| Literature DB >> 27657835 |
Andelé M Conradie1, Liesel Stassen1, Henk Huismans2, Christiaan A Potgieter3, Jacques Theron4.
Abstract
In an effort to simplify and expand the utility of African horse sickness virus (AHSV) reverse genetics, different plasmid-based reverse genetics systems were developed. Plasmids containing cDNAs corresponding to each of the full-length double-stranded RNA genome segments of AHSV-4 under control of a T7 RNA polymerase promoter were co-transfected in cells expressing T7 RNA polymerase, and infectious AHSV-4 was recovered. This reverse genetics system was improved by reducing the required plasmids from 10 to five and resulted in enhanced virus recovery. Subsequently, a T7 RNA polymerase expression cassette was incorporated into one of the AHSV-4 rescue plasmids. This modified 5-plasmid set enabled virus recovery in BSR or L929 cells, thus offering the possibility to generate AHSV-4 in any cell line. Moreover, mutant and cross-serotype reassortant viruses were recovered. These plasmid DNA-based reverse genetics systems thus offer new possibilities for investigating AHSV biology and development of designer AHSV vaccine strains.Entities:
Keywords: African horse sickness virus; Orbivirus; Reassortment; Reoviridae; Reverse genetics; T7 RNA polymerase; Virus rescue; dsRNA
Mesh:
Substances:
Year: 2016 PMID: 27657835 PMCID: PMC7172382 DOI: 10.1016/j.virol.2016.07.010
Source DB: PubMed Journal: Virology ISSN: 0042-6822 Impact factor: 3.616
Fig. 1Plasmid maps of the pJAD1 and pJAD2 reverse genetics vectors. In each of the pJAD1 and pJAD2 vectors (A), cloned cDNAs of the 10 full-length AHSV-4 dsRNA genome segments are flanked by a bacteriophage T7 RNA polymerase promoter and a HDV ribozyme sequence (B). Since the T7 RNA polymerase promoter directs transcription initiation from a juxtaposed guanosine residue and considering that all AHSV positive-sense RNAs are terminated with a guanosine, plasmid-generated transcripts are thus anticipated to possess the native 5′-end. Autocatalytic cleave of the nascent transcripts generates the native viral 3′-end. The transcription cassette in each reverse genetics vector is flanked by bidirectional T7Te terminators and restriction enzyme sites to facilitate cloning procedures are indicated.
Fig. 2Recovery of AHSV-4 from cDNA plasmids only. (A) Schematic of the approach. The 10 AHSV-4 constructs are co-transfected into BSR-T7 cells. Cytoplasmic transcription of the cloned cDNAs yield transcripts corresponding to viral positive-sense mRNAs with native 5′ and 3′ termini. Following 3–5 days of incubation, transfected cells are lysed and viable viruses are isolated by plaque assays on BSR cells. (B) Plaque assays of transfection cell lysates performed 5 days post-transfection (well 2). Mock-transfected cells were included as a control (well 1). (C) Electropherotypes of wild-type (WT) and plasmid-derived AHSV-4 (lanes 1 and 2). BSR cells were infected with wild-type AHSV-4 or rescued AHSV-4. At 72 h post-infection the viral dsRNA was extracted and electrophoresed in a non-denaturing polyacrylamide gel, followed by staining with ethidium bromide to visualize viral genome segments (S1–S10). (D) Digestion of the S5 genome segment RT-PCR products of wild-type AHSV-4 (WT) and plasmid-derived AHSV-4 (lanes 1 and 2) with PstI to confirm the presence of a novel mutation introduced into the S5 genome segment of plasmid-derived viruses. Size markers (M) are indicated in base pairs. The nucleotide sequence of the RT-PCR products was also determined and compared. Shown is the sequence chromatogram demonstrating the A→G substitution at nucleotide 1010 that creates a novel PstI restriction site in the S5 genome segment of recombinant AHSV-4. (E) Growth kinetics of wild-type (wt) AHSV-4 and plasmid-derived AHSV-4 (rAHSV-4) in BSR cells. Cells were infected with virus at a MOI of 0.1 pfu/ml and incubated for the intervals shown. Virus titres in cell lysates were determined by plaque assays on BSR cells. The results are presented as the mean virus titres of three independent experiments and error bars indicate the standard deviation.
