cDNA-AFLP analysis reveals differential gene expression in incompatible interaction between infected non-heading Chinese cabbage and Hyaloperonospora parasitica.

Non-heading Chinese cabbage (Brassica rapa ssp. chinensis) is one of the main green leafy vegetables in the world, especially in China, with significant economic value. Hyaloperonospora parasitica is a fungal pathogen responsible for causing downy mildew disease in Chinese cabbage, which greatly affects its production. The objective of this study was to identify transcriptionally regulated genes during incompatible interactions between non-heading Chinese cabbage and H. parasitica using complementary DNA-amplified fragment length polymorphism (cDNA-AFLP). We obtained 129 reliable differential transcript-derived fragments (TDFs) in a resistant line 'Suzhou Qing'. Among them, 121 upregulated TDFs displayed an expression peak at 24-48 h post inoculation (h.p.i.). Fifteen genes were further selected for validation of cDNA-AFLP expression patterns using quantitative reverse transcription PCR. Results confirmed the altered expression patterns of 13 genes (86.7%) revealed by the cDNA-AFLP. We identified four TDFs related to fungal resistance among the 15 TDFs. Furthermore, comparative analysis of four TDFs between resistant line 'Suzhou Qing' and susceptible line 'Aijiao Huang' showed that transcript levels of TDF14 (BcLIK1_A01) peaked at 48 h.p.i. and 25.1-fold increased in the resistant line compared with the susceptible line. Similarly, transcript levels of the other three genes, TDF42 (BcCAT3_A07), TDF75 (BcAAE3_A06) and TDF88 (BcAMT2_A05) peaked at 24, 48 and 24 h.p.i. with 25.1-, 100- and 15.8-fold increases, respectively. The results suggested that the resistance genes tended to transcribe at higher levels in the resistance line than in the susceptible line, which may provide resistance against pathogen infections. The present study might facilitate elucidating the molecular basis of the infection process and identifying candidate genes for resistance improvement of susceptible cultivars.

Introduction

It is well known that plant–pathogen interactions activate a subset of pathogen genes so-called systemic acquired resistance to protect themselves.[1-3] This interaction process is diverse and complicated because plant pathogens have evolved by developing various strategies to infect their hosts. Specific pathogen may trigger defense systems that are essential for pathogenicity. Next, molecular responses are up- or downregulations by numerous specific resistant genes. During the development of interaction, the recognition of specific host genes determines whether the interaction will be successful.

Downy mildew is an important fungal disease of Brassica specie that is caused by the obligatory biotrophic oomycete Hyaloperonospora parasitica (formerly Peronospora parasitica (Pers. Ex Fr.)), and infects most members of the Brassica family.[4] It can be fatal to seedling growth in the nurseries and reduce the productivity and quality of adult plants in the field.[4] Leaves become yellow after infection and then scorch. When downy mildew became epidemic, it can cause damage to >90% of the crop. The disease is more severe in spring and autumn seasons than in other seasons. Currently, the downy mildew disease is controlled by application of fungicides.[5] However, chemical control is often difficult and ineffective. It has been proved that the most efficient way to manage plant diseases is to develop a host resistance in new cultivars.[5] Therefore, to identify the host resistant genes is a crucial need for obtaining reliable resistant genotypes to assist plant breeding. Previous studies have shown some differentially expressed genes during infection process using various methods.[6,7] The differential display-based strategy has been used to reveal genes related to downy mildew infection in B. oleracea seedlings.[6] Suppression subtractive hybridization technology has been employed and revealed 37 high-quality Expressed Sequence Tags (ESTs), of which functions are known in energy metabolism, transcriptional regulation, signal transduction and defense reaction.[7] However, most molecular components of the signal transduction pathway involved in gene regulation remain to be identified.

Furthermore, there is no report on pathogen virulence genes matching the resistance genes of non-heading Chinese cabbage (Brassica rapa ssp. chinensis), and their inheritance remains uncertain. In this prospect, it is important to elucidate the molecular mechanisms or gene expression profile and to identify an inventory of candidate genes during the non-heading Chinese cabbage–H. parasitica interaction.

Screening for differentially expressed genes is a direct approach to reveal the molecular basis of a biological system. The complementary DNA-amplified fragment length polymorphism (cDNA-AFLP) method has been successfully used for the identification of genes involved in various plant–pathogen systems.[8,9] In comparison with microarray technique and RNA sequencing, cDNA-AFLP costs less and does not require sequence information. When compared with subtractive hybridization, cDNA-AFLP is highly reproducible.[8]

The objectives of this study were to apply the cDNA-AFLP technique to the pathogenic interaction between non-heading Chinese cabbage and downy mildew. We identified a set of genes that were regulated during the incompatible interaction between the host and pathogen, and validated the expression patterns for the regulated genes.

Materials and methods

Plant material, inoculums and pathogen infection

Two non-heading Chinese cabbage inbred lines, ‘Suzhou Qing’ (resistant to H. parasitica) and ‘Aijiao Huang’ (susceptible to H. parasitica) from our lab, were used in this study. The transcript-derived fragments (TDFs) were obtained from interaction between ‘Suzhou Qing’ and downy mildew (H. parasitica). ‘Aijiao Huang’ was used for the comparison of expression patterns of the four genes related with fungal resistance between resistant and susceptible line.

Plants were grown in plastic nurseries (inner size: 45×45 mm; height: 57 mm) and transferred to a growth chamber under 25 °C day/ 20 °C night temperature with 85±5% relative humidity and a 12-h light/12-h dark after germination for 36 h under dark. H. parasitica was isolated from leaves of susceptible line ‘Aijiao Huang’ in the Jiangpu Farm of Nanjing Agricultural University, China.[10] Conidial suspensions were adjusted to 1×105 spores per mL and Tween-20 was added as a surfactant to a final concentration of 0.1%. One hundred of 3-week-old seedlings (with four true-leaves) were sprayed with 50 mL pathogen suspension and distilled water (as control), respectively. After inoculation, the seedlings were covered with plastic film separately and transferred to a growth chamber under 20 °C, 100% relative humidity in the dark for the first 24 h to promote sporulation, then moved back to the initiatory conditions. Both control and treated third leaf of five plants were harvested and pooled at 0, 24, 48 and 72 h post inoculation (h.p.i.), immediately frozen in liquid nitrogen and stored at −70 °C until use.

