Literature DB >> 27610278

Microsatellites in the tree Foetidia mauritiana (Lecythidaceae) and utility in other Foetidia taxa from the Mascarene Islands.

Florent Martos1, Gérard Lebreton1, Eric Rivière1, Laurence Humeau2, Marie-Hélène Chevallier1.   

Abstract

PREMISE OF THE STUDY: Polymorphic markers were required for a native tree of the Mascarene Islands, Foetidia mauritiana (Lecythidaceae), to investigate the effects of fragmentation of lowland tropical habitats on tree mating systems and on gene flow. METHODS AND
RESULTS: Using microsatellite enrichment and next-generation sequencing, we identified 13 microsatellite loci (dinucleotide repeats). They were highly polymorphic in 121 trees sampled in the largest three populations on Réunion, revealing 2-17 different alleles per locus. Furthermore, they were found to be polymorphic in conspecific populations on Mauritius and in F. rodriguesiana from Rodrigues.
CONCLUSIONS: These results indicate the utility of these markers to investigate genetic diversity, mating systems, and gene flow in a genus native to the biodiversity hotspot of Madagascar and the Indian Ocean islands.

Entities:  

Keywords:  Foetidia mauritiana; Lecythidaceae; Madagascar; ecological restoration; island biotas; tropical dry forests

Year:  2016        PMID: 27610278      PMCID: PMC5001860          DOI: 10.3732/apps.1600034

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Trees that belong to the family Lecythidaceae are often used as indicators of disturbance in lowland tropical forests, in particular because they are usually among the most common trees in these rich but fragile ecosystems (Mori et al., 2007). In addition to their ecological significance, some species may also be economically important, such as the Brazil nut tree Bertholletia excelsa Bonpl. For these reasons, polymorphic genetic markers have been developed for several species of several subfamilies of Lecythidaceae, mostly in taxa occurring as large trees in the Amazon Basin (e.g., Bertholletia Bonpl. [Reis et al., 2009], Cariniana Casar. [Guidugli et al., 2009, 2010], and Lecythis Loefl. [Rodrigues et al., 2015]), but also in a few other taxa found in the Old World (e.g., Barringtonia J. R. Forst. & G. Forst. [Xie et al., 2015]). However, to our knowledge, polymorphic markers are not yet available for the representatives of Lecythidaceae in the biodiversity hotspot formed by Madagascar and the Indian Ocean islands. Out of 18 species that make up the genus Foetidia Comm. ex Lam. (subfamily Foetidioideae), 17 are endemic to island biotas in Madagascar, the Comoros, and the Mascarene Islands, while one species is found only on the African continent in Tanzania (Prance, 2008; Labat et al., 2011). The endemic species F. mauritiana Lam. was common in drier areas of Mauritius and Réunion where precipitation is low and temperatures are high, relative to the wet conditions generally found on these two tropical islands. However, for this species as for many indigenous taxa adapted to dry tropical habitats, populations have undergone rapid decline in less than 400 years since human settlement, and those few remaining stands are left in highly fragmented landscapes on both islands. This species is considered endangered in Réunion and Mauritius. There is an urgent need to protect and restore natural communities in tropical dry habitats on the Indian Ocean islands as well as worldwide (Miles et al., 2006). A European Union–supported project, Life+ Corexrun, was launched in 2009 on Réunion; it aims at both reintroducing 48 indigenous plant species (including F. mauritiana) and controlling invasions by alien plants within and around semi-dry forest stands.

METHODS AND RESULTS

Genomic DNA of F. mauritiana was extracted with the DNeasy Plant Mini Kit (QIAGEN, Hilden, North Rhine-Westphalia, Germany). Production of a microsatellite-enriched library was outsourced to the high-throughput platform set up by Genoscreen (Lille, Nord-Pas-de-Calais-Picardie, France). Following the method described in Malausa et al. (2011), 1 μg of genomic DNA was mechanically fragmented, ligated to standard adapters (Adap-F: GTTTAAGGCCTAGCTAGCAGAATC and Adap-R: GATTCTGCTAGCTAGGCCTT), and enriched by addition of eight biotin-labeled oligoprobes corresponding to the following microsatellite motifs: (TG)n, (TC)n, (AAC)n, (AAG)n, (AGG)n, (ACG)n, (ACAT)n, and (ACTC)n. Enriched DNA was isolated using Dynabeads (Invitrogen, Waltham, Massachusetts, USA) and amplified by PCR with primers corresponding to the library adapters (PCR protocol not communicated by Genoscreen). Sequencing was carried out through 454 GS-FLX Titanium pyrosequencing (Roche Applied Science, Penzberg, Bavaria, Germany). Sequences were analyzed using the bioinformatics program QDD (Meglécz et al., 2010), which detects microsatellite sequences and designs primers in flanking regions. We then selected 13 primer pairs among the microsatellite sequences (dinucleotide repeats), because they had adequate flanking regions for designing primers (see Table 1 for locus information, primers, and GenBank accession numbers). Eight additional microsatellite loci are provided in this paper, although population testing was not conducted for these markers (Appendix 1).
Table 1.

