Literature DB >> 27587978

A new species of frog of the genus Pristimantis from Tingo María National Park, Huánuco Department, central Peru (Anura, Craugastoridae).

Germán Chávez1, Alessandro Catenazzi2.   

Abstract

A new species of Craugastoridae frog encountered from 1000-1700 m in elevation in the premontane forests of the Peruvian central Andes is described. The new species is similar in appearance to many other species of Pristimantis, but is easily distinguishable from these species by having bright red coloration on the groin, posterior surface of thighs, and shanks. The new species is only known for two localities 27 km apart in the Huánuco Region.

Entities:  

Keywords:  Amphibian; Andes; Anfibio; Craugastoridae; bosques premontanos; premontane forests; taxonomy; taxonomía

Year:  2016        PMID: 27587978      PMCID: PMC4992813          DOI: 10.3897/zookeys.610.8507

Source DB:  PubMed          Journal:  Zookeys        ISSN: 1313-2970            Impact factor:   1.546


Introduction

Frogs of the genus () comprise one of the most striking, richest, and understudied groups in the Neotropics (Hedges et al. 2008; Padial and De la Riva 2009; Ortega–Andrade et al. 2015). Likewise, 131 species of are known to occur in Peru where they are distributed in many habitats on the western and eastern versants of the Andes (Frost 2016). Although several species of have been described from the eastern Andean slopes of central Peru over the last 15 years (Lehr et al. 2000; Lehr 2001; Lehr and Aguilar 2002; Lehr et al. 2002; Lehr and Aguilar 2003; Duellman and Hedges 2005; Boano et al. 2008; Duellman and Chaparro 2008; Lehr and Oroz 2012; Chávez et al. 2015), amphibian taxonomic research in one of main drainages of the area: the Upper Huallaga river has focused on species of , , and (Duellman and Toft 1979; Aichinger 1991, Castroviejo–Fisher et al. 2009) with only one () species recently described from this region (Duellman and Hedges 2007). is a small protected area covering 4777 ha (SERNANP 2015) located in the Huallaga river basin on the eastern versant of the Peruvian central Andes. The landscape is dominated by a chain of small, isolated mountains commonly called “La Bella Durmiente” (“The sleeping beauty”), and belongs to lower montane forest (Gentry 1993). Few biological surveys have been conducted within this park, and its biological diversity is poorly known because terrorism and drug trafficking made the area inaccessible during the decades of the 80’s and 90’s. A rapid biological inventory was realized in 2014, 50 years after the creation by Peruvian law of TMNP, and resulted in an amphibian collection obtained by GC. Morphological analysis of collected specimens, and comparisons with similar species, led us to the discovery of a new species of frogs of the genus , which is described herein. Tingo María National Park

