Literature DB >> 27647271

Molecular characterization of Staphylococcus aureus isolates from various healthcare institutions in Nairobi, Kenya: a cross sectional study.

Geoffrey Omuse1, Kristien Nel Van Zyl2, Kim Hoek2, Shima Abdulgader3, Samuel Kariuki4, Andrew Whitelaw2, Gunturu Revathi5.   

Abstract

BACKGROUND: Staphylococcus aureus (S. aureus) has established itself over the years as a major cause of morbidity and mortality both within the community and in healthcare settings. Methicillin resistant S. aureus (MRSA) in particular has been a major cause of nosocomial infections resulting in significant increase in healthcare costs. In Africa, the MRSA prevalence has been shown to vary across different countries. In order to better understand the epidemiology of MRSA in a setting, it is important to define its population structure using molecular tools as different clones have been found to predominate in certain geographical locations.
METHODS: We carried out PFGE, MLST, SCCmec and spa typing of selected S. aureus isolates from a private and public referral hospital in Nairobi, Kenya.
RESULTS: A total of 93 S. aureus isolates were grouped into 19 PFGE clonal complexes (A-S) and 12 singletons. From these, 55 (32 MRSA and 23 MSSA) representative isolates from each PFGE clonal complex and all singletons were spa typed. There were 18 different MRSA spa types and 22 MSSA spa types. The predominant MRSA spa type was t037 comprising 40.6 % (13/32) of all MRSA. In contrast, the MSSA were quite heterogeneous, only 2 out of 23 MSSA shared the same spa type. Two new MRSA spa types (t13149 and t13150) and 3 new MSSA spa types (t13182, t13193 and t13194) were identified. The predominant clonal complex was CC 5 which included multi-locus sequence types 1, 8 and 241.
CONCLUSION: In contrast to previous studies published from Kenya, there's marked genetic diversity amongst clinical MRSA isolates in Nairobi including the presence of well-known epidemic MRSA clones. Given that these clones are resident within our referral hospitals, adherence to strict infection control measures needs to be ensured to reduce morbidity and mortality associated with hospital acquired MRSA infections.

Entities:  

Keywords:  Kenya; MRSA; MSSA; Staphylococcus aureus

Mesh:

Substances:

Year:  2016        PMID: 27647271      PMCID: PMC5029008          DOI: 10.1186/s12941-016-0171-z

Source DB:  PubMed          Journal:  Ann Clin Microbiol Antimicrob        ISSN: 1476-0711            Impact factor:   3.944


Background

Staphylococcus aureus (S. aureus) has established itself over the years as a major cause of morbidity and mortality globally both within the community and in healthcare settings [1-3]. Its ability to cause disease is aided not only by its impressive repertoire of virulence factors but also its ability to develop resistance to antibiotics used in its treatment epitomized by the emergence of methicillin resistant S. aureus (MRSA). Methicillin resistance is conferred by the mecA gene that is carried on a staphylococcal cassette chromosome mec (SCCmec) and codes for a modified penicillin binding protein (PBP2a). This binding protein has reduced affinity to all beta-lactam and beta-lactam/beta-lactamase inhibitor combination antibiotics [4, 5]. In Africa, the MRSA prevalence has been shown to vary across different countries with a prevalence as low as 7 % reported in Madagascar and as high as 82 % in Egypt [6]. This marked variation could be due to different environmental determinants or simply due to a difference in the genetic diversity of S. aureus. In Kenya, there is a marked difference in reported MRSA prevalence in clinical isolates within Nairobi with one recent study reporting a prevalence of 3.7 % while another reported 87.2 % [7, 8]. In order to better understand the epidemiology of MRSA, it is important to define its population structure. Molecular characterization helps in identifying clonal populations which can help in surveillance and investigation of outbreaks. There is a growing interest in the characterization of MRSA isolates and this stems primarily from its role as a major cause of hospital and community acquired infections [1, 9, 10]. There are various molecular methods used, the more common ones include multi-locus sequence typing (MLST), pulse field gel electrophoresis (PFGE), staphylococcal protein A (spa) typing and SCCmec typing [11]. Despite S. aureus having a very diverse clonal population, MLST studies have shown that a small set of clonal complexes (CC) are associated with most of the MRSA epidemics. These include CC5, CC22, CC30, CC45 and CC80 [6, 12, 13]. A clonal complex can have several sequence types, however the multi-locus sequence types that are regarded as the founders in these clonal complexes are ST5, ST22, ST30, ST45 and ST80 respectively [14]. As regards spa types, it has been shown that particular ones are more predominant in certain regions. For example t030 is quite predominant in hospitals in Turkey [15], t042 and t044 are more common in North Africa while t008 is common in the US [16]. Unfortunately, the molecular epidemiology of MRSA in Africa is not very well described. Most of the studies carried out in Africa characterizing MRSA have emanated from a few countries namely Tunisia, Nigeria, South Africa, Algeria and Egypt [6]. There are very few studies from East Africa that have reported on the molecular characterization of S. aureus presumably due to lack of readily available technical expertise and laboratory facilities. A study done in Kenya looking at carriage of S. aureus by inpatients in a government hospital found that only 6 out of 86 (7 %) S. aureus isolates were MRSA and they all belonged to the same clone (MLST ST239; spa type t037) [17]. This clone is a globally distributed hybrid of ST8 and ST30 and is known to be responsible for several outbreaks in different continents [18-21]. The only other study from Kenya did not report on spa or multi locus sequence types [8]. We set out to characterize selected S. aureus isolates from different hospitals in Nairobi, Kenya in order to identify which clonal lineages are present and further shed light on the molecular epidemiology of both MSSA and MRSA in Kenya.