Characteristics of 13 microsatellite loci developed in Foetidia mauritiana.

LocusPrimer sequences (5′–3′)Repeat motifAllele size range (bp)Ta (°C)GenBank accession no.
FmCIR27F: AAGGAAAAGATGCATGCCAA(CA)1479–9757KU713062
R: AGACAATTCTAAACAAGATAGGACG
FmCIR29F: CATGTGGATTCCAAAATGGC(AG)1287–9357KU713063–70
R: TTGCAATGATAATTCACCAACC
FmCIR31F: CATGAATAGGTCCCAGGCTC(CA)1386–10057KU713071
R: TATCTATGCTTGCGTGTGCG
FmCIR32F: GAAGAGCACAGAAGAACACATCA(GA)1292–9657KU713072
R: GCCACTTCTATCATCGGGAG
FmCIR43F: AGCATGACCCCTAAACCCTAA(AC)14119–14357KU713073
R: AACATGACTGTGATGGCCTAAG
FmCIR45F: GTGACTAGCTCACCAAGAGCC(GA)12132–14657KU713074
R: TTGTCCCTAACGTTTCCTTCTC
FmCIR47F: TTCTTCACTGAGTGTATTTCCATAGG(GA)12134–15657KU713075
R: TGTAAAATAGTTCCTGGACCGAC
FmCIR52F: TGCTACTCTGTGGTGTGAAAGG(AC)14144–20457KU713076
R: GCATGAACAGGCAGAACATAA
FmCIR16F: GAAAAGTCACGGTTCTTCCG(AC)15164–18157KU713061
R: TTTGGTTCGAGGATGGGTAG
FmCIR57F: TAAAATCAACAACCTAAAACACGAA(TC)12188–19657KU713077
R: TGAGATTACCCAGGAGCAGG
FmCIR61F: GAGCACATTGAAGTAGCTGGT(GA)11196–22857KU713078
R: ATTTGAGCCCTGAACCAATG
FmCIR11F: TGAAGCTCAAGCAATTGGAA(TC)13194–20857KU713058–60
R: GGGTCCGGTAGGGTACTGTT
FmCIR3F: CGATTGGCATTGGAGAAAG(AG)10286–28857KU713056–57
R: GCTCTTGCCCAAGAAGGTC

Note: Ta = annealing temperature.