RNA isolation and cDNA-AFLP analysis

Total RNAs were extracted using the RNAeasy Plant Mini kit (Qiagen; https://www.qiagen.com/cn/shop/sample-technologies/rna/rna-preparation/rneasy-mini-kit#orderinginformation) and synthesis of the first strand of cDNA is made using the M-MLV reverse transcriptase (Takara Shuzo Co., Ltd, Japan) according to the manufacturer’s protocol. To synthesize the second strand, the following components were added to the first-strand solution. A volume of 30 μL, 5×2nd strand synthesis buffer, 3 μL dNTP mixture, 89 μL RNase-free H2O, 2 μL Escherichia coli DNA polymerase I, 2 μL E. coli RNase H/E. coli DNA ligase mixture and 4 μL T4 DNA polymerase in a final volume of 150 μL. The components were gently mixed and incubated at 16 °C for 2 h. Double-stranded cDNA was purified using the DNA Fragment Purification Kit Ver.2.0 (Takara).

Second-strand cDNA was digested by two restriction enzymes Tag І (restriction site TCGA) and Ase І (restriction site ATTAAT; Takara), and then ligated to Tag І and Ase І double-strand adaptors. The AFLP adaptor primers 5′-GACGATGAGTCCTGAC-3′, 5′-CGGTCAGGACTCAT-3′ (Taq I-adaptor primers) and 5′-GCGTAGACTGCGTACC-3′, 5′-TAGGTACGCAGTC-3′ (Ase І-adaptor primers) were ligated onto the restriction fragments: Taq I pre-amplification primer, 5′-GACGATGAGTCCTGACCGA-3′; Ase I pre-amplification primer, 5-CTCGTAGACTGCGTACCTAAT-3′; Taq I selective amplification primer, 5′-GATGAGTCCAGACCGA+NN-3′; Ase I selective amplification primer, 5′-GACTGCGTACCTAAT+NN-3′ (indicated by N, representing an A, C, G or T). The initial small-scale screen using 96 AFLP primer combinations were done using six Taq I forward selective amplification primers (extension CG, CA, CT, CC, GA or GT) in combination with 16 Ase I reverse selective amplification primers (extension NN), respectively. Pre-amplification PCR was carried out with one-tenth volume of the restriction/ligation mix, the pre-amplification PCR was carried out as follows: 94 °C, 3 min; 94 °C, 30 s, 55 °C, 30 s, 72 °C, 60 s, 25 cycles; and 72 °C, 5 min. The products of pre-amplification was diluted 10-fold, and the selective amplification PCR was carried out as follows: 94 °C, 30 s; 94 °C, 30 s, 65 °C, 30 s (−0.7 °C per cycle), 72 °C, 60 s, 12 cycles; 94 °C, 30 s, 56 °C, 30 s, 72 °C, 60 s, 24 cycles; and 72 °C, 5 min.

Selective amplification products were separated on a 6% polyacrylamide gels running at 60 W for 2 h and visualized by silver staining. Differential bands were excised from the polyacrylamide gel electrophoresis gels based on the alignment between films and markers on the gels, and incubated in 30 μL of water and then at 95 °C for 30 min. The TDFs were then re-amplified by PCR using same primers under the similar conditions. The amplified fragments were retrieved from a 1% agarose gel with the Sephaglas BandPrep kit (Amersham Pharmacia Biotech.), cloned into pGEM-T Easy vector (Takara) according to the manufacturer's protocol and sequenced by Invitrogen Company (Shanghai BioWisdom Technology Co, Ltd; Shanghai, China. http://en.cellfood.com.cn/culture.aspx), and sequence information was BLASTed in the Brassica database (http://).

Quantitative real-time PCR

The single-strand cDNA of resistant line ‘Suzhou Qing’ and susceptible line ‘Aijiao Huang’ were diluted to 30 ng μL−1, and were used for quantitative reverse transcription PCR (qRT-PCR) analyses. Primers were designed by the Primers 3 (http://frodo.wi.mit.edu/primer3/) based on the interested cDNA sequence. The qRT-PCR reaction mixtures contained 12.5 μL, 2× SYBR Green PCR MasterMix (Applied Biosystems; http://www.bio-rad.com/), 10 pm of each primer, 2 μL template and sterile distilled water to total volume of 25 μL, as well as also performed on CFX96 Real-Time System (C1000 Thermal Cycler, Bio-Rad, CA, USA). Thermal conditions were 2 min of denaturation at 95 °C, followed by 45 cycles of 95 °C for 10 s, annealing at 55 °C for 20 s, and extension at 72 °C for 20 s and 72 °C for 5 min. Three technical replicates were analysed for each biological replicate. All the cycle threshold (Ct) values from one gene were determined at the same threshold fluorescence value of 0.2 using the ΔΔCt method.[11] The primers of gene-specific and housekeeping gene were listed in Table 1.

