Literature DB >> 27600944

Dirofilaria immitis in a child from the Russian Federation.

Nelli Ignatievna Tumolskaya1, Edoardo Pozio2, Vera Mikhaylovna Rakova1, Valentina Georgievna Supriaga1, Vladimir Petrovich Sergiev3, Evgeny Nikolaevich Morozov1, Lola Farmonovna Morozova3, Giovanni Rezza2, Serguei Kirillovich Litvinov1.   

Abstract

An immature female worm, Dirofilaria immitis, was isolated from the scrotum of a 14-month-old child. This is the first identification of human dirofilariosis caused by D. immitis in a relatively Northern region (Moscow) of the Russian Federation. The parasite was diagnosed by means of morphological examination of the worm, confirmed by PCR assay. This case raises questions about the range of the D. immitis distribution among humans in Russia. To better understand the geographical distribution of dirofilarioses, detailed clinical and epidemiological information should be collected from human cases with appropriate laboratory confirmation. © N.I. Tumolskaya et al., published by EDP Sciences, 2016.

Entities:  

Mesh:

Year:  2016        PMID: 27600944      PMCID: PMC5018928          DOI: 10.1051/parasite/2016037

Source DB:  PubMed          Journal:  Parasite        ISSN: 1252-607X            Impact factor:   3.000


Introduction

In the Russia Federation, dirofilariosis is commonly identified in domestic and wild carnivores [21]. Dirofilaria repens has been documented in dogs and cats, whereas Dirofilaria immitis has been reported in dogs of the South and the Far East of Russia [2]. Dirofilaria ursi has been reported in brown bears (Ursus arctos) of the Primorskiy kray, Sakhalin, Yakutia, and of the Vologda regions [2, 21]. Human infections by Dirofilaria repens are found more often in the southern regions of the country (Rostov region, Volgograd region, Stavropolskiy kray, Northern Caucasus, and other territories) [2, 22]. In recent years, both animal and human dirofilariosis has spread toward the North of Russia. These zoonotic nematodes are reported more frequently in the Moscow, Tyumen, and Novosibirsk regions, and in the Primorskiy and Khabarovskiy krays, where the environment favors their natural cycles [2, 22, 25]. In the last five years, dog and human dirofilariosis has been documented in 28 Russian regions [5, 21, 22, 25]. In these regions, these parasites are transmitted not only in rural areas, but also in towns, where transmission can occur the whole year round if infected dogs are present [22, 25, 29]. The key vectors of Dirofilaria spp. in Russia are mosquitos belonging to the Aedes, Anopheles, and Culex genera [2]. In Western Europe, D. immitis is widespread causing severe cardiac signs in dogs [20, 23]. In humans, pulmonary localizations of this parasite are observed [24], but the focal lesion in the lungs is often initially misdiagnosed as a tumor [23]. There are limited observations of other localizations of this parasite in humans, such as the chest, usually discovered in the course of coronary angiography [19], spermatic cord [17], scrotum [1, 6, 10, 15, 26], oral area [3, 9], ovaries [16], liver [11], or subcutaneous tissue [4, 7]. In this report, we present a case of dirofilariosis in a child.

Case study

A 14-month-old child residing in a rural settlement of the Solnechnogorskiy district (Moscow region), about 56° North, was brought by the parents to a local health care center on March 2015. Significant edema at the right part of the scrotum, cyanotic tint of the affected area, and tenderness were observed. The urologist suspected torsion of the right testicle and referred the child to the surgery unit. According to the parents, the child, who did not attend a kindergarten, was very often taken outside the home in a baby carriage, lightly dressed or even undressed in the hot days of the 2014 summer. The child was healthy before the 2014 spring but then pain and swelling developed and gradually worsened. The child was operated in March 2015, and an inflammatory infiltrate of solid-elastic texture was removed. A very thin white filamentous worm, about 10 cm in length, was extracted from the biopsy. The worm was surrounded by necrotic tissue, hemorrhage, and it was infiltrated by eosinophils, lymphocytes, and plasma cells. The biopsy was analyzed at the Department of Medical Parasitology and Tropical Medicine of the Clinical and Diagnostic Center, Moscow State Medical University. In April 2015, the child was in good health and no abnormal signs were observed, except minor residual edema and induration in the area of the surgical intervention. A case of dirofilariosis was suspected. No microfilariae were detected in the blood. PCR testing of a blood sample tested negative for D. repens. The morphological examination of the worm showed that it was an immature female (no larvae were present in the uterus) of 130 mm in length and 0.95 mm in width (Fig. 1).
Figure 1.