Characteristics of 13 microsatellite loci developed in Foetidia mauritiana. Note: Ta = annealing temperature. For biological validation, we selected the main wild populations on Réunion. This included 49 individuals sampled near the Lataniers River (mean elevation 330 m), 45 individuals on the southern slope of the Grande-Chaloupe River (545 m), and 27 individuals near the Tamarins River (270 m), for a total of 121 individuals (sampling authorized by the Parc National de La Réunion, the Office National des Forêts, the Département de La Réunion, and the Conservatoire du Littoral). Because the species is considered critically endangered on Réunion, we harvested no more than 1–2 leaves per individual tree, with the exception of three individuals (one per locality) from which voucher specimens were made (see Appendix 2). Plant genomic DNA was isolated with the DNeasy Plant Mini Kit (QIAGEN). Multiplex PCR was performed in a total volume of 15 μL containing 7.5 μL 2× Type-it Multiplex PCR Master Mix (QIAGEN), 1.5 μL 5× Q-Solution, 0.2 μM each primer, and 20–50 ng template DNA. The thermal cycling protocol was as follows: initial denaturation at 95°C for 5 min; 28 cycles of denaturation at 95°C for 30 s, primer annealing at 57°C for 90 s, extension at 72°C for 30 s; and final extension at 60°C for 30 min. PCR products were diluted in HPLC-grade water (1: 10), denatured in formamide, and separated on a 16-capillary ABI PRISM 3130xl Genetic Analyzer (Applied Biosystems, Foster City, California, USA); GeneScan 500 LIZ (Applied Biosystems) was used for sizing alleles in the expected range of 80–300 bp. Allele sizes were estimated using the Microsatellite Plugin version 1.4 implemented in Geneious version 8.1.7 (Biomatters, Auckland, New Zealand). The number of different alleles and observed and expected heterozygosity were calculated for each locus and population in GenAlEx (Peakall and Smouse, 2006, 2012). Hardy–Weinberg exact tests (9999 iterations) and linkage disequilibrium were analyzed in GENEPOP version 4.2 (Rousset, 2008). The presence of null alleles was estimated with MICRO-CHECKER version 2.2.3 (van Oosterhout et al., 2004). The minimum number of microsatellite loci necessary to discriminate individuals of F. mauritiana was assessed using the package poppr in R software (Kamvar et al., 2015). All microsatellite loci revealed polymorphisms in F. mauritiana populations on Réunion. The number of different alleles per locus ranged from two to 17 (Table 2). Four loci showed significant deviation from Hardy–Weinberg equilibrium: FmCIR27, FmCIR47, FmCIR16, and FmCIR3. No significant linkage disequilibrium was detected between pairs of loci. We found that the minimum number of loci necessary to discriminate individuals in the data set was eight (data not shown).
Table 2.

Genetic properties of the 13 newly developed microsatellites of Foetidia mauritiana.

Grande-Chaloupe (n = 45)Lataniers (n = 49)Tamarins (n = 27)
LocusAHoHebAHoHebAHoHeb
FmCIR2780.1630.678***70.4080.695***60.4800.762***
FmCIR2940.6440.62140.5210.68340.7410.735
FmCIR3140.4890.53940.5920.58650.7410.651
FmCIR3230.5780.56030.5100.57430.6670.592
FmCIR43100.7780.752100.9180.831100.9260.783
FmCIR4550.7270.62440.590.52630.640.506
FmCIR4720.0010.044*70.1670.299***40.0370.372***
FmCIR52170.8670.886150.8570.874110.8890.845
FmCIR16100.4320.767***100.4790.808***110.6670.804*
FmCIR5750.5110.72050.6530.69040.5930.536
FmCIR61110.6440.675110.7140.65390.7780.696
FmCIR1160.5780.54860.4080.39450.4810.514
FmCIR320.0230.107***20.0200.230***20.0370.324***

Note: A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; n = number of individuals sampled.

All three populations are located on Réunion; see Appendix 2 for locality and voucher information.

Asterisks refer to significant deviations from Hardy–Weinberg equilibrium (*P < 0.05, ***P < 0.01).

Genetic properties of the 13 newly developed microsatellites of Foetidia mauritiana. Note: A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; n = number of individuals sampled. All three populations are located on Réunion; see Appendix 2 for locality and voucher information. Asterisks refer to significant deviations from Hardy–Weinberg equilibrium (*P < 0.05, ***P < 0.01). Transferability of the microsatellite loci was tested on 28 individuals of F. mauritiana and 30 individuals of F. rodriguesiana F. Friedmann sampled across Mauritius and Rodrigues, respectively (sampling authorized by the National Parks and Conservation Service of Mauritius). Conspecific populations on different islands were tested because they are expected to experience strong genetic isolation. Foetidia rodriguesiana is morphologically similar to F. mauritiana (Prance, 2008). Using the above-mentioned protocol, we found that all loci amplified in Foetidia populations found on other islands, with the exception of FmCIR31, which did not amplify in F. rodriguesiana (Table 3). Moreover, most loci were polymorphic in the Mauritius and Rodrigues populations.
Table 3.

Cross-species amplification (showing number of different alleles and size range) of the 13 newly developed microsatellites of Foetidia mauritiana.