Table 1

Primers and reference sequence used in qRT-PCR analysis

Functional categories	TDFs number	Gene	Sequence 5′–3′ (forward )	Sequence 5′–3′ (reverse)
D	TDF1	BcASN1_A06	TTCCTTCTACGCCTTATG	GAATCAAGACCACCAGAT
D	TDF7	BcCHS_A10	TGTGTTCTCTTCATATTGGA	CACTGTCTCTACGGTAAG
D	TDF11	BcTPI_A04	CTCAAGTTCCTTCACAAGA	AGTTCACAAGCATCTCAG
D	TDF14	BcLIK1_A01	CCTCCTCGTCTCTATCAT	ATTCCAGTTAGTCTTCTTCAA
ST	TDF42	BcCAT3_A07	GTCCACACCTACACTCTA	CAACTACCTTAGCCTCTTC
ST	TDF49	BcCCS_A08	TTCCTCATCTTCCTCTACTA	CACACTTCATATCCACCAT
ST	TDF58	BcNIT2_A02	GCTTCCACTGTCTATAATGA	CTATGCCGAACCTATATCC
ST	TDF59	BcRLK5_A01	TCATTCACATTGGTCTTCT	CACATAGTAAGGCGAGAG
ST	TDF60	BcKEG_A03	GCCTTACACCGTTACATA	TTATAGCAGCAGCCATAC
ST	TDF63	BcSAMDC_A03	GCCTTACACCGTTACATA	TTATAGCAGCAGCCATAC
EM	TDF75	BcAAE3_A06	CCTCCGTCAACAACATTA	GGCGTCATACTTCTTCAT
EM	TDF76	BcLHCB1.1_A07	GTTGAAGGTGAAGGAGAT	AATGGTCAGCAAGATTCT
EM	TDF88	BcAMT2_A05	ACATTAGCGGTATTCTACA	GACACTACATTCCAGACA
R	TDF91	BcABCG36_A07	TTGATGCTGATGAAGAGA	GGTGGCTGGATTATACTT
R	TDF101	BcSIG1_A08	GTCTTCTTCCTCAGTTCA	TAATCTTCGCCACATCAA
Reference	β-actin		GTTGCTATCCAGGCTGTTCT	AGCGTGAGGAAGAGCATAAC

Abbreviations: D, defense; ST, signal transduction; EM, energy metabolism; R, regulation; qRT-PCR, quantitative reverse transcription PCR.

Statistical analysis was performed using Student’s t-test.

Results

Isolation of differentially expressed genes

To determine the early events involved during the non-heading Chinese cabbage–H. parasitica interactions, four gene pools were constructed from resistant inbred line ‘Suzhou Qing’ at 0, 24, 48 and 72 h.p.i., respectively. TDFs displayed by cDNA-AFLP analysis ranged in size from 100 to 800 bp, depending on 96 selective primer combinations and time points. Figure 1 showed an example of the expression patterns of the genes revealed using cDNA-AFLP. A total of 180 fragments were obtained with the 96 primer pairs. After excluding repeat and error sequences, 129 TDFs were obtained. Of the 129 TDFs, 121 were upregulated and 8 downregulated. Of the 121 TDFs upregulated, 35 (28.9%), 31 (25.6%) and 4 (3.3%) TDFs were induced strongly at 24, 48 and 72 h.p.i., respectively; 12 (9.9%) and 2 (1.7%) TDFs were induced at 24 and 48 h.p.i., and 48 and 72 h.p.i., respectively. These results showed that non-heading Chinese cabbage has mainly accumulated expression at 24–48 h.p.i. and that gene expression patterns were different and complex after H. parasitica infection.

Figure 1

Expression of non-heading Chinese cabbage ‘Suzhou Qing’ genes in leaves inoculated with H. parasitica transcripts was displayed by cDNA-AFLP. An example showing that land 1, 2, 3 and 4 represents the induction time 0, 24, 48 and 72 h.p.i., respectively. The size of the differential TDFs was determined by direct sequencing. Arrow: differential bands.

Gene sequence analysis

By BLASTn search on Brassica database, 129 TDFs were successfully annotated (Table 2). One hundred and sixteen TDFs (90%) of the 129 TDFs can be divided into six functional categories, including defense (D), signal transduction (ST), energy metabolism (EM), regulation (R), protein–protein interaction (PI), others (O) and unknown (Un; Figure 2). Forty-one TDFs (31.8%) of the annotated sequences were associated with defense. Among them, four TDFs were associated with the pathogenesis-related protein, include β-1,3-glucanase (TDF3), hapless 8 (TDF8), pathogenesis-related protein (TDF28) and thaumatin-like protein (TDF16), and others had hypersensitive-induced response protein (TDF22), mannose-binding lectin superfamily protein (TDF23), respiratory burst oxidase protein (TDF13) and so on. Thirty-two TDFs (24.8%) were involved in signal transduction, for example, a member of the BEL family of homeodomain proteins (TDF49), catalase (TDF42), calcium ion binding (TDF48) and so on. Followed that, 19 TDFs (14.7%) mainly involved in regulation, including ATP-binding cassette G36 (TDF91), heat-shock cognate protein (TDF102) and so on. Fifteen TDFs (11.7%) were mainly involved in energy metabolism, for example, TDF81 was predicted to involve in Arabidopsis thaliana photosynthetic electron transfer chain. Four TDFs (3.1%) and five TDFs (3.9%) were involved in protein–protein interaction and others metabolic pathways, respectively. These genes might function to protect cells from the fungal pathogen in non-heading Chinese cabbage. No function was assigned to 13 (10.0%) of the TDFs as they showed no or low sequence similarities in the Brassica database search. In conclusion, gene expression patterns are more complex after infection and involved in many different metabolic pathways. It indicates that it is the common effect of these different metabolic pathways that improved the plant resistance to fungus, thereby reducing the hypersensitive response (HR) in resistance line against fungus pathogen.