Methods

We obtained archived methicillin susceptible (MSSA) and MRSA isolates from 2 hospitals in Nairobi, Kenya collected between January 2010 and July 2013. The hospitals included a government hospital whose samples we obtained through the Kenya Medical Research Institute (KEMRI) and the Aga Khan University Hospital Nairobi (AKUHN) which is a private referral hospital with a network of satellite clinics and laboratories spread in and around Nairobi as well as different parts of the country. The isolates from the government hospital were part of a previous study done to determine prevalence of MRSA carriage in a paediatric ward and the rest of the isolates were from clinical specimens submitted to the AKUHN laboratory for routine culture and sensitivity. These were convenience isolates that were not collected through a well-structured, formal and documented process. All isolates were stored at −80 °C and grown overnight on sheep blood agar plates at 37 °C.

S. aureus identification

All isolates were confirmed to be S. aureus using routine bench identification methods which included growth characteristics on sheep blood agar, gram stain, catalase, coagulase, deoxyribonuclease (DNase) and mannitol fermentation tests. A cefoxitin screen using a 30 µg disc (Oxoid, United Kingdom) was performed to distinguish MSSA from MRSA. Isolates with a diameter ≤21 mm were classified as MRSA.

Antibiotic susceptibility

Antibiotic susceptibility was only available for the MRSA isolates obtained from AKUHN. These were performed on Vitek 2 (version 4.01, bioMerieux, Marcy-l’Etoile, France) an automated bacterial identification system that performs antibiotic susceptibility using broth dilution and interpretation based on Clinical Laboratory Standards Institute (CLSI) antimicrobial susceptibility guidelines [22]. Multidrug resistance (MDR) was defined as resistance to three or more drug classes.

DNA derivation

Isolates were grown on blood agar plates (National Health Laboratory Services Media Lab, Cape Town, South Africa) at 37 °C overnight. After incubation, 4–5 large colonies were re-suspended in 200 µL nuclease free water. The samples were incubated at 95 °C for 30 min, followed by −80 °C for 30 min and centrifuged for 10 min at 14,000×g when thawed. The supernatant containing DNA was carefully aspirated without disturbing the pellet of cell debris and stored as DNA aliquots at −20° C until further use.

PFGE

PFGE based on SmaI macrorestriction analysis was performed using the CDC laboratory protocol for S. aureus [23]. The PFGE was run on a CHEF DR III system (Bio-Rad, California, United States of America) with optimum settings as follows: initial 5 s, switch 30 s, run time 29 h, voltage 6 V/cm and a SeaKem Gold agarose (Lonza, Rockland, USA) gel concentration of 1.4 %. S. aureus NCTC 8325 was used as a control in each gel run. Gels were visualized an Alliance 2.7 (UVItec, Cambridge, United Kingdom) gel documentation system after staining with 10 mg/mL ethidium bromide. Analysis of PFGE clusters was performed using the BioNumerics software package (Applied Maths, Sint-Martens-Latem, Belgium), using the Dice coefficient, and visualized as a dendrogram by the unweighted-pair group method, using average linkages with 1 % tolerance and 1 % optimization settings. In order to define a cluster, a cutoff of 80 % similarity was used.

SCCmec typing

SCCmec typing was performed using multiplex PCR as described by Milheirico et al. [24]. All assays were performed in a GeneAmp 9600 thermocycler (Applied Biosystems). The optimal cycling conditions were the following: 95 °C for 5 min; 35 cycles of 95 °C for 45 s, 57 °C for 45 s, and 72 °C for 1 min; and a final extension at 72 °C for 10 min. Each PCR mixture contained 0.5 µL of the primers listed in Table 1, KAPA2G Robust HotStart ReadyMix PCR (KAPA biosystems) which contains KAPA2G Robust HotStart DNA Polymerase (1 U/25 µL reaction) in a proprietary reaction buffer containing dNTPs (0.2 mM of each dNTP at 1X), MgCl2 (2 mM at 1X), 0.3 µL (3 mM) additional MgCl2, 10.7 µL of PCR grade water and genomic DNA in a final volume of 25 µL. The following S. aureus isolates were used as controls: BAA-38, BAA-1681, BAA-39, BAA-1680, BAA-1688 and BAA-42 for SCCmec types I–VI respectively. The PCR products were resolved in a 1 % SeaKem Gold Agarose (Lonza, Rockland, USA) gel in 0.5 % Tris–borate-ethylene-diamine-tetra-acetic acid (EDTA) buffer (Bio-Rad, Hercules, CA) at 4 V/cm for 2.5 h and were visualized with ethidium bromide.
Table 1