F. mauritianaF. rodriguesiana
LocusRéunion (n = 121)Mauritius (n = 28)Rodrigues (n = 30)
FmCIR278 (79–97)1 (91)3 (97–101)
FmCIR294 (87–93)6 (85–95)3 (79–89)
FmCIR315 (86–100)3 (94–98)
FmCIR323 (92–96)3 (92–96)2 (98–102)
FmCIR4313 (119–143)5 (121–135)6 (121–133)
FmCIR455 (132–146)6 (130–146)5 (122–134)
FmCIR477 (134–156)5 (132–152)1 (134)
FmCIR5221 (144–204)6 (154–168)10 (146–184)
FmCIR1614 (164–181)8 (164–180)9 (164–182)
FmCIR575 (188–196)2 (190–192)9 (192–210)
FmCIR6113 (196–228)9 (192–222)17 (200–264)
FmCIR117 (194–208)6 (196–218)1 (200)
FmCIR32 (286–288)4 (278–288)1 (286)

Note: — = no amplification; n = number of individuals sampled.

See Appendix 2 for locality and voucher information.

Cross-species amplification (showing number of different alleles and size range) of the 13 newly developed microsatellites of Foetidia mauritiana. Note: — = no amplification; n = number of individuals sampled. See Appendix 2 for locality and voucher information.

CONCLUSIONS

We developed 13 polymorphic genetic markers for Foetidia, a widespread genus in the Indian Ocean islands biodiversity hotspot. They will aid in designing priority populations for conservation and implementing adaptive conservation plans for the genus. They may also be used to study mating systems and pollen and seed flow between lowland forest fragments.
Appendix 1.

Eight additional microsatellite loci identified in Foetidia mauritiana.

LocusPrimer sequences (5′–3′)Repeat motifAllele size (bp)
FmCIR7F: GGTAAACAGCTCAAGCCCAA(AAC)12148
R: TTATTCCGGCCAAACAACTC
FmCIR37F: AAGAAAATTCTGCCCGATTG(CT)12113
R: CACTGTTGCAAGAGGGTGAG
FmCIR38F: TTTGGAGATCCTATGTTGAGCA(TG)12116
R: AAATTTTCCCAAATTAACCCAA
FmCIR41F: CTTCCTCCCACTGTTTCTCG(CT)12127
R: TATGGCAAGGGTTTGGATGT
FmCIR48F: AAGGATAACTATCAACCTCAAGCA(AC)12144
R: ACCCTCAGGTATGTGTCAGTTT
FmCIR49F: CCATGTTTGCCCATGCAC(CA)12144
R: TGGCCGAGATGCATAATGT
FmCIR58F: TTGTCTCTGTCTAAAGTTTGTGAGG(AC)11190
R: TCGCGAAATCTTGACCATC
FmCIR68F: AGGTCAGTGCTCACCAATACAG(GA)11173
R: CCAGAAATCTCCTATCCTCTTGC

Polymorphism has not been assessed in these markers.

Appendix 2.

Voucher information for Foetidia populations used in this study.

SpeciesVoucher specimen no.aCollection localityGeographic coordinatesN
F. mauritianaCir 919Grande-Chaloupe/Cap Francis, La Possession, Réunion20°55′24.532″S, 55°23′16.63″E45
F. mauritianaCir 875Ravine des Lataniers, La Possession, Réunion20°56′41.467″S, 55°20′56.857″E49
F. mauritianaCir 936Ravine des Tamarins, Saint-Denis, Réunion20°53′50.798″S, 55°23′1.33″E27
F. mauritianaBlack River Gorges National Park, Mauritius20°23′53.467″S, 57°25′32.564″E11
F. mauritianaChamarel, Black River, Mauritius20°25′4.843″S, 57°23′10.731″E8
F. mauritianaDomaine du Chasseur National Park, Anse Jonchée, Mauritius20°20′46.128″S, 57°45′23.91″E7
F. mauritianaBras d’Eau National Park, Mauritius20°8′42.781″S, 57°43′35.767″E2
F. rodriguesianaAnse Quitor Nature Reserve, Rodrigues19°45′18.9″S, 63°22′10.599″E5
F. rodriguesianaGraviers, Rodrigues19°43′57″S, 63°28′38.099″E5
F. rodriguesianaMourouk, Rodrigues19°44′13.7″S, 63°27′40.499″E5
F. rodriguesianaMont Malgache, Rodrigues19°43′40.598″S, 63°27′21.099″E5
F. rodriguesianaGrande Montagne, Rodrigues19°42′14.501″S, 63°27′56.699″E4
F. rodriguesianaBaie Malgache, Rodrigues19°43′39.299″S, 63°23′24.399″E1
F. rodriguesianaRivière Cascade Victoire, Rodrigues19°43′49.4″S, 63°26′59.798″E1
F. rodriguesianaCaverne Provert, Rodrigues19°40′26.4″S, 63°26′25.299″E1
F. rodriguesianaCrève-coeur, Rodrigues19°40′43.201″S, 63°25′47.499″E1
F. rodriguesianaGrande Baie, Rodrigues19°40′57.202″S, 63°26′57.001″E1
F. rodriguesianaSolitude, Rodrigues19°41′37″S, 63°26′15.399″E1