Table 2

Homology of obtained TDFs in the non-heading Chinese cabbage–H. parasitica interaction

TDF no.	Accession number	Length (bp)	A. thaliana	Gene name in Arabidopsis	Gene name in B. rapa	Gene name in B. campestris ssp. chinensis	Functional categories	0 h	24 h	48 h	72 h
1	AB474661	302	AT3G47340	ASN1	Bra018160	BcASN1_A06	D	—	X	x	x
2	AB474690	202	AT1G33970	AT1G33970	Bra028016	AT1G33970_A09	D	—	x	X	x
3	AB474678	149	AT3G57260	PR2	Bra014636	BcBG3_A04	D	—	x	X	x
4	AB474674	313	AT1G52400	ATBG1	Bra018969	BcATBG1_A06	D	x	X	x	x
5	AB474696	127	AT1G55490	CPN60B	Bra011919	BcCPN60B_A07	D	—	x	x	x
6	AB474682	297	AT1G02305	AT1G02305	Bra030498	AT1G02305_A08	D	—	x	x	x
7	AB474660	221	AT5G13930	CHS	Bra008792	BcCHS_A10	D	—	x	X	x
8	AB474679	122	AT5G56250	HAP8	Bra003169	BcHAP8_A07	D	—	x	x	x
9	AB474688	80	AT1G08400	AT1G08400	Bra018627	AT1G08400_A06	D	—	x	x	x
10	AB474667	228	AT2G16600	ROC3	Bra037296	BcROC3_A09	D	—	x	x	x
11	AB474666	441	AT3G55440	TPI	Bra014743	BcTPI_A04	D	—	x	X	x
12	AB474665	132	AT1G01040	ASU1	Bra033293	BcASU1_A10	D	x	x	X	x
13	AB474676	326	AT2G03820	NMD3	Bra040033	BcNMD3_A01	D	—	x	x	x
14	AB474643	304	AT3G14840	LIK1	Bra021579	BcLIK1_A01	D	—	x	X	x
15	AB474693	293	AT2G47070	SPL1	Bra041037	BcSPL1_Scaffold000403	D	—	x	x	x
16	FJ605478	954	AT1G18250	ATLP-1	Bra025923	BcATLP-1_A06	D	—	x	x	x
17	AB474697	223	AT1G60950	FD2	Bra031471	BcFD2_A01	D	—	x	x	x
18	AB474681	204	AT1G08540	SIG1	Bra030732	BcSIG1_A08	D	—	x	x	x
19	AB474684	160	AT3G60120	BGLU27	Bra004840	BcBGLU27_A05	D	—	x	x	x
20	AB474664	383	AT2G41480	PRX25	Bra000228	BcPRX25_A03	D	—	x	x	x
21	AB474689	265	AT1G18360	AT1G18360	Bra016558	AT1G18360_A08	D	—	x	x	x
22	AB474694	119	AT3G01290	HIR2	Bra039130	BcHIR2_A05	D	—	x	x	x
23	AB474671	204	AT1G52120	AT1G52120	Bra018940	AT1G52120_A06	D	—	x	x	x
24	AB474685	258	AT5G42870	PAH2	Bra027461	BcPAH2_A09	D	—	x	x	x
25	AB474659	100	AT2G23760	BLH4	Bra032147	BcBLH4_A04	D	—	x	x	x
26	AB474677	100	AT1G25540	MED25	Bra038087	BcMED25_A08	D	—	—	x	x
27	AB474686	67	AT3G14210	ESM1	Bra027359	BcESM1_A05	D	x	X	x	x
28	AB474683	126	AT2G14580	PRB1	Bra013123	BcPR1_A03	D	—	x	x	x
29	AB474662	138	AT3G27310	PUX1	Bra025265	BcPUX1_A06	D	—	—	x	—
30	AB474669	112	AT2G35100	ARAD1	Bra023001	BcARAD1_A03	D	—	x	x	x
31	AB474663	255	AT5G63110	HDA6	Bra035858	BcHDA6_A09	D	—	—	x	—
32	AB474695	150	AT3G04790	EMB3119	Bra040120	BcEMB3119_A01	D	—	X	X	x
33	AB474658	80	AT4G34850	LAP5	Bra011566	BcLAP5_A01	D	—	x	x	x
34	AB474687	363	AT5G67360	ARA12	Bra037113	BcARA12_A09	D	—	x	x	x
35	AB474668	183	AT5G58070	TIL	Bra006784	BcTIL_A03	D	—	x	x	x
36	AB474691	263	AT3G16560	AT3G16560	Bra022166	AT3G16560_A05	D	X	x	x	x
37	AB474675	336	AT5G38430	RBCS1B	Bra028181	BcRBCS1B_A04	D	—	x	x	X
38	AB439291	556	AT1G54410	ATHIRD11	Bra013206	BcATHIRD11_A03	D	x	X	x	x
39	AB439836	528	AT3G09390	ATMT-1	Bra029765	BcATMT-1_A05	D	—	x	X	x
40	AB474649	315	AT5G44790	RAN1	Bra025102	BcRAN1_A06	D	x	X	x	x
41	AB474717	316	AT5G53300	UBC10	Bra022645	BcUBC10_A02	D	—	x	x	x
42	AB474628	266	AT1G20620	CAT3	Bra012238	BcCAT3_A07	ST	—	X	X	x
43	AB495004	917	AT5G06290	2CPB	Bra009181	Bc2CPB_A10	ST	x	x	X	x
44	AB474632	843	AT1G12520	CCS	Bra016768	BcCCS_A08	ST	x	x	x	x
45	AB474627	239	AT5G56500	CPN60BETA3	Bra028922	BcCPN60BETA3_A03	ST	—	x	X	x
46	AB474645	121	AT5G18020	SAUR20	Bra026598	BcSAUR20_A02	ST	—	x	x	x
47	AB474656	264	AT4G28080	AT4G28080	Bra024230	AT4G28080_A03	ST	—	X	x	x
48	AB474629	140	AT3G56800	CAM3	Bra014671	BcCAM3_A04	ST	—	X	x	x
49	AB474632	843	AT1G12520	CCS	Bra016768	BcCCS_A08	ST	—	—	X	x
50	AB474637	266	AT4G39220	ATRER1A	Bra010695	BcATRER1A_A08	ST	—	—	x	x
51	AB474646	136	AT2G33150	PKT3	Bra005522	BcPKT3_A05	ST	—	x	X	x
52	AB474648	128	AT5G13650	SVR3	Bra008811	BcSVR3_A10	ST	—	x	X	x
53	AB474647	252	AT2G31060	EMB2785	Bra021694	BcEMB2785_A04	ST	—	X	X	x
54	AB474635	638	AT4G00700	AT4G00700	Bra000963	AT4G00700_A03	ST	—	X	X	x
55	AB474640	95	AT2G01400	AT2G01400	Bra026670	BcAT2G01400_A02	ST	—	—	x	—
56	AB474652	160	AT4G26240	AT4G26240	Bra019116	AT4G26240_A03	ST	—	x	x	x
57	AB474657	224	AT3G63070	HULK3	Bra040426	BcHULK3_A04	ST	—	—	x	X
58	AB474655	186	AT3G44300	NIT2	Bra023598	BcNIT2_A02	ST	X	x	x	x
59	AB474634	267	AT4G28490	RLK5	Bra011033	BcRLK5_A01	ST	—	X	x	x
60	AB474641	226	AT5G13530	KEG	Bra006205	BcKEG_A03	ST	X	x	x	x
61	AB474633	231	AT2G22260	ALKBH2	Bra038536	BcALKBH2_A09	ST	—	x	x	—
62	AB474639	166	AT4G13940	MEE58	Bra032750	BcMEE58_A04	ST	x	x	X	x
63	AB474638	306	AT3G02470	SAMDC	Bra001046	BcSAMDC_A03	ST	X	x	x	x
64	AB474651	405	AT3G55800	SBPASE	Bra007192	BcSBPASE_A09	ST	—	—	x	x