Primers used in the updated version of SCCmec multiplex PCR

Primer namePrimer sequence (5 33)Primer specificity (SCCmec type, region)Amplicon size (bp)Conc. (µM)
CIF2 F2TTCGAGTTGCTGATGAAGAAGGI, J1 region4950.4
CIF2 R2ATTTACCACAAGGACTACCAGC0.4
ccrC F2GTACTCGTTACAATGTTTGGV, ccr complex4490.8
ccrC R2ATAATGGCTTCATGCTTACC0.8
RIF5 F10TTCTTAAGTACACGCTGAATCGIII, J3 region4140.4
RIF5 R13ATGGAGATGAATTACAAGGG0.4
SCCmec V J1 FTTCTCCATTCTTGTTCATCCV, J1 region3770.4
SCCmec V J1 RAGAGACTACTGACTTAAGTGG0.4
dcs F2CATCCTATGATAGCTTGGTCI, II, IV, and VI, J3 region3420.8
dcs R1CTAAATCATAGCCATGACCG0.8
ccrB2 F2AGTTTCTCAGAATTCGAACGII and IV, ccr complex3110.8
ccrB2 R2CCGATATAGAAWGGGTTAGC0.8
kdp F1AATCATCTGCCATTGGTGATGCII, J1 region2840.2
kdp R1CGAATGAAGTGAAAGAAAGTGG0.2
SCCmec III J1 FCATTTGTGAAACACAGTACGIII, J1 region2430.4
SCCmec III J1 RGTTATTGAGACTCCTAAAGC0.4
mecI P2ATCAAGACTTGCATTCAGGCII and III, mec complex2090.8
mecI P3GCGGTTTCAATTCACTTGTC0.8
mecA P4TCCAGATTACAACTTCACCAGGInternal positive control1620.8
mecA P7CCACTTCATATCTTGTAACG0.8
Primers used in the updated version of SCCmec multiplex PCR

spa typing

This was done using the following primers: 1095 F: 5′-AGACGATCCTTCGGTGAGC-3′ and 1517R: 5′-GCTTTTGCAATGTCATTTACTG-3′. PCR reactions consisted of 12.5 uL of KAPA2G Robust HotStart ReadyMix PCR (KAPA biosystems) which contains KAPA2G Robust HotStart DNA Polymerase (1 U per 25 µL reaction) in a proprietary reaction buffer containing dNTPs (0.2 mM of each dNTP at 1X), MgCl2 (2 mM at 1X), 0.5 μM of primers and genomic DNA in a final volume of 25 µL. PCR conditions were 95 °C for 6 min; 30 cycles each of 95 °C for 45 s, 64 °C for 45 s, and 72 °C for 60 s; and a final extension at 72 °C for 6 min. Sequencing was outsourced to inqaba biotec, a biotechnology company based in Pretoria, South Africa. Using the Ridom spa server (http://www.spa.server.ridom.de), spa sequences were automatically assigned to spa types. Sequence types and clonal complexes (spa-CC) were assigned where possible using Based Upon Repeat Patterns (BURP) grouping analysis from the Ridom StaphType software (version 1.4; Ridom GmbH, Würzburg, Germany). For BURP analysis, default parameters were used which allows spa types with maximum 4 genetic differences to be grouped into one cluster resulting in a calculated cost between members of a group being less than or equal to 4.

MLST

MLST was done on representative isolates from each PFGE clonal complex and selected singletons according to the protocol published by Enright et al. [25]. The PCRs were carried out as uniplex reactions consisting of 1 µM of the forward and reverse primers, 12.5 µL of 2× KAPA Taq ReadyMix (KAPA Biosystems), 2.5 mM MgCl2, 1 µL of template DNA and nuclease free water up to 25 µL. The PCR conditions were 95 °C for 5 min, followed by 30 cycles of 95 °C for 45 s, 56 °C for 45 s and 72 °C for 1 min. A final elongation step was carried out at 72 °C for 10 min. 5 µL of the PCR product was visualised with gel electrophoresis at 120 V for 1 h. Sequencing was performed on the remainder of the PCR product by Inqaba Biotechnical Industries (Pty) Ltd (Pretoria, South Africa). Sequences were inspected and trimmed in BioEdit Sequence Alignment Editor using reference sequences for each of the seven loci. A consensus sequence was generated from the forward and reverse sequences and used to generate sequence types (STs) on the S. aureus MLST database (http://www.saureus.beta.mlst.net/#). Isolates that were not typed by MLST were assigned STs using BURP analysis. Isolates with the same PFGE clonal complex and spa type were assigned the same STs. MLST clonal complexes (MLST-CC) were determined using a Java applet found at http://www.eburst.mlst.net that uses the eBURST algorithm. The default setting was used in which STs that share identical alleles at 6 or 7 of MLST loci are put in the same group. Where there was a discrepancy between the CC determined using eBURST and BURP, we considered the MLST-CC as the correct one.