Immature female worm of Dirofilaria immitis (left) isolated from the scrotum of a child living near Moscow, present case, and an immature female worm of Dirofilaria repens (right) isolated from another patient in Russia, for comparison.

Immature female worm of Dirofilaria immitis (left) isolated from the scrotum of a child living near Moscow, present case, and an immature female worm of Dirofilaria repens (right) isolated from another patient in Russia, for comparison. The anterior and posterior ends of the body were slightly narrowed and had a roundish shape. The anus was at 0.8 mm from the tail. The cuticle was white with tender cross striations. No pectiniform longitudinal cross striations, typical for D. repens, were observed. Fine “cuts” located lengthwise on the cuticle were present. The uteri were formed and large nuclei were clearly visible in the notochord cells. Based on its morphology, the worm was identified as D. immitis. To confirm the morphological identification of the worm, fragments from the worm isolated from the patient and from reference adult worms belonging to D. repens and D. immitis were tested by PCR using species-specific primers. The D. repens specific primers were DIR-3 F-5′–CCGGTAGACCATGGCATTAT–3′, and DIR-4 R-5′–CGGTCTTGGACGTTTGGTTA–3′, amplifying a fragment of 246 base pairs. Amplification consisted of 48 cycles at 94 °C for 30 s, 50 °C for 30 s, and 72 °C for 1 min [27]. The D. immitis specific primers were CO1 int F-5′–TGATTGGTGGTTTTGGTAA–3′, and CO1 int R-5′–ATAAGTACGAGTATCAATATC–3′, amplifying a fragment of 656 base pairs. Amplification consisted of one cycle at 94 °C for 30 s, then 30 cycles at 94 °C for 1 min, 50 °C for 2 min, and 72 °C for 5 min [13]. The PCR products were visualized on a 1.5% agar gel. The worm isolated from the patient displayed the PCR pattern of D. immitis (amplified fragment of 656 bp), whereas no amplification was observed when the DNA was amplified by the D. repens specific primer pairs (Fig. 2).
Figure 2.

Amplicon products on agar gel electrophoresis. Lane 1, positive control of Dirofilaria immitis; lanes 2–4, samples from the worm removed from the patient and amplified by D. immitis specific primers; lane 5, negative control; lane 6, molecular mass marker; lanes 7–9, samples from the worm removed from the patient and amplified by Dirofilaria repens specific primers; and lane 10, D. repens positive control.

Amplicon products on agar gel electrophoresis. Lane 1, positive control of Dirofilaria immitis; lanes 2–4, samples from the worm removed from the patient and amplified by D. immitis specific primers; lane 5, negative control; lane 6, molecular mass marker; lanes 7–9, samples from the worm removed from the patient and amplified by Dirofilaria repens specific primers; and lane 10, D. repens positive control.