65	AB474636	736	AT4G32200	ASY2	Bra039766	BcASY2_A01	ST	—	—	x	x
66	AB474630	369	AT5G16070	AT5G16070	Bra006338	AT5G16070_A03	ST	—	X	X	x
67	AB474654	236	AT4G21450	AT4G21450	Bra013528	AT4G21450_A01	ST	—	X	x	x
68	AB474650	180	AT4G31800	WRKY18	Bra023983	BcWRKY18_A03	ST	x	X	x	x
69	AB474714	291	AT3G22650	AT3G22650	Bra005858	AT3G22650_A03	ST	—	x	x	x
70	AB474715	199	AT1G47210	CYCA3;2	Bra040753	BcCYCA3;2_Scaffold000249	ST	—	X	X	x
71	AB474720	188	AT2G33800	EMB3113	Bra021879	BcEMB3113_A04	ST	—	x	x	x
72	AB474716	126	AT5G42220	AT5G42220	Bra027974	AT5G42220_A09	ST	—	—	x	x
73	AB474644	121	AT2G33620	AHL10	Bra021865	BcAHL10_A04	ST	—	x	x	x
74	AB474713	129	AT3G15290	AT3G15290	Bra027263	AT3G15290_A05	EM	—	X	X	x
75	AB474703	127	AT3G48990	AAE3	Bra018019	BcAAE3_A06	EM	—	x	X	x
76	AB474710	384	AT1G29920	LHCB1.1	Bra010807	BcLHCB1.1_A07	EM	X	x	x	x
77	AB474711	405	AT1G29920	CAB2	Bra010807	BcCAB2_A08	EM	x	x	x	x
78	AB474704	150	AT3G45190	AT3G45190	Bra038298	AT3G45190_A10	EM	X	x	x	x
79	AB474705	427	AT4G18760	RLP51	Bra040730	BcRLP51_A06	EM	—	x	x	—
80	AB474702	150	AT5G18800	AT5G18800	Bra002186	AT5G18800_A10	EM	—	x	x	x
81	AB474709	266	AT4G03280	PGR1	Bra000837	BcPGR1_A03	EM	—	x	—	x
82	AB474708	75	AT3G16560	AT3G16560	Bra022166	AT3G16560_A05	EM	X	x	x	x
83	AB474706	222	AT5G47910	RBOHD	Bra020724	BcRBOHD_A02	EM	—	x	x	x
84	AB474712	239	AT5G38430	RBCS1B	Bra028181	BcRBCS1B_A04	EM	—	X	x	x
85	AB439290	733	AT5G38430	RBCS1B	Bra028174	BcRBCS1B_A04	EM	—	X	x	x
86	AB474707	53	AT3G60750	TKL1	Bra007555	BcTKL1_A09	EM	—	—	x	x
87	AB474626	190	AT5G36880	ACS	Bra030286	BcACS_A04	EM	—	x	X	x
88	AB474613	210	AT2G38290	AMT2	Bra005125	BcAMT2_A05	EM	—	X	x	x
89	AB474614	169	AT2G33150	PKT3	Bra022927	BcPKT3_A03	R	—	—	x	x
90	AB474609	106	AT4G00810	AT4G00810	Bra037409	AT4G00810_A09	R	—	x	—	—
91	AB474616	349	AT1G59870	ABCG36	Bra003527	BcABCG36_A07	R	X	x	x	x
92	AB474621	144	AT4G34970	ADF9	Bra017683	BcADF9_A03	R	—	x	x	x
93	AB474610	140	AT3G23240	ERF1	Bra023744	BcERF1_A01	R	—	x	x	x
94	AB474624	310	AT3G55360	GLH6	Bra007154	BcGLH6_A09	R	—	x	x	x
95	AB474619	211	AT4G27640	AT4G27640	Bra026329	AT4G27640_A01	R	—	x	x	x
96	AB474612	119	AT1G35160	14-3-3PHI	Bra028068	Bc14-3-3PHI_A09	R	—	x	X	X
97	AB439837	1062	AT1G01050	PPA1	Bra033292	BcPPA1_A10	R	x	—	x	x
98	AB474615	230	AT5G14400	CYP724A1	Bra023464	BcCYP724A1_A02	R	—	x	x	x
99	AB474718	200	AT3G62310	AT3G62310	Bra007671	AT3G62310_A09	R	—	X	X	x
100	AB495003	1418	AT4G11260	EDM1	Bra035239	BcEDM1_A09	R	x	X	x	x
101	AB474611	393	AT1G08540	SIG1	Bra030732	BcSIG1_A08	R	—	X	X	x
102	AB474719	173	AT5G02500	AT-HSC70-1	Bra009584	BcAT-HSC70-1_A10	R	—	x	x	x
103	AB474622	429	AT5G64940	ATH13	Bra024339	BcATH13_A06	R	—	X	x	x
104	AB474623	218	AT5G54770	THI4	Bra022742	BcTHI4_A02	R	—	X	x	x
105	AB474625	150	AT3G55360	GLH6	Bra007154	BcGLH6_A09	R	x	X	X	X
106	AB474618	220	AT1G65550	AT1G65550	Bra036544	AT1G65550_A09	R	x	x	x	x
107	AB474620	183	AT1G55620	CLCF	Bra038007	BcRRN23S.2_A06	R	—	x	x	x
108	AB474699	478	AT3G32195	AT3G32195	Bra007659	AT3G32195_A09	PPI	—	x	x	x
109	AB474701	448	AT4G00700	AT4G00700	Bra000963	AT4G00700_A03	PPI	—	x	x	x
110	AB474698	180	AT1G78120	TPR12	Bra015628	BcTPR12_A07	PPI	—	x	x	x
111	AB474700	423	AT4G28270	ZF	Bra026271	BcZF_A01	PPI	—	x	x	x
112	AB474727	308	AT5G53370	PMEPCRF	Bra003062	BcPMEPCRF_A10	O	x	—	x	x
113	AB474721	113	AT3G62770	ATG18A	Bra003509	ATG18A_A07	O	—	X	X	x
114	AB474726	583	AT1G19480	AT1G19480	Bra025741	AT1G19480_A06	O	x	X	x	x
115	AB474723	175	AT1G62970	AT1G62970	Bra027007	AT1G62970_A09	O	—	x	X	x
116	AB474730	340	AT4G34640	SQS1	Bra011548	BcSQS1_A01	O	x	x	x	—
117	AB474741	209	AT3G13720	PRA1.F3	Bra027406	BcPRA1.F3_A05	Un	—	X	x	x
118	AB474742	149	AT1G44191	AT1G44191	Bra010149	AT1G44191_A06	Un	—	—	x	x
119	AB474745	149	AT3G13080	MRP3	Bra039368	BcMRP3_Scaffold000164	Un	—	—	—	x
120	AB474733	126	AT1G14740	TTA1	Bra026192	BcTTA1_A06	Un	—	X	x	x
121	AB474737	205	AT3G29075	AT3G29075	Bra025663	AT3G29075_A04	Un	x	X	x	x
122	AB474740	149	AT3G13080	MRP3	Bra039368	BcMRP3_A06	Un	x	X	x	x
123	AB474736	121	AT5G42050	AT5G42050	Bra025450	AT5G42050_A04	Un	—	X	x	x
124	AB474731	130	AT5G09805	IDL3	Bra009082	BcIDL3_A10	Un	x	—	X	—
125	AB474738	191	AT1G70900	AT1G70900	Bra016176	AT1G70900_A07	Un	x	X	x	x
126	AB474735	239	AT3G29075	AT3G29075	Bra025663	AT3G29075_A04	Un	x	—	—	x
127	AB474739	77	AT3G49601	AT3G49601	Bra017971	AT3G49601_A06	Un	—	X	X	—
128	AB474732	398	AT4G19430	AT4G19430	Bra013396	AT4G19430_A01	Un	—	—	X	—
129	AB474746	301	AT5G44790	RAN1	Bra025102	BcRAN1_A06	Un	—	x	x	—