Fig. 3Improved plasmid-based reverse genetics system for AHSV-4. (A) Two genome segment transcription cassettes encoding AHSV-4 cDNA flanked by the T7 RNA polymerase promoter and HDV ribozyme sequences were combined into a single plasmid, creating 5 plasmids encoding the viral genome. The procedure for AHSV-4 recovery is near identical to that for the 10-plasmid system, except that BSR-T7 cells are co-transfected with the 5 plasmids. (B) Plaque assays of transfection cell lysates performed 3 days post-transfection (well 2). Mock-transfected cells were included as a control (well 1). (C) Electropherotypes of wild-type (WT) and plasmid-derived AHSV-4 (lanes 1 and 2). The viral dsRNA was extracted from infected BSR cells at 72 h post-infection, separated on a non-denaturing polyacrylamide gel and visualized by staining with ethidium bromide. The genome segments (S1–S10) are indicated. (D) Digestion of the S5 genome segment RT-PCR products of wild-type AHSV-4 (WT) and plasmid-derived AHSV-4 (lanes 1 and 2) using PstI to confirm the presence of the signature mutation in the S5 genome segment as a genetic marker for viruses rescued from plasmid cDNA. Size markers (M) in base pairs are indicated.
Fig. 4Characterization of the reassortant virus A4AHSV-1VP2/VP5. (A) Electropherotype of the reassortant virus A4AHSV-1VP2/VP5 (lane 1) obtained by electrophoresis of the genomic dsRNA in a non-denaturing polyacrylamide gel, followed by ethidium bromide staining to visualize viral genome segments (S1–S10). The reassortant virus contains genome segments S2 and S6 from AHSV-1 in an otherwise AHSV-4 genetic background. Wild-type AHSV-4 dsRNA (A-4) and AHSV-1 dsRNA (A-1) marker lanes are indicated to the left and right of the figure, respectively. The asterisk indicates the faster migrating S2 genome segment of AHSV-1, whereas the origin of the S6 genome segment was determined by restriction enzyme digestion. (B) Restriction digestion analysis of genome segment S6 RT-PCR products from AHSV-4, AHSV-1 and the reassortant virus A4AHSV-1VP2/VP5. The RT-PCR products were digested with BamHI and the digestion products were analysed by agarose gel electrophoresis. BamHI has specificity for genome segment S6 of AHSV-4, with one site present in the genome segment, and does not cleave within the S6 genome segment of AHSV-1. Size markers (M) in base pairs are indicated.
Fig. 5Plasmid-based AHSV-4 reverse genetics system driven by a plasmid-encoded T7 RNA polymerase. (A) Schematic of the experimental strategy. A monolayer of BSR or L929 cells is co-transfected with a modified 5-plasmid set, in which the T7 RNA polymerase expression cassette is incorporated into the genetic backbone of the pJAD-S2-S6 reverse genetics plasmid to yield pJAD-S2-S6-T7pol. In cells co-transfected with the 5 plasmids, T7 RNA polymerase is expressed under control of a CMV promoter, which induces expression of transcripts corresponding to the native AHSV-4 positive-sense transcripts from the plasmids. After incubation for 3 days, recombinant viruses are recovered by plaque assays of the transfection cell lysates on BSR cells. (B) Plaque formation by recovered AHSV-4 viruses generated with the modified 5-plasmid reverse genetics system using BSR and L929 cells, as indicated in the figure. Mock-transfected cells were included as controls. (C) Comparison of virus recovery with the modified 5-plasmid system using BSR and L929 cells. Virus titres in supernatants of co-transfected BSR or L929 cells were determined at different time post-transfection by plaque assays on BSR cells. The results are presented as the mean titres of three independent experiments and error bars indicate the standard deviation. (D) Electropherotypes of the recovered viruses obtained by electrophoresis of viral dsRNA from wild-type (WT) AHSV-4 and dsRNAs obtained from recombinant AHSV-4 viruses recovered with the modified 5-plasmid system in BSR cells (lane 1) and L929 cells (lane 2). The non-denaturing polyacrylamide gel was stained with ethidium bromide to visualize the viral genome segments (S1–S10).