Note: N = number of individuals.

Vouchers for the F. mauritiana populations collected in Réunion were deposited at Université de la Réunion (REU). Vouchers were not collected for the F. mauritiana populations sampled in Mauritius and the F. rodriguesiana populations sampled in Rodrigues per agreements with local authorities to collect DNA samples only.

  9 in total

1.  Evolution of Lecythidaceae with an emphasis on the circumscription of neotropical genera: information from combined ndhF and trnL-F sequence data.

Authors:  Scott A Mori; Chi-Hua Tsou; Chi-Chih Wu; Bodil Cronholm; Arne A Anderberg
Journal:  Am J Bot       Date:  2007-03       Impact factor: 3.844

2.  QDD: a user-friendly program to select microsatellite markers and design primers from large sequencing projects.

Authors:  Emese Meglécz; Caroline Costedoat; Vincent Dubut; André Gilles; Thibaut Malausa; Nicolas Pech; Jean-François Martin
Journal:  Bioinformatics       Date:  2009-12-10       Impact factor: 6.937

3.  High-throughput microsatellite isolation through 454 GS-FLX Titanium pyrosequencing of enriched DNA libraries.

Authors:  Thibaut Malausa; André Gilles; Emese Meglécz; Hélène Blanquart; Stéphanie Duthoy; Caroline Costedoat; Vincent Dubut; Nicolas Pech; Philippe Castagnone-Sereno; Christophe Délye; Nicolas Feau; Pascal Frey; Philippe Gauthier; Thomas Guillemaud; Laurent Hazard; Valérie Le Corre; Brigitte Lung-Escarmant; Pierre-Jean G Malé; Stéphanie Ferreira; Jean-François Martin
Journal:  Mol Ecol Resour       Date:  2011-02-21       Impact factor: 7.090

4.  genepop'007: a complete re-implementation of the genepop software for Windows and Linux.

Authors:  François Rousset
Journal:  Mol Ecol Resour       Date:  2008-01       Impact factor: 7.090

5.  Development and characterization of microsatellite markers for the Brazil nut tree Bertholletia excelsa Humb. & Bonpl. (Lecythidaceae).

Authors:  Alessandra M M Reis; Aline C Braga; Maristerra R Lemes; Rogério Gribel; Rosane G Collevatti
Journal:  Mol Ecol Resour       Date:  2009-01-22       Impact factor: 7.090

6.  GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research--an update.

Authors:  Rod Peakall; Peter E Smouse
Journal:  Bioinformatics       Date:  2012-07-20       Impact factor: 6.937

7.  Genetic characterization of 12 heterologous microsatellite markers for the giant tropical tree Cariniana legalis (Lecythidaceae).

Authors:  Marcela Corbo Guidugli; Klaus Alvaro Guerrieri Accoroni; Moacyr Antonio Mestriner; Eucleia Primo Betioli Contel; Carlos Alberto Martinez; Ana Lilia Alzate-Marin
Journal:  Genet Mol Biol       Date:  2010-03-01       Impact factor: 1.771

8.  Novel R tools for analysis of genome-wide population genetic data with emphasis on clonality.

Authors:  Zhian N Kamvar; Jonah C Brooks; Niklaus J Grünwald
Journal:  Front Genet       Date:  2015-06-10       Impact factor: 4.599

9.  Development of EST-SSR markers in Barringtonia racemosa (Lecythidaceae) and cross-amplification in related species.

Authors:  Hongxian Xie; Yang Yuan; Xiaoting Fang; Ying Liu; Chao Yang; Jianhua Jin; Fengxiao Tan; Yelin Huang
Journal:  Appl Plant Sci       Date:  2015-12-04       Impact factor: 1.936

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.