Abbreviations: D, defense; EM, energy metabolism; O, others; PPI, protein-protein interaction; R, regulation; ST, signal transduction; Un, unknown. Legend: (X,X) Different signal intensity in cDNA-AFLP analysis (6% polyacrylamide gel). The bigger legend "X", the more signal intensity.

Figure 2

Classification of differentially accumulated TDFs after inoculation of H. parasitica. A total of 129 TDFs were classified based on the Chinese cabbage database.

Validation of expression patterns using qRT-PCR analysis

To investigate the reliability of cDNA-AFLP for detecting differentially expressed genes, qRT-PCR analysis was carried out for 15 TDFs. These TDFs were selected based on significantly different expression patterns in the time course of the cDNA-AFLP experiment and homology to genes known to have a role in defense, signal transduction, regulation and energy metabolism. Expression patterns of the 15 TDFs in non-heading Chinese cabbage leaves after infection are shown in Figure 3. The same expression pattern was found for each TDF with qRT-PCR analysis as observed in the cDNA-AFLP tests, except for TDF60 (BcKEG_A03) and TDF91 (BcABCG36_A07). As shown in Figure 3, TDFs that involved in defense (TDF1 (BcASN1_A06), TDF7 (BcCHS_A10), TDF11 (BcTPI_A04) and TDF14 (BcLIK1_A01)) had maximum expression at 48 h.p.i., except for TDF1 that had maximum expression peaked at 24 h.p.i. TDFs involved in signal transduction included TDF42 (BcCAT3_A07), TDF49 (BcCCS_A08), TDF58 (BcNIT2_A02), TDF59 (BcRLK5_A01), TDF60 (BcKEG_A03) and TDF63 (BcSAMDC_A03)). Among of them, TDF42, TDF49 and TDF59 had similar expression patterns and peaked at 24 or 48 h.p.i. TDF58 and TDF63 had minimum expression at 72 h.p.i., suggesting that these two genes may be repressed after infection. TDFs involved in energy metabolism included TDF75 (BcAAE3_A06), TDF76 (BcLHCB1.1_A07) and TDF88 (BcAMT2_A05). Among them, TDF75 and TDF88 were expressed highly at 0 h.p.i. compared with other TDFs, and showed maximum expression at 48 and 24 h.p.i., respectively. The results suggested that they may have been involved in the earlier stageinteraction between non-heading Chinese cabbage and H. Parasitica. TDF76 expressed very low at the 0 h.p.i. TDF91 (BcABCG36_A07) and TDF101 (BcSIG1_A08)) were related to regulation. TDF91 was slowly increased after 0 h.p.i. and maximum expression peaked at 48 h.p.i. TDF101 was strongly upregulated at 24 h.p.i. and decreased after 24 h.p.i. These results suggested that the selected TDFs with putative four categories of functions might be triggered rapidly and have an active role during the early incompatible interaction between non-heading Chinese cabbage and H. parasitica.