Material and methods

Format for diagnosis and description of the new species follow those of Lynch and Duellman (1997). For systematic of we follow Hedges et al. (2008), Pyron and Wiens (2011), and Padial et al. (2014). Specimens collected were sacrificed with a 20% benzocaine solution and fixed in 10% formalin, then stored in 70% ethanol and deposited in the herpetological collection at . The following variables were taken as described in Duellman and Lehr (2009) and were measured to the nearest 0.1 mm with digital calipers under a stereoscope: ; ; ; ; ; ; ; ; ; . Centro de Ornitologia y Biodiversidad snout–vent length eye–nostril distance head length head width interorbital distance internarial distance tibia length foot length eye diameter upper eyelid width Fingers and toes are numbered preaxially to postaxially from I–IV and I–V respectively. We determined comparative lengths of toes III and V by adpressing both toes against Toe IV; lengths of fingers I and II were determined by adpressing the fingers against each other. Specimens were sexed based on external sexual characteristics (e.g., presence of vocal sacs in males), all specimens were collected when they were calling, thus are considered adult males. Photographs were taken in the field and laboratory by GC, and used for descriptions of coloration in life and in preserved condition respectively. In addition to the type series of the new species, specimens examined are listed in Appendix I. The advertisement calls of a chorus of males (CORBIDI 15563–68, 15577–78) were recorded at the type locality on 21 November 2014 (Tair = 23.0 °C; taken with a digital thermo hygrometer to the nearest 0.1 °C). A digital recorder (Marantz PMD661MK2) and unidirectional microphone (Sennheiser ME64) were used for field recording, and Raven Pro version 1.4 (Cornell Laboratory of Ornithology, Ithaca, NY) to analyze call variables. A total of 48 calls were analyzed. The following variables were measured from oscillograms: note, duration, and rate, interval between notes or calls, number of pulses, and presence of amplitude modulation. Variables measured from spectrograms included dominant frequency, and presence of frequency modulation or harmonics. Spectral parameters were calculated through set at a length of 512 points (Hann window, 50% overlap). Averages are reported ± SD. fast Fourier transform Genetic distances were estimated to confirm generic placement of the new species within through analysis of the non-coding 16S rRNA mitochondrial fragment. Tissues from two paratopotypes, CORBIDI 15563 and 15566, were used to obtain DNA sequences for the new species (deposited in GenBank; Appendix 2). Sequences of closely related, congeneric species were downloaded from GenBank (Appendix 2). Extraction, amplification, and sequencing of DNA followed standard protocols (Hedges et al. 2008; Catenazzi and Tito 2016). The 16Sar (forward) primer (5’-3’ sequence: CGCCTGTTTATCAAAAACAT) and the 16Sbr (reverse) primer (5’-3’ sequence: CCGGTCTGAACTCAGATCACGT) (Palumbi et al. 2002) were used; the following thermocycling conditions during the polymerase chain reaction (PCR) with a Veriti thermal cycler (Applied Biosystems) were employed: one cycle of 96 °C/3 min; 35 cycles of 95 °C/30 s, 55 °C/45 s, 72 °C/1.5 min; one cycle 72 °C/7 min. PCR products were purified with Exosap-IT (Affymetrix, Santa Clara, CA) and shipped to MCLAB (San Francisco, CA) for sequencing. Geneious R8, version 8.1.6 (Biomatters, http://www.geneious.com/) was used to align the sequences with the MAFFT, version 7.017 alignment program (Katoh and Standley 2013). Uncorrected p-distances (i.e., the proportion of nucleotide sites at which any two sequences are different) were estimated with the R package “ape” (Paradis et al. 2004).

Results

sp. n.

http://zoobank.org/4DCDA666-2217-48A0-9E6D-C1681544BDD5 Proposed standard English name: Sleeping beauty rain frog Proposed standard Spanish name: Rana de lluvia de la Bella Durmiente

Holotype.

CORBIDI 15578 (Figures 1–3), an adult male collected by G. Chávez and D. Vásquez at Campamento La Garganta de la Bella, Tingo María National Park, (; 1095 m above sea level (asl), Provincia Leoncio Prado, Departamento Huánuco, Peru, on 21 November 2014.
Figure 1.

Map of Peru indicating the type locality of sp. n. (asterisk), the two most closely related species according to analysis of genetic distances, and sp. (white square; see text for analysis), and of other Peruvian species of with red shanks or thighs: (black square), (black star), and (white circle), (triangle), (black circle).

Figure 3.

Ventral view of A hand (hand length – 8.5 mm) and B foot (foot length = 9.2 mm) of the holotype of sp. n., (CORBIDI 15578). Photographs by Germán Chávez.

Map of Peru indicating the type locality of sp. n. (asterisk), the two most closely related species according to analysis of genetic distances, and sp. (white square; see text for analysis), and of other Peruvian species of with red shanks or thighs: (black square), (black star), and (white circle), (triangle), (black circle). Dorsolateral and ventral views (A, B) of the holotype of sp. n., male CORBIDI 15578, SVL = 21.9 mm, showing detail of (C) coloration on shanks and thighs. Photographs by G. Chávez. Ventral view of A hand (hand length – 8.5 mm) and B foot (foot length = 9.2 mm) of the holotype of sp. n., (CORBIDI 15578). Photographs by Germán Chávez. Paratopotypes. Seven adult males (Fig. 4): CORBIDI 15563–68, 15577, collected along with the holotype.
Figure 4.