Results

A total of 93 S. aureus isolates underwent PFGE. These were subsequently grouped into 19 PFGE clonal complexes (A–S) and 12 singletons. From these, 55 (32 MRSA and 23 MSSA) representative isolates from each PFGE clonal complex and all singletons were spa typed. This comprised 41 isolates from AKUHN and 14 from KEMRI. In total, there were 18 different MRSA spa types and 22 different spa types amongst the MSSA. The predominant MRSA spa type was t037 comprising 40.6 % (13/32) of all MRSA. In contrast, the MSSA were quite heterogeneous, only 2 out of 23 MSSA shared the same spa type. Two new MRSA spa types (t13149 and t13150) and 3 new MSSA spa types (t13182, t13193, t13194) were identified as shown in Table 2. Three spa types (t005, t318 and t1476) were found in both MSSA and MRSA. BURP analysis for both MSSA and MRSA revealed 7 spa-clonal complexes and 14 singletons as shown in Fig. 1. The predominant spa-CC was spa-CC005 which included the new MRSA spa type 13149. SCCmec type-III [3A] was the predominant type followed by SCCmec-IV [2B]. Only one MRSA isolate was non-typeable using the SCCmec protocol published by Milheirico et al. [24]
Table 2

Molecular characterization of methicillin susceptible and resistant Staphylococcus aureus

Isolate No.HospitalSampleID spa type spa-CCSCCmec typeMLST/spa STMLST CCPFGE CCPFGE pulsotype
36AKUHNPus swabMSSAt645sng1841a 121AA2
84AKUHNPus swabMSSAt314sng121a 121BB2
78AKUHNPus swabMSSAt355sng152a 152CC1
48AKUHNPus swabMSSAt355sng152b 152CC4
91AKUHNNasal swabMRSAt0055IV22a 22DD2
28AKUHNNasal swabMRSAt0055IV22b 22DD3
83AKUHNSputumMRSAt0055IV22b 22DD3
89AKUHNPus swabMRSAt13149d 5IVNDc DD1
22KEMRINasal swabMRSAt0225IV22a 22EE2
75AKUHNBloodMRSAt9622sngIVNDc EE1
15AKUHNPus swabMSSAt005522a 22FF6
12AKUHNPus swabMSSAt223522a 22GG2
71AKUHNPus swabMSSAt122sng30a 30HH1
88AKUHNTracheal aspirateMSSAt318sng30a 30II5
16AKUHNPus swabMSSAt0212130a 30II7
23AKUHNSputumMRSAt13393202/186UT88a 88JJ2
49KEMRINasal swabMRSAt32023202/186UTNDc JJ1
19AKUHNAxillary swabMSSAt3841sng672a 672KK2
6AKUHNNasal swabMRSAt091NF3V789a 7LL2
69AKUHNPus swabMSSAt2505NF3789a 7LL1
14AKUHNTracheal aspirateMSSAt002sng5a 5MM3
79AKUHNPus swabMRSAt13150d sngII5a 5MM2
52AKUHNBloodMSSAt2473sng72a 72NN3
92AKUHNBloodMSSAt13193d 522a 22OO1
87AKUHNBloodMSSAt127sng1a 5PP3
81AKUHNEar swabMRSAt1476NF2V8a 5QQ1
45AKUHNPus swabMSSAt1476NF28a 5QQ2
31AKUHNPus swabMSSAt064sng8a 5RR4
33KEMRINasal swabMRSAt104NF1IV8a 5RR2
7KEMRINasal swabMRSAt689NF1INDc RR1
25AKUHNBloodMRSAt8525IVNDc RR5
4AKUHNSputumMRSAt037NF4III241a 5SS1
2KEMRINasal swabMRSAt037NF4III241b 5SS10
3KEMRINasal swabMRSAt037NF4III241b 5SS10
1AKUHNBloodMRSAt037NF4III241b 5SS11
47KEMRINasal swabMRSAt037NF4III241b 5SS2
38KEMRINasal swabMRSAt037NF4III241b 5SS3
34KEMRINasal swabMRSAt037NF4III241b 5SS4
20KEMRINasal swabMRSAt037NF4III241b 5SS5
18KEMRINasal swabMRSAt037NF4III241b 5SS6
37KEMRINasal swabMRSAt037NF4III241b 5SS7
27KEMRINasal swabMRSAt037NF4III241b 5SS9
29AKUHNPus swabMRSAt2029NF4IV241a 5SS8
13AKUHNPus swabMRSAt037NF4III239/240/241c Sng12
11AKUHNPus swabMRSAt037NF4III239/240/241c Sng6
17AKUHNPus swabMSSAt13182d sngNDc Sng 3
44AKUHNUrineMSSAt13194d sngNDc Sng7
73AKUHNPus swabMSSAt1839345NDc Sng5
58AKUHNBloodMSSAt1863202/18688c Sng4
70AKUHNBloodMSSAt22434597c Sng8
21AKUHNPus swabMRSAt293sngIVNDc Sng 2
43KEMRINASAL SWABMRSAt318sngIV30c Sng 1
35AKUHNPus swabMRSAt345345VNDc Sng10
40AKUHNUrineMRSAt648NF2IVNDc Sng11
85AKUHNVulval swabMSSAt131345NDc Sng9