Discussion

In Russia, data on the prevalence of human dirofilariosis are limited, since the official notification and registration of clinical cases have been introduced very recently. According to Nagornyi and Krivorotova [14], D. immitis affects 97.2%, 29.8%, and 33% of owned and stray dogs of the Volgograd and Rostov regions, and of the Krasnodar Krai, respectively. Both D. immitis and D. repens were detected in 24.8% of dogs of the Rostov region. D. immitis was also documented in dogs of the Adygei Republic [14]. In the Moscow region, D. immitis was found in 122 dogs (3.6%) and D. repens in 22 dogs (0.6%) [28]. D. immitis was detected in 19 dogs (36.5%) and 31 dogs (29.2%) with microfilariae of the Voronezh region [30] and the Bashkiria Republic [18], respectively. Although there is very little information on the circulation of D. immitis among dogs in Siberia, this parasite was detected in 61 dogs (43.6%) with microfilaremia in Khabarovsk city [8]. This is the first documented report of human dirofilariosis due to D. immitis in the Russian Federation. The child acquired the infection at 14 months of age. No specific clinical signs and/or symptoms were observed. The parasite was identified by means of morphological examination of the worm and confirmed by molecular analysis. There is a need for more thorough and detailed analysis of each case of human dirofilariosis. We cannot exclude that D. immitis may be more frequent in humans in the Russian Federation than previously reported, since in most cases the worm is not identified at the species level. In humans, D. repens is localized most frequently under the conjunctiva, more rarely subcutaneously in areas with areolar cellular tissue [2, 12, 21]. Over the past few years, atypical localizations of D. repens in humans (e.g., scrotum with signs of acute inflammation, oscheoma, spermatic cords, testicle, ovaries, penis, fallopian tube, pleura, mesentery, omentum, intestinal wall, and mucous tunic of the mouth) have become more frequent [12, 25], with the same trend as in other countries of Europe [1, 4, 7, 10, 15–17, 19, 23]. A specific sign of dirofilariosis is the sense of moving and crawling of something inside of the intumescence, tumor, or subcutaneous node [6]. Detailed assessments of epidemiological data would also be very useful and helpful in clarifying the epidemiological situation.
  23 in total

1.  Dirofilaria repens mimicking an ovarian mass: histologic and molecular diagnosis.

Authors:  Andrea Palicelli; Cristina Deambrogio; Alberto Arnulfo; Francesco Rivasi; Alessia Paganotti; Renzo Boldorini
Journal:  APMIS       Date:  2014-04-04       Impact factor: 3.205

2.  [A case of dirofilariasis of the scrotum of probable origin in Languedoc].

Authors:  J P Nozais; M Huerre
Journal:  Bull Soc Pathol Exot       Date:  1995

3.  18-FDG Uptake in Pulmonary Dirofilariasis.

Authors:  Michael Stone; Ishani Dalal; Chad Stone; Bhavin Dalal
Journal:  J Radiol Case Rep       Date:  2015-04-30

4.  [Human dirofilariasis: clinical and diagnostic signs and diagnostic methods].

Authors:  E N Morozov; V G Supriaga; V M Rakova; L F Morozova; L A Zhukova
Journal:  Med Parazitol (Mosk)       Date:  2014 Apr-Jun

Review 5.  [Dirofilaria (Nochtiella) repens in the spermatic cord: a new human case in Italy].

Authors:  S Pampiglione; R Montevecchi; P Lorenzini; M Puccetti
Journal:  Bull Soc Pathol Exot       Date:  1997

6.  Oral dirofilariasis.

Authors:  Mahija Janardhanan; S Rakesh; Vindhya Savithri
Journal:  Indian J Dent Res       Date:  2014 Mar-Apr

7.  [Results of studies of human dirofilariasis in Russia].

Authors:  V P Sergiev; V G Supriaga; A M Bronshteĭn; L A Ganushkina; V M Rakova; E N Morozov; L V Fedianina; A A Frolova; L F Morozova; I B Ivanova; N N Darchenkova; L A Zhukova
Journal:  Med Parazitol (Mosk)       Date:  2014 Jul-Sep

8.  Dirofilaria immitis infection of a snow leopard (Uncia uncia) in a Japanese zoo with mitochondrial DNA analysis.

Authors:  Koichi Murata; Tokuma Yanai; Takeshi Agatsuma; Shigehiko Uni
Journal:  J Vet Med Sci       Date:  2003-08       Impact factor: 1.267

9.  Live Dirofilaria immitis found during coronary artery bypass grafting procedure.

Authors:  Zrinka Požgain; Grgur Dulić; Krunoslav Sego; Robert Blažeković
Journal:  Eur J Cardiothorac Surg       Date:  2013-10-17       Impact factor: 4.191

10.  Pseudo-tumor of the scrotum, a rare clinical presentation of dirofilariasis: a report of two autochtonous cases due to Dirofilaria repens.

Authors:  Nathalie Leccia; Stephanie Patouraux; Xavier Carpentier; Christian Boissy; Pascal Del Giudice; Scott Parks; Jean François Michiels; Damien Ambrosetti
Journal:  Pathog Glob Health       Date:  2012-10       Impact factor: 2.894

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.