Dorsolateral and ventral views of two paratopotypes of sp. n. showing detail of coloration on shanks and thighs. Male CORBIDI 15563 (A–C), SVL = 21.0 mm. Male CORBIDI 15565 (D–F), SVL = 21.5 mm. Photographs by G. Chávez.

Dorsolateral and ventral views of two paratopotypes of sp. n. showing detail of coloration on shanks and thighs. Male CORBIDI 15563 (A–C), SVL = 21.0 mm. Male CORBIDI 15565 (D–F), SVL = 21.5 mm. Photographs by G. Chávez. Paratype. Adult male, CORBIDI 16606 collected at Sharco (; altitude 1700 m asl), Provincia Pachitea, Departamento Huánuco, Peru, on 28 November 2015 by Juan Carlos Chávez-Arribasplata.

Diagnosis.

The new species is distinguished by the following combination of characters: (1) skin on dorsum finely shagreen, that on venter areolate, discoidal fold absent, dorsolateral folds absent; (2) tympanic membrane and tympanic annulus distinct, weak supratympanic fold covering dorsal and posterior edges of tympanum, horizontal diameter of eye 3x the diameter of tympanum; (3) snout acuminate in dorsal view, truncated and posteroventrally inclined in lateral view, canthus rostralis weakly concave in dorsal view, angular in lateral view, loreal region concave, rostral papilla absent; (4) upper eyelid lacking tubercles, cranial crests absent; (5) dentigerous process of vomers absent; (6) males with vocal sacs and vocal slits, nuptial excrescences absent; (7) finger I and finger II of equal length, fingers II and III bearing rounded discs about 1.5 times wider than digits, finger IV bearing a rounded disc about twice as wide as its digit; (8) fingers with narrow lateral fringes; (9) antebrachial tubercle absent; (10) ulnar and tarsal tubercles absent (11) inner metatarsal tubercle oval twice as long as round outer metatarsal tubercle, low supernumerary plantar tubercles at the base of toes I, II, and III; (12) toes with narrow lateral fringes, webbing absent, toe V longer than toe III; (13) in life, males with dorsum creamy yellow or yellowish brown with dark blotches; canthal stripe creamy white extending to the orbits; throat yellow; belly creamy white; groins, posterior surfaces of thighs, and shanks bright red; iris cream with brown flecks; (14) SVL in adult males 19.1–21.9 mm; SVL in females unknown.

Comparisons.

sp. n. is morphologically similar to , , , , , , , , , , , , , , and in having the head and body slightly compressed dorso–ventrally, but differs from all of them by having bright red coloration on groins, and on the posterior surfaces of thighs and shanks. Furthermore, lacks a rostral papilla, which is present in , ,PageBreak (variable), , , , , , and . Other species further differ by the following characters: has a tarsal fold (absent) and is lacking vocal slits (present); PageBreakPageBreak has a smooth dorsum (finely shagreen), and is lacking vocal slits (present), and a differentiated tympanic annulus and membrane (tympanic annulus and membrane distinct); has a sigmoid inner tarsal fold (absent) and dorsal skin shagreen with scattered spicules (finely shagreen without spicules); has an evident supratympanic fold (weakly evident), small dentigerous processes of vomers (absent), tubercles on ulnar and tarsal region (absent) and lacks vocal slits (present); has small dentigerous processes of vomers (absent), elongated ulnar tubercles (absent) and lacks tympanic annulus and membrane (present) and vocal slits (present). Only eight other species of Peruvian have red coloration on groins and posterior surfaces of thighs: , , , , , , and . can be differentiated from these species by having skin on dorsum finely shagreen (shagreen with pustules in ; shagreen with dermal ridges in ; shagreen to finely corrugated in ; coarsely shagreen in ; shagreen with low tubercles in ), skin on venter areolate (smooth in ), snout acuminate in dorsal view (rounded in ; subacuminate in and ; acutely rounded in ), truncated and posteroventrally inclined in lateral view (acutely rounded in ; rounded in ; acuminate in ), upper eyelids lacking tubercles (bearing small rounded tubercles in , conical tubercles in and ), tympanic annulus not prominent (prominent in , , , ; absent in ), supratympanic stripe PageBreakabsent (present in ), fingers I and II of equal lengths (finger I longer than finger II in ; finger I shorter than finger II in , and ), ulnar tubercles absent (distinct conical ulnar tubercles in ), heels lacking tubercles (bearing small subconical tubercles in and prominent conical tubercles in and ). The uncorrected genetic distances (Table 2) support the generic placement of the new species and its distinctiveness with respect to superficially similar species. According to these analyses, the most closely related species is (Shepack et al. 2016), which despite sharing a similar body shape can easily be distinguished from by the presence of a rostral papilla, larger size, and coloration patterns.
Table 2.