sng singleton, NF no founder, UT untypeable, ND not defined on the Ridom database Accessed on 07/10/2015

aMLST ST

bMLST ST extrapolated based on similar spa type and pulsotype

c spa ST

dNew spa type

Fig. 1

Based upon repeat pattern clustering analysis for all identified S. aureus isolates: the clustering analysis resulted in seven spa-clonal complexes and 14 singletons. The blue circle represents the group founder and the circle size is proportional to the frequency of the spa type

Molecular characterization of methicillin susceptible and resistant Staphylococcus aureus sng singleton, NF no founder, UT untypeable, ND not defined on the Ridom database Accessed on 07/10/2015 aMLST ST bMLST ST extrapolated based on similar spa type and pulsotype c spa ST dNew spa type Based upon repeat pattern clustering analysis for all identified S. aureus isolates: the clustering analysis resulted in seven spa-clonal complexes and 14 singletons. The blue circle represents the group founder and the circle size is proportional to the frequency of the spa type MLST STs were determined and extrapolated for 31 isolates. A total of seven different MRSA and MSSA MLST-CC were identified with the predominant one being MLST-CC 5. This clonal complex comprised STs 1, 5, 8 and 241 as shown in Table 2. An isolate belonging to ST241 (t2029) that was detected in a pus sample from AKUHN hospital was found to harbor SCCmec type IV [2B]. Out of the 16 MRSA from AKUHN, 13 were MDR including the two new spa types. Resistance was commonly seen to clindamycin, erythromycin and trimethoprim/sulfamethoxazole (TMP/SMX). A number of isolates had intermediate resistance to levofloxacin. However, two isolates were only resistant to beta lactams but susceptible to all other antibiotics including TMP/SMX as shown in Table 3. None of the MRSA was resistant to vancomycin, linezolid, mupirocin, teicoplanin or tigecycline.
Table 3

Molecular characterization and antibiotic susceptibility of MRSA isolates from AKUHN

Isolate No.Sample spa typeSCCmec typeAntibiogram
RSI
21Pus swabt293IV [2B]TOB, CLI, ERY, LEVLNZ, TEI, VAN, TET, TIG, MUP, RIF, SXT, MOX
23Sputumt1339UTSXTTOB, MOX, ERY, CLI, VAN, TET, TIG, MUP, RIF, LEV
79Pus swabt13150a II [2A]ERY, CLI, LEV, MOX, TOBTET, SXT, VAN, MUP, RIF, TIG, TEI, LNZ
40Urinet648IV [2B]ERY, CLI, TET, SXT, VAN, MUP, MOX, RIF, TIG, TOB, TEI, LNZ, LEV
25Bloodt852IV [2B]CLI#, ERYLNZ, MUP, MOX, RIF, SXT, TET, TEI, TIG, TOB, VANLEV
35Pus swabt345V [5C]RIF, SXT, TET, TOBCLI, ERY, LNZ, MUP, MOX, TEI, TIG, VANLEV
13Pus swabt037III [3A]CLI, ERY, SXT, TOBLNZ, MUP, MOX, RIF, TET, TEI, TIG, VANLEV
11Pus swabt037III [3A]CLI#, SXT, TET, TOBERY, LNZ, MUP, MOX, RIF, TEI, TIG, VANLEV
89Pus swabt13149a IV [2B]TOB, SXT, ERYCLI, LNZ, TEI, VAN, TET, TIG, MUP, RIF, LEV, MOX
75Bloodt9622IV [2B]ERY, CLI, TET, SXT, VAN, MUP, MOX, RIF, TIG, TOB, TEI, LNZLEV
83Sputumt005IV [2B]TOB, ERY, CLI# MOX, LNZ, TEI, VAN, TET, TIG, MUP, RIF, SXTLEV
28Nasal swabt005IV [2B]ERY, CLI#, TOB, LEVTET, SXT, VAN, LNZ, TEI, MUP, MOX, RIF, TIG
81Ear swabt1476V [5C]ERY, CLI#, TET, SXT, LEVVAN, MUP, MOX, RIF, TIG, TEI, LNZTOB
6Nasal swabt091V [5C]SXT, TET, TOBCLI, ERY, LNZ, MUP, MOX, RIF, TEI, TIG, VANLEV
29Pus swabt2029IV [2B]CLI, ERY, RIF, SXT, TET, TOBLNZ, MUP, MOX, TEI, TIG, VANLEV
1Bloodt037III [3A]ERY, CLI#, TET, SXT, RIF, TOB, LEVVAN, MUP, MOX, TIG, TEI, LNZ

