP080531050.2500.51760.7500.74350.7500.7023 (2)0.6000.480
AP12435840.000*0.51340.917*0.64230.2500.593
AP141441090.8330.81670.9170.82740.7500.608
AP14371440.5000.53830.5830.43420.5000.3754 (2)1.0000.640
AP15792860.5830.61140.5000.63230.7500.5071 (1)0.0000.000
AP202161060.7500.78180.7500.79210.0000.000

Note: — = not amplified; A = number of alleles per population; AT = total number of alleles observed in A. palustris; He = expected heterozygosity; Ho = observed heterozygosity.

Voucher and locality information are provided in Appendix 1.

Numbers in parentheses are the numbers of alleles only observed in the A. triphylla var. japonica population.

Significant deviation from Hardy–Weinberg equilibrium expectations (P < 0.01).

Genetic variation of the 10 polymorphic microsatellite loci for three populations of Adenophora palustris and one population of A. triphylla var. japonica. Note: — = not amplified; A = number of alleles per population; AT = total number of alleles observed in A. palustris; He = expected heterozygosity; Ho = observed heterozygosity. Voucher and locality information are provided in Appendix 1. Numbers in parentheses are the numbers of alleles only observed in the A. triphylla var. japonica population. Significant deviation from Hardy–Weinberg equilibrium expectations (P < 0.01).

CONCLUSIONS

The microsatellite markers described here will be useful for investigating genetic diversity and gene flow within and among remnant native populations of the critically endangered A. palustris in Japan. Assessment of their genetic variation will also contribute to elucidating how A. palustris populations in Japan have been declining, and the results will play a key role in the future management of the species. Furthermore, these markers have enough resolution to detect localities of individuals that were illegally collected and marketed, and the results will provide crucial information for revitalization of populations by complementary planting of illegally collected individuals.
Appendix 1.

Voucher information for Adenophora populations used in this study. One voucher was collected from each population sampled.

SpeciesCollection localityVoucher collection no.a
A. palustris Kom.Sera, Hiroshima Prefecture, JapanK. Otake0001
A. palustrisToyosaka, Hiroshima Prefecture, JapanK. Otake0003
A. palustrisEna, Gifu Prefecture, JapanK. Otake0006
A. triphylla (Thunb.) A. DC. var. japonica H. HaraHigashi-Hiroshima, Hiroshima Prefecture, JapanK. Otake0007

All vouchers were deposited in the Herbarium of the Graduate School for International Development and Cooperation, Hiroshima University, Hiroshima, Japan. To prevent illegal collection, we have withheld the exact locations of the sites.

  5 in total

1.  Primer3 on the WWW for general users and for biologist programmers.

Authors:  S Rozen; H Skaletsky
Journal:  Methods Mol Biol       Date:  2000

2.  Taq DNA polymerase slippage mutation rates measured by PCR and quasi-likelihood analysis: (CA/GT)n and (A/T)n microsatellites.

Authors:  Deepali Shinde; Yinglei Lai; Fengzhu Sun; Norman Arnheim
Journal:  Nucleic Acids Res       Date:  2003-02-01       Impact factor: 16.971

3.  msatcommander: detection of microsatellite repeat arrays and automated, locus-specific primer design.

Authors:  Brant C Faircloth
Journal:  Mol Ecol Resour       Date:  2008-01       Impact factor: 7.090

4.  A rapid CTAB DNA isolation technique useful for RAPD fingerprinting and other PCR applications.

Authors:  C N Stewart; L E Via
Journal:  Biotechniques       Date:  1993-05       Impact factor: 1.993

5.  A post-labeling method for multiplexed and multicolored genotyping analysis of SSR, indel and SNP markers in single tube with bar-coded split tag (BStag).

Authors:  Tokurou Shimizu; Kanako Yano
Journal:  BMC Res Notes       Date:  2011-05-26
  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.