Figure 3

Quantitative real-time PCR analysis of 15 selected genes. (a–o) Both control and treated third leaf of five plants ‘Suzhou Qing’ were harvested and pooled at 0, 24, 48 and 72 h.p.i. The relative expression level for H. parasitica-inoculated plants at each time point was calculated as fold of the control plants at 0 using the LOG method. All data were normalized to the β-actin gene expression level. Error bars indicate s.d. of the three technical repeats.

Through BLAST searching in the Arabidopsis database (http://www.arabidopsis.org/), we found that four of the 15 TDFs were related with fungal resistance. To verify these expectations were related to fungal resistance, we performed a qRT-PCR experiment with a resistant and a susceptible line. Results are shown in Figure 4.

Figure 4

The comparison of partial TDFs (a–d) expression patterns between resistant line and susceptible line. The results show that these four genes has almost the same expression trend between two lines, but the expression of gene in the resistant line ‘Suzhou Qing’ is higher than that of in susceptible line ‘Aijiao Huang’. Both control and treated third leaf of five plants were harvested and pooled at 0, 24, 48 and 72 h.p.i. The gene expression level was calculated using the LOG method. The gene expression level in both lines was compared using LOG value directly. All data were normalized to the β-actin gene expression level. Error bars indicate s.d. of the three technical repeats. Asterisks indicate statistically significant differences compared ‘Aijiao Huang’ and ‘Suzhou Qing’ at each TDFs (Student’s t-test: *P<0.05; **P<0.01).

TDF14 (BcLIK1_A01) encodes LRR-RLK protein, is involved in regulation of innate immune response, and have a role against pathogens according to the homologous alignment in the Brassica database. As shown in Figure 4, gene expression of TDF14 was increased slowly after inoculation and expression peaked at 48 h.p.i. Although both have the same expression trends, the expression of TDF14 in resistant line ‘Suzhou Qing’ is higher than that in susceptible line ‘Aijiao Huang’, especially in 48 h.p.i.

TDF42 (BcCAT3_A07) encodes catalase and is involved in the regulation of defense. Catalase is one of the key enzymes in vivo anti-oxidative defense systems, which has a special role in removing the hydrogen peroxide to avoid the body to produce oxidative stress in the process. The expression patterns of TDF42 in two lines were similar to that of TDF14. TDF75 (BcAAE3_A06) encodes an oxalyl-CoA synthetase and involved in defense response to fungus. The gene expression in resistant line ‘Suzhou Qing’ was much higher than that in susceptible line ‘Aijiao Huang’, with fold change reaching to 100 times at 48 h.p.i.

TDF88 (BcAMT2_A05) encodes a high-affinity ammonium transporter and involved in ammonium transmembrane transport and defense response to fungus. The expression of TDF88 was almost the same in 0 h.p.i. in two lines, strongly induced subsequently and maximum expression both peaked at 24 h.p.i. But gene expression of TDF88 in resistant line ‘Suzhou Qing’ was always higher than that in susceptible line ‘Aijiao Huang’. The expression of the genes related with fungal resistance in resistance line were higher than that in susceptible line.

Discussion

We identified 129 TDFs, of which 121 TDFs were upregulated and eight were down-regulated using cDNA-AFLP.[2,3] By BLAST searching in the Brassica database, these TDFs were classified according to their different functions. The functional categorization showed a complex linkage between proteins encoding by the TDFs. Information obtained from this study may provide a foundation for better understanding defense mechanisms of the non-heading Chinese cabbage with H. parasitica incompatible interaction.

Defense

Our data showed that several transcripts encoding the group of PR proteins were differentially expressed in the interaction (Table 2). For example, TDF3 (β-1, 3-glucanase) was induced within 24 h.p.i. and its expression peaked at 48 h.p.i. The expression levels of TDF8 (Hapless 8), TDF16 (a thaumatin-like protein) and TDF28 (PR 1-like protein) were induced within 24–72 h.p.i. Previously, we cloned the full length of β-1, 3-glucanase, hapless 8 and PR 1 genes, and analysed their expression patterns in response to H. parasitica infection in ‘Suzhou Qing’ cultivar of non-heading Chinese cabbage.[10] The accumulations of these two transcripts were upregulated during the infection period, suggesting that these proteins may participate in the defence reaction for non-heading Chinese cabbage against H. parasitica. We also found that expression of TDF39 (ATMT-1) peaked at 48 h.p.i. In rice and barley, MT2A genes were induced by stresses such as drought, cold treatment and wounding or in response to pathogen attacks.[12-14] Further research revealed that products of homologous MT scavenged the reactive oxygen species (ROS), such as OH to H2O.[15] Evidences suggest that the generation of ROS occurs at early stage in the plant–pathogen interaction. Rapid accumulation of ROS causes oxidative burst that results in hypersensitive cell death and cell wall cross-link.[16] Our data may indicate that the upregulation of MT2A in non-heading Chinese cabbage leaves may contribute to ROS accumulation for inducing the hypersensitive response of the plant.

Signal transduction

Studies suggest that several signal transduction-related proteins are involved in the plant–fungus interactions.[1-3,17] We also identified many TDFs related to the signal transduction, such as TDF42 (Catalase 3), TDF43 (2-Cys PrxB), TDF45 (ATP binding), TDF50 (ATRER1A), TDF58 (Nitrilase), TDF48 (BcCAM3_A04, calcium ion binding) and TDF68 (WRKY DNA-binding protein).