R resistant, S susceptible, I intermediate, ERY erythromycin, CLI clindamycin, CLI inducible clindamycin resistance, TET tetracycline, SXT trimethoprim/sulfamethoxazole, VAN vancomycin, GENT gentamicin, MUP mupirocin, MOX moxifloxacin, RIF rifampicin, TIG tigecycline, TOB tobramycin, TEI teicoplanin, LNZ linezolid, LEV levofloxacin

aNew spa type

Molecular characterization and antibiotic susceptibility of MRSA isolates from AKUHN R resistant, S susceptible, I intermediate, ERY erythromycin, CLI clindamycin, CLI inducible clindamycin resistance, TET tetracycline, SXT trimethoprim/sulfamethoxazole, VAN vancomycin, GENT gentamicin, MUP mupirocin, MOX moxifloxacin, RIF rifampicin, TIG tigecycline, TOB tobramycin, TEI teicoplanin, LNZ linezolid, LEV levofloxacin aNew spa type

Discussion

This study reveals a markedly heterogeneous population of S. aureus isolates as well as the presence of well described MRSA clonal complexes 5, 22 and 30 that are responsible for several outbreaks worldwide [13, 26]. CC5 has been identified as the major clonal complex causing HA-MRSA in Africa with MRSA ST239/ST241-III [3A] having been identified in several African countries [6]. The main clonal complex in our study was CC5 that included ST 241, a single locus variant of ST 239 also known as the “Brazilian/Hungarian clone”. ST 239 and ST 239 like isolates are well-known epidemic clones responsible for several healthcare associated MRSA outbreaks globally. They have been found to be a cause of hospital acquired infections in other African countries including Algeria, Ghana, Morocco, South Africa and Nigeria [6]. A study done by Aiken et al. [17] in a public hospital that is approximately 40 km from Nairobi identified t037-ST239 as the predominant clone carried by inpatients in a surgical ward. Most of the nasal swabs in our study were obtained from children in a paediatric ward situated in a public referral hospital. The high proportion of t037-ST241 among our MRSA isolates is not necessarily reflective of the true prevalence of this spa type in Nairobi due to a selection bias in the manner in which the isolates were collected. Nevertheless, it is quite concerning that a clone known to be associated with MRSA epidemics is resident within hospitals in Nairobi indicating an urgent need for proper infection control interventions and regular surveillance. Unlike the study by Aiken et al. [17] that only found one MRSA clone, we identified 18 distinct spa types amongst the MRSA isolates belonging to very diverse sequence types, including 2 MRSA spa types (t13149 and t13150) that have not previously been described. The spa type t13150 was found to belong to ST5-II [2A] which has also been found in Nigeria and Senegal [27, 28]. We identified MRSA belonging to ST22 which in Africa has only previously been found in Algeria, Tunisia and South Africa. This clone has been widely associated with hospital epidemics especially in new born units [29]. The “West Australia MRSA-2 clone” (WA-MRSA-2), ST88-IV [2B] which has been reported in Cameroon and Madagascar was not found and the European MRSA clone ST80-IV that has been found in North African countries was not present in our collection. None of the MRSA in this study belonged to spa type t008, the prevalent spa type associated with the USA300 pulsotype that has been identified as the major cause of community acquired skin and soft tissue infections in North America [30, 31]. Although the isolates included in our study were few, they represent a fairly diverse collection from both a public and private referral hospital and we can therefore conclude that USA300 is not common in Nairobi. The 23 MSSA belonged to 22 different spa types highlighting their marked genetic diversity in contrast to the MRSA. There were 3 spa types (t005, t318 and t1476) that were found in both MSSA and MRSA suggesting the possibility of local acquisition of an SCCmec element. One of the MSSA spa types belongs to t002 which is associated with the MRSA pulsotype USA100 [16]. The spa type t064 was also found which is associated with one of the major MRSA clones (ST612- SCCmec IV [2B] found in South Africa [32]. ST241 has frequently been associated with SCCmec III [3A], however, one isolate belonging to ST241 harbored SCCmec IV [2B] (this SCCmec element was more common in AKUHN hospital). This particular clone was previously observed in a large university clinic in Nigeria [33]. SCCmec types IV and V are small in size and can be transmitted both in the community and healthcare settings. Potentially, this could result in the emergence of well-known epidemic MRSA clones like the predominant European CA-MRSA clone ST80-IV [2B] whose for bearer is thought to be a PVL-positive MSSA from sub-Saharan Africa that acquired the SCCmec IV [2B] [34]. The MSSA strain t021-ST30 has also been associated with a known PVL positive CA-MRSA clone [35]. The multi-drug resistant patterns for the MRSA in this study are in keeping with what has been described in other countries in Africa [17, 32, 36, 37]. Most of the MRSA were resistant to macrolidelincosamide, tetracycline and sulphonamide group of antibiotics which is fairly common amongst MRSA especially those that are healthcare associated. However two of the isolates showed resistance to only beta lactam antibiotics suggesting that they may be community acquired (based on their molecular structure) given that they belonged to SCCmec type IV which has been associated with CA-MRSA. The major limitation of this study is that the isolates characterized were not collected in a structured and consistent manner and as such the proportions reported do not necessarily represent a true picture of the relative distributions of different clones in Nairobi due to a selection bias. The over representation of nasal swab specimens from a paediatric population from one hospital may have exaggerated the prevalence of t037-ST 241. We also did not carry out MLST and spa typing on all isolates due to financial constraints. However, we did ensure that a representative isolate from each PFGE clonal complex was included in the isolates that were further characterized using MLST and spa typing.