Uncorrected p-distances of the mitochondrial 16S rRNA gene. Comparisons between and the three taxa with lowest p-distances are indicated in bold.

Pristimantis acuminatus (MC11555) Pristimantis boulengeri (MAV257) Pristimantis bromeliaceus (KU291702) Pristimantis cf. mendax (MTD45080) Pristimantis dorsopictus (MHUAA7638) Pristimantis galdi (QCAZ32368) Pristimantis mindo (MZUTI1382) Pristimantis mindo (MZUTI1756) Pristimantis moro (AJC1753) Pristimantis moro (AJC1860) Pristimantis omeviridis (QCAZ19664) Pristimantis pluvialis (CORBIDI11862) Pristimantis pluvialis (CORBIDI16695) Pristimantis pulchridormientes (CORBIDI 15563) Pristimantis pulchridormientes (CORBIDI 15566) Pristimantis ridens (AJC1778) Pristimantis sp. (CORBIDI 17473) Pristimantis sp. (ROM43978) Pristimantis subsigillatus (MECN10117)
Pristimantis acuminatus (MC11555)0.00
Pristimantis boulengeri (MAV257)0.050.00
Pristimantis bromeliaceus (KU291702)0.140.130.00
Pristimantis cf. mendax (MTD45080)0.140.130.000.00
Pristimantis dorsopictus (MHUAA7638)0.150.130.110.110.00
Pristimantis galdi (QCAZ32368)0.110.110.100.100.080.00
Pristimantis mindo (MZUTI1382)0.120.110.090.090.080.060.00
Pristimantis mindo (MZUTI1756)0.120.120.090.090.080.060.000.00
Pristimantis moro (AJC1753)0.110.100.090.100.090.090.080.070.00
Pristimantis moro (AJC1860)0.110.100.090.090.090.090.070.070.050.00
Pristimantis omeviridis (QCAZ19664)0.140.130.120.120.120.110.120.110.100.100.00
Pristimantis pluvialis (CORBIDI11862)0.140.140.110.110.110.110.090.090.110.090.130.00
Pristimantis pluvialis (CORBIDI16695)0.140.140.110.110.110.110.090.090.110.090.130.000.00
Pristimantis pulchridormientes (CORBIDI 15563)0.180.170.130.120.130.120.110.100.100.100.14 0.07 0.07 0.00
Pristimantis pulchridormientes (CORBIDI 15566)0.180.170.130.120.130.120.110.100.100.100.14 0.07 0.07 0.000.00
Pristimantis ridens (AJC1778)0.150.130.140.140.130.160.130.130.140.130.150.150.150.160.160.00
Pristimantis sp. (CORBIDI 17473)0.140.140.110.110.100.090.080.080.100.080.120.060.06 0.07 0.07 0.150.00
Pristimantis sp. (ROM43978)0.140.130.120.120.110.100.090.080.100.100.130.070.07 0.08 0.08 0.170.060.00
Pristimantis subsigillatus (MECN10117)0.130.130.110.110.090.100.050.050.090.090.120.100.100.120.120.150.090.090.00
The new species is also similar to the recently described (Reyes–Puig et al. 2013) from Ecuador in having red groins (red or orange in ), but can be distinguished by the following characters (condition for in parentheses): upper eyelid lacking tubercles (bearing two small rounded tubercles), low ulnar tubercles present (absent), and iris cream with brown flecks (orange with fine black reticulations).