Fig. 6Comparison of virus recovery using the 10-plasmid, 5-plasmid and modified 5-plasmid AHSV-4 reverse genetics systems. BSR-T7 cells were co-transfected with the 10-plasmid set or 5-plasmid set, and BSR cells were co-transfected with the modified 5-plasmid set. The titres of virus released into the supernatant at different times post-transfection were determined by plaque assays on BSR cells. The results are presented as the mean titres of three independent experiments and error bars indicate the standard deviation.
Oligonucleotides used in this study.
| Oligonucleotide | Sequence (5′–3′) | Use and properties |
|---|---|---|
| iPCR F | CACAAAGCCGGCGCTTACAGACAAGCTGTG | Construction of pJAD1 and pJAD2; T7Te terminator sequences are underlined, |
| iPCR R | GAAACAGCCGGCCTCAAAGGCGGTAATACG’ | |
| Cas1F | ||
| Cas1R | A | |
| Cas2F | A | |
| Cas2R | CGAAG | |
| InvF | GGCCGGCATGGTCCCAGC | Linearization of pJAD1 and pJAD2 for cloning |
| InvR | TATAGTGAGTCGTATTA | |
| S1F | GTTATTTGAGCGATGGTCATCACCG | AHSV-4 genome segment-specific primers |
| S1R | GTAAGTGTTTTGAGCTGTGGGG | |
| S2F | GTTAATTCACTATGGCGTCCGAG | |
| S2R | GTATGTGTATTCACATGGAGCAAC | |
| S3F | GTTTATTTTCTGCTGTGAACTCCAG | |
| S3R | GTAAGTGTAATTCTGCCCGC | |
| S4F | GTTATTTAGGATGGAACCTTACG | |
| S4R | GTAAGGTTATTAGGATTCCCC | |
| S5F | GTTAAAGAACCTAGGCGGTTTGG | |
| S5R | GTAAGTTTGTGAACCAGGGGG | |
| S6F | GTTATTTTTCCAGAAGCCATGG | |
| S6R | GTAAGTGTTTTTCCCGCCCAC | |
| S7F | GTTAAATTCGGTTAGGATGGACG | |
| S7R | GTAAGTGTATTCGGTATTGACGTATTAC | |
| S8F | GTTAAAAATCCGTTCGTCATCATGG | |
| S8R | GTATGTTGAAATCCGCGGTTAC | |
| S9F | GTTAAATAAGTTGTCTCATGTCTTCGGC | |
| S9R | GTAAGTTTTAAGTTGCCTGCAAG | |
| S10F | GTTAATTATCCCTTGTCATGAATCTAGC | |
| S10R | GTAAGTTGTTATCCCACCCCCTAG | |
| S5PstI-F | GGGACATCTGCAGCCGGAATCAATTTTAGT | AHSV-4 S5 mutagenic primers |
| S5PstI-R | ACTAAAATTGATTCCGGCTGCAGATGTCCC | |
| 2.1F | GTTAATTCACTATGGCGTCCGAG | AHSV-1 genome segment-specific primers |
| 2.1R | GTAAGTGTTTTGAGCTGTGGGG | |
| 6.1F | GTTTATTTTTCCAGAAGCCATGG | |
| 6.1R | GTAAGTGTTTTTCCCGCCCAC | |
| T7Bam-F | GAggatccATGAACACGATTAACATCGCTAAGAACGACTTC | Amplification of T7 RNA polymerase coding region from |
| T7Bam-R | GCggatccTTACGCGAACGCGAAGTCCGACTCTAAGATGTC | |
| CMV-F | CCgatatcGAGGCGGAAAGAACCAGCTGGGGCTCTA | Amplification of expression cassette from pcDNA-T7pol; |
| CMF-R | CCgatatcGTTGACATTGATTATTGACTAGTTA |