Conclusion

To the best of our knowledge, this is the largest study from Kenya that has carried out PFGE, MLST, spa and SCCmec typing on a diverse collection of MRSA isolates. This study highlights the marked genetic diversity of MSSA and MRSA isolates in Nairobi including the presence of well-known epidemic MRSA clones and new MRSA spa types. Given the evolution of S. aureus over the years, there is need for continuous surveillance in order to keep track of emerging clones. The existence of epidemic MRSA clones further justifies the need to strengthen infection control measures within our hospitals so as to avoid nosocomial S. aureus infections.
  35 in total

Review 1.  Methicillin-resistant Staphylococcus aureus in the community: new battlefronts, or are the battles lost?

Authors:  B D Cookson
Journal:  Infect Control Hosp Epidemiol       Date:  2000-06       Impact factor: 3.254

2.  Survey of infections due to Staphylococcus species: frequency of occurrence and antimicrobial susceptibility of isolates collected in the United States, Canada, Latin America, Europe, and the Western Pacific region for the SENTRY Antimicrobial Surveillance Program, 1997-1999.

Authors:  D J Diekema; M A Pfaller; F J Schmitz; J Smayevsky; J Bell; R N Jones; M Beach
Journal:  Clin Infect Dis       Date:  2001-05-15       Impact factor: 9.079

3.  High genetic diversity of Staphylococcus aureus in a tertiary care hospital in Southwest Nigeria.

Authors:  Adeola Raji; Omorugho Ojemhen; Uche Umejiburu; Albert Ogunleye; Dominique S Blanc; Patrick Basset
Journal:  Diagn Microbiol Infect Dis       Date:  2013-10-11       Impact factor: 2.803

4.  Intercontinental spread of a multidrug-resistant methicillin-resistant Staphylococcus aureus clone.

Authors:  M Aires de Sousa; I S Sanches; M L Ferro; M J Vaz; Z Saraiva; T Tendeiro; J Serra; H de Lencastre
Journal:  J Clin Microbiol       Date:  1998-09       Impact factor: 5.948

Review 5.  Emergence and resurgence of meticillin-resistant Staphylococcus aureus as a public-health threat.

Authors:  Hajo Grundmann; Marta Aires-de-Sousa; John Boyce; Edine Tiemersma
Journal:  Lancet       Date:  2006-09-02       Impact factor: 79.321

Review 6.  Meticillin-resistant Staphylococcus aureus (MRSA): global epidemiology and harmonisation of typing methods.

Authors:  Stefania Stefani; Doo Ryeon Chung; Jodi A Lindsay; Alex W Friedrich; Angela M Kearns; Henrik Westh; Fiona M Mackenzie
Journal:  Int J Antimicrob Agents       Date:  2012-01-09       Impact factor: 5.283

Review 7.  Methicillin resistance in staphylococci: molecular and biochemical basis and clinical implications.

Authors:  H F Chambers
Journal:  Clin Microbiol Rev       Date:  1997-10       Impact factor: 26.132

8.  Emergence of a community-associated methicillin-resistant Staphylococcus aureus strain with a unique resistance profile in Southwest Nigeria.

Authors:  B Ghebremedhin; M O Olugbosi; A M Raji; F Layer; R A Bakare; B König; W König
Journal:  J Clin Microbiol       Date:  2009-07-01       Impact factor: 5.948

9.  MRSA in Africa: filling the global map of antimicrobial resistance.

Authors:  Matthew E Falagas; Drosos E Karageorgopoulos; John Leptidis; Ioanna P Korbila
Journal:  PLoS One       Date:  2013-07-29       Impact factor: 3.240

10.  Carriage of Staphylococcus aureus in Thika Level 5 Hospital, Kenya: a cross-sectional study.

Authors:  Alexander M Aiken; Irene M Mutuku; Artur J Sabat; Viktoria Akkerboom; Jonah Mwangi; J Anthony G Scott; Susan C Morpeth; Alexander W Friedrich; Hajo Grundmann
Journal:  Antimicrob Resist Infect Control       Date:  2014-07-15       Impact factor: 4.887

View more
  12 in total

Review 1.  Methicillin-resistant Staphylococcus aureus: an overview of basic and clinical research.