Description of the holotype.

An adult male (CORBIDI 15578) with a SVL of 21.9 mm, head as wide as long; snout subacuminate in dorsal view and truncated in lateral view, relatively short (eye–nostril distance 12% of SVL); canthus rostralis distinct in lateral view; loreal region concave; nostrils protuberant, directed anteriorly; interorbital area flat, broader than upper eyelid (upper eyelid width 59% of interorbital distance); cranial crests absent; upper eyelid lacking tubercles; tympanic membrane distinct, differentiated of surrounding skin; tympanic annulus distinct, round with weak supratympanic fold obscuring upper and posterodorsal edges of annulus (Fig. 2); tympanum diameter 31% of eye diameter; postrictal tubercles absent. Choanae small, rounded, not concealed by palatal shelf of maxillary; tongue longer than wide and granular. Skin texture on dorsum and flanks finely shagreen; dorsolateral folds absent; venter areolate; thoracic fold present, discoidal fold absent, cloacal sheath absent. Forearm slender; ulnar tubercles low, ulnar fold absent; radio–ulnar length 23% of SVL; fingers with narrow lateral fringes; relative lengths of fingers I ≤ II < IV < III; palmar tubercle bilobed, thenar tubercle oval (Fig. 3); subarticular tubercles round, prominent; supernumerary palmar tubercles present at the base of all fingers; disc cover finger I slightly expanded, those of fingers III and IV extensively expanded (Fig. 3), outer discs of fingers as wide as those of toes; discs covered with elliptical ventral pads defined by circummarginal grooves. Hind limbs slender; tibia length 50% of SVL; foot length 85% of tibia length; tarsal fold absent, tarsal tubercles low; heel lacking tubercles; toes with narrow lateral fringes; subarticular tubercles round, prominent; inner metatarsal tubercle oval, about 2.4 times the size of subconical outer tubercle; supernumerary plantar tubercles low at the base of all toes; discs covers slightly expanded; toes with defined pads; discs pads nearly elliptical; relative length of toes I < II < III < V < IV; tip of toe V reaching proximal border of distal subarticular tubercle IV; tip of toe II reaching distal border of medial subarticular tubercle of Toe IV.
Figure 2.

Dorsolateral and ventral views (A, B) of the holotype of sp. n., male CORBIDI 15578, SVL = 21.9 mm, showing detail of (C) coloration on shanks and thighs. Photographs by G. Chávez.

Measurements and proportions of the holotype

(in millimeters). SVL = 21.9; HL = 8.5; HW = 8.5; ED = 2.7; EN = 2.5; TD = 0.5; IOD = 3.1; EW = 1.8; IND = 1.9; TL = 10.8; FL = 9.2; HL/SVL = 0.3; HW/SVL = 0.3; EW/IOD = 0.5; TL/SVL = 0.4; FL/SVL = 0.4; FL/TL = 0.8.

Coloration in life.

At night, dorsum, flanks, and dorsal surface of limbs are yellowish-brown with diagonal brown blotches and tiny brown flecks; dorsal surface of head of the same color and bearing a fine creamy yellow canthal stripe which extends to the medial portion of the upper eyelids. Throat yellow, chest and belly are creamy-white with tiny dark flecks; ventral surface of hands, and exterior portion of the ventral surface of foots yellowish-brown; groins, posterior surface of thighs, posterior surface of shanks, and inner portion of the ventral surface of hands bright red. Anterior surface PageBreakof thighs are pinkish-gray with irregular red blotches. Iris golden with fine dark flecks. In daytime, yellowish-brown coloration turns into pale yellow.

Coloration in preservative.

As described above, but yellowish-brown coloration turns creamy-yellow with tiny dark flecks on dorsum, limbs and ventral surfaces of hands and feet; red coloration turned pinkish-white, and venter creamy-yellow; iris gray.

Advertisement call.

A chorus of several males (CORBIDI 15563–68, 15577–78) was recorded at a distance of 1 meter from the microphone; thus the description refers to such context. The general structure of calls in this chorus (2'45’’ recording) is that calls include a variable number of single–pulse notes (Fig. 5). It is possible, considering advertisement calls in similar species, that males emit simpler vocalizations, i.e., single notes separated by longer durations, outside of choruses. Males in the chorus produced calls with 3.3 ± 0.7 notes (range 2–5 notes). Note duration averaged 45.9 ± 12.6 ms (range 31–75 ms). Fundamental frequency averaged 2763 ± 133 ms (range 2531–3094 Hz) and did not vary within or among notes; likely the main source of variation in fundamental frequency was among individuals. Within single notes, much of the energy was concentrated in the first half of the note.
Figure 5.

Oscillogram (above) and spectrogram and of the advertisement call of an uncollected male of sp. n., recorded at the type locality on 21 November 2014 (Tair = 23.0 °C).

Oscillogram (above) and spectrogram and of the advertisement call of an uncollected male of sp. n., recorded at the type locality on 21 November 2014 (Tair = 23.0 °C).

Variation.

Measurements and proportions of the specimens examined are given in Table 1. Dorsal coloration pattern is paler in CORBIDI 15563–64, 15568 than the holotype. Specimen CORBIDI 15565 (Figure 4, D–F) has a minute dorsolateral yellow spot. Specimens CORBIDI 15563–66 have a darker yellow throat.
Table 1.

Measurements and morphological proportions of sp. n. Range is followed by mean value and standard deviation in parenthesis (n = 9 adult males).

Snout-vent length

(SVL)
19.1–21.9 (20.5 ± 0.8)

Head length

(HL)
7.0–8.5 (7.8 ± 0.5)

Head width

(HW)
7.2–8.5 (7.8 ± 0.5)

Upper-eyelid width

(EW)
1.8–1.9 (1.8 ± 0.1)

Interorbital distance

(IOD)
2.2–3.1 (2.8 ± 0.3)

Eye diameter

(ED)
2.3–2.7 (2.6 ± 0.1)

Eye-nostril distance

(EN)
2.2–2.5 (2.3 ± 0.1)

Internarial distance

(IND)
1.6–1.9 (1.7 ± 0.1)

Tibia length

(TL)
9.6–10.8 (10.3 ± 0.4)

Foot length

(FL)
7.7 – 9.2 (8.3 ± 0.5)
HL/SVL0.3–0.4 (0.3 ± 0.1)
HW/SVL0.3–0.4 (0.3 ± 0.1)
FL/SVL0.3–0.4 (0.3 ± 0.1)
EN/SVL0.1 (0.1 ± 0.0)
FL/TL0.7–0.8 (0.8 ± 0.0)
EW/IOD0.5–0.8 (0.6 ± 0.0)
Measurements and morphological proportions of sp. n. Range is followed by mean value and standard deviation in parenthesis (n = 9 adult males). Snout-vent length Head length Head width Upper-eyelid width Interorbital distance Eye diameter Eye-nostril distance Internarial distance Tibia length Foot length

Etymology.

The name is composed of two words in Latin, “pulcher” which means beautiful, and “dormientes” = sleeping, in reference to the chain of mountains located within Tingo María National Park, above the city of Tingo Maria, locally known as Sleeping Beauty (Bella Durmiente), because it looks like a sleeping reclined woman (Figure 6A).
Figure 6.

Habitat of sp. n. in Tingo María National Park: A panoramic view of the Bella Durmiente (Sleeping Beauty) chain of mountains , and B premontane forest at the type locality. Photographs by G. Chávez.