Calcium binding-like proteins may have a role in signalling pathways against pathogens and wounding.[18] A number of downstream targets of calmodulin (CaM), including nitric oxide synthase,[19] barley MLO protein,[20] maize Ca-CaM[21] and transcriptional regulators,[22] are involved in plant responses to pathogens. Given that calcium ion-binding proteins are important modulators of defence response in pathways for pathogen sensing in plants, the CAM 3 gene could have a special role as Ca2+ sensors during the plant immune response to the fungus H. Parasitica.

WRKY proteins are signal transcriptional factors recognizing the TTGAC (C/T) W-box elements in the promoters of a large number of plant defence-related genes.[23] Many of WRKY genes are upregulated particularly in pathogen-infected, wounded or abiotic-treated plants.[24] In this study, expression of WRKY DNA-binding protein peaked at 24 h.p.i., suggesting that the possible role of WRKYs is in the regulation of the genes associated with plant defence responses. However, we found that expression pattern of TDF60 (WRKY gene) determined by qRT-PCR was inconsistent with that of cDNA-AFLP. The inconsistence may be caused by different paralogues in the genome.

Regulation

An ethylene response factor (BcERF1_A01, TDF93; Table 2), a regulator of ethylene responses after pathogen attack in Arabidopsis,[25] may have a key role in the non-heading Chinese cabbage–H. parasitica interaction. Previous studies have been demonstrated that ERFs are involved in regulating the expression of the defence-related genes during the disease resistance responses.[26,27]

We found that TDF91 (BcABCG36_A07, ATP-binding cassette g36) was inhibited after inoculation by cDNA-AFLP analysis. However, its expression was induced weakly at 24 h.p.i., peaked at 48 h.p.i. and decreased weakly at 72 h.p.i. afterwards by qRT-PCR analysis. TDF100 (BcEDM1_A09) coding for an enhanced downy mildew 1 homolog was found to be induced during the infection period. Its relationship with the fungi, bacteria and viruses has been identified to be regulators of R gene-mediated resistance in other crop species.[28,29] Recent studies have revealed that EDM1 homologue gene SGT1 is required for pathogen-induced disease-associated cell death during both compatible and incompatible interactions in tobacco.[30]

Energy metabolism

Energy metabolism has an important role in plants–pathogen interaction. The photosynthetic carbon cycle (PCC) is part of the dark reactions of photosynthesis and can be roughly divided into three steps: carboxylation, reduction reaction and regeneration of RuBP.[31] In this study, we found that some TDFs relating to energy metabolism were downregulated, such as TDF76 (chlorophyll a/b binding protein), TDF78 (SIT4 phosphatase-associated family protein) and TDF82 (PP2C-related protein), whereas some were upregulated, such as TDF79 (receptor like protein 51), TDF80 (NADH-ubiquinone oxidoreductase), TDF83 (respiratory burst oxidase protein), TDF85 (rubisco small subunit 1b; Table 2). Previous reports have identified that they are involved in PCC cycle, for example, TDF86 (reduction of transketolase) inhibited ribulose-1,5-bisphosphate regeneration and photosynthesis.[31,32] These results are consistent with previous report that the expression of energy metabolism-related genes are induced and/or suppressed in photosynthesis during abiotic and biotic stresses.[33,34] Our results may suggest that PCC cycle could provide protection function in energy metabolism during non-heading Chinese cabbage against H. parasitica.

Protein–protein interaction

A number of genes related to protein–protein interaction were induced after inoculation, such as TDF110 (BcTPR12_A07, tetratricopeptide repeat protein) and TDF111 (BcZF_A01, zinc-finger family protein). Of which, the gene expression of PAT is induced in the presence of ozone in Arabidopsis.[35] The tryptophan biosynthetic enzymes, including anthranilate synthase (ASA) and PAT, are co-ordinately upregulated at both the messenger RNA and protein level during biotic and abiotic stress.[36] We found that one of BcZF orthologous to A. thaliana was induced after inoculation (Table 2). Rizhsky et al. speculate that a zinc-finger protein is required for the expression of ascorbate peroxidase, which provides some measure of resistance for plant during oxidative stress.[37] In this study, fact that pathogen-induced accumulation of these protein–protein interaction-related genes suggested that these genes may be involved in some defence mechanisms against H. parasitica indirectly.

Using the cDNA-AFLP method, we also detected several unknown functional genes. Their biological role is still unclear.

In this study, we examined gene expression patterns in an incompatible interaction between non-heading Chinese cabbage ‘Suzhou Qing’ and the downy mildew pathogen. We obtained 129 TDFs with different expression patterns and classified functional categories using cDNA-AFLP. Fifteen TDFs were randomly selected for validation of cDNA-AFLP expression patterns using qRT-PCR. Results showed that reliability of cDNA-AFLP is suitable for detecting differentially expressed genes. Among the 15 TDFs, four TDFs are related with fungal resistance, namely, TDF14 (BcLIK1_A01), TDF42 (BcCAT3_A07), TDF75 (BcAAE3_A06) and TDF88 (BcAMT2_A05). We further compared expression patterns in ‘Suzhou Qing’ and ‘Aijiao Huang’ using qRT-PCR. Results showed that the four genes displayed similar expression trend in the two lines. Importantly, the expression of genes in the resistant line is higher than that in susceptible line. These genes expression patterns and their putative functions may provide insight in understanding the non-heading Chinese cabbage–downy mildew incompatible interaction. Our study may also provide a foundation for better understanding molecular mechanisms and can be beneficial in selecting candidate resistance genes for the incompatible interaction between non-heading Chinese cabbage and H. Parasitica. Further research is needed to study the comparison between compatible and incompatible interactions to identify novel and common genes that regulate non-heading Chinese cabbage–downy mildew pathosystem.