Authors:  Nicholas A Turner; Batu K Sharma-Kuinkel; Stacey A Maskarinec; Emily M Eichenberger; Pratik P Shah; Manuela Carugati; Thomas L Holland; Vance G Fowler
Journal:  Nat Rev Microbiol       Date:  2019-04       Impact factor: 60.633

2.  A six-member SNP assay on the iPlex MassARRAY platform provides a rapid and affordable alternative for typing major African Staphylococcus aureus types.

Authors:  Justin Nyasinga; Cecilia Kyany'a; Raphael Okoth; Valerie Oundo; Daniel Matano; Simon Wacira; Willie Sang; Susan Musembi; Lillian Musila
Journal:  Access Microbiol       Date:  2019-05-03

3.  Coagulase gene polymorphism, enterotoxigenecity, biofilm production, and antibiotic resistance in Staphylococcus aureus isolated from bovine raw milk in North West India.

Authors:  Vishnu Sharma; Sanjita Sharma; Dinesh Kumar Dahiya; Aarif Khan; Manisha Mathur; Aayushi Sharma
Journal:  Ann Clin Microbiol Antimicrob       Date:  2017-09-20       Impact factor: 3.944

4.  Bridging antimicrobial resistance knowledge gaps: The East African perspective on a global problem.

Authors:  Frederick K Wangai; Moses M Masika; Godfrey N Lule; Emma M Karari; Marybeth C Maritim; Walter G Jaoko; Beatrice Museve; Antony Kuria
Journal:  PLoS One       Date:  2019-02-11       Impact factor: 3.240

5.  Phenotypic and genotypic characterization of clinical Staphylococcus aureus isolates from Kenya.

Authors:  Cecilia Kyany'a; Justin Nyasinga; Daniel Matano; Valerie Oundo; Simon Wacira; Willie Sang; Lillian Musila
Journal:  BMC Microbiol       Date:  2019-11-06       Impact factor: 3.605

6.  Antimicrobial Resistance and Molecular Characteristics of Methicillin-resistant Staphylococcus aureus Isolates from Children Patients in Iran.

Authors:  Roghayeh Samadi; Zohreh Ghalavand; Reza Mirnejad; Bahram Nikmanesh; Gita Eslami
Journal:  Infect Drug Resist       Date:  2019-12-09       Impact factor: 4.003

7.  Methicillin-Resistant Coagulase-Negative Staphylococci Carriage is a Protective Factor of Methicillin-Resistant Staphylococcus Aureus Nasal Colonization in HIV-Infected Patients: A Cross-Sectional Study.

Authors:  Ying Li; Jialing Lin; Linghua Li; Weiping Cai; Jiaping Ye; Suiping He; Wencui Zhang; Ning Liu; Zijun Gong; Xiaohua Ye; Zhenjiang Yao
Journal:  Can J Infect Dis Med Microbiol       Date:  2021-01-12       Impact factor: 2.471

Review 8.  Distribution of the Most Prevalent Spa Types among Clinical Isolates of Methicillin-Resistant and -Susceptible Staphylococcus aureus around the World: A Review.

Authors:  Parisa Asadollahi; Narges Nodeh Farahani; Mehdi Mirzaii; Seyed Sajjad Khoramrooz; Alex van Belkum; Khairollah Asadollahi; Masoud Dadashi; Davood Darban-Sarokhalil
Journal:  Front Microbiol       Date:  2018-02-12       Impact factor: 5.640

Review 9.  Genetic diversity and risk factors for the transmission of antimicrobial resistance across human, animals and environmental compartments in East Africa: a review.

Authors:  Bugwesa Z Katale; Gerald Misinzo; Stephen E Mshana; Harriet Chiyangi; Susana Campino; Taane G Clark; Liam Good; Mark M Rweyemamu; Mecky I Matee
Journal:  Antimicrob Resist Infect Control       Date:  2020-08-06       Impact factor: 4.887

10.  Characterization of Antibiotic and Biocide Resistance Genes and Virulence Factors of Staphylococcus Species Associated with Bovine Mastitis in Rwanda.

Authors:  Fruzsina Irén Antók; Rosa Mayrhofer; Helene Marbach; Jean Claude Masengesho; Helga Keinprecht; Vedaste Nyirimbuga; Otto Fischer; Sarah Lepuschitz; Werner Ruppitsch; Monika Ehling-Schulz; Andrea T Feßler; Stefan Schwarz; Stefan Monecke; Ralf Ehricht; Tom Grunert; Joachim Spergser; Igor Loncaric
Journal:  Antibiotics (Basel)       Date:  2019-12-18
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.