Habitat of sp. n. in Tingo María National Park: A panoramic view of the Bella Durmiente (Sleeping Beauty) chain of mountains , and B premontane forest at the type locality. Photographs by G. Chávez.

Distribution and natural history.

is known from two localities (Fig. 1), Garganta de la Bella, the highest point (1095 m asl) along the trail inside Tingo Maria NP, and Sharco (1700 m asl), approximately 27 km south of the type locality (by airline). Male specimens CORBIDI 15563–68, 15577–78 were collected at the beginning of the rainy season, calling at night, perched on leaves 2 meters above ground in the primary montane forest. Although bromeliads were present, individuals were not observed using these plants. Other vegetation included trees spp. and spp., bamboo patches, ferns, epiphyte plants and lichens (Figure 6B). The ground was covered with leaf litter and rocks. Sympatric species inPageBreakPageBreakclude the amphibians , , , , and , and the reptiles , , , and . One specimen (CORBIDI 16606) was collected calling at night on a leaf 2 m above the ground in a patch of a secondary forest, the habitat strongly affected by human activities such as cattle grazing and orange plantations. The vegetation consisted of trees of spp., spp., and the ground was covered by herbs and bushes. Sympatric amphibians include and .

Discussion

The new species is not assigned to any taxonomic group despite the presence of morphological characters (i.e. head and body dorsoventrally compressed; skin on dorsum finely shagreen and that on venter areolate) suggesting a possible inclusion in the group. Group assignment is currently avoided because of the unclear taxonomic status of the group, as shown by recent phylogenetic studies (Padial et al. 2014; Ortega–Andrade et al. 2015). Further hindering group assignments among frogs of the genus are high species diversity (Hedges et al., 2008), small genetic distances (i.e. complex; Ortega–Andrade et al. 2015), and limitations of morphological characters in defining species groups (Elmer and Cannatella 2008; Hedges et al. 2008; Padial and De la Riva 2009). Furthermore, phylogenetic relationships proposed by Hedges et al. (2008) for species in the putative group are not confirmed by recent studies, such as the strongly supported phylogeny published by Padial et al. (2014). In fact, Hedges et al. (2008) placed outside of the group, but Padial et al. (2014) showed that this species is closely related to species of the putative group, evidencing the complicated taxonomy of this clade. The analysis of genetic distances (uncorrected p-distances) shows that sp. n. is closely related to both and an undescribed species ( sp.) from southeastern Peru (Table 2), which both show clear morphological differences with (Shepack et al. 2016). In contrast, other species such as , , and , show higher genetic distances exceeding 10%. Uncorrected p-distances of the mitochondrial 16S rRNA gene. Comparisons between and the three taxa with lowest p-distances are indicated in bold. At both localities the new species was found in arboreal microhabitats, frequently calling perched on leaves 2 m above the ground. The only other species sharing a similar microhabitat and presumably ecological niche (also nocturnal) was , but this frog was not found in sympatry with , because its altitudinal range of 100–900 m asl does not overlap with the range of from 1095–1700 m asl. With only two known localities, it is difficult to predict the potential distribution range of this species. Although the type locality had a large population and was located inside a protected area, the locality where paratype CORBIDI 16606 was collected PageBreakhad a very fragmented habitat surrounded by orange plantations and corn cropland. Considering that the upper Huallaga drainage is highly disturbed by agriculture activities which fragments the submontane and montane forests (Catenazzi and von May 2014), the distribution of is considered to be highly fragmented with the only known protected population living on an isolated slope of Tingo Maria NP. On the basis of our limited knowledge of its distribution, and according to the IUCN Red List guidelines (2016) we recommend the species be placed in the Data Deficient category of the IUCN Red List of Threatened species.

GenBank accession numbers for the taxa and genes sampled in this study. 1 sp. (ROM 43978) is treated herein as sp. following Padial et al. (2014).

TaxonVoucher Nbr.16S
Pristimantis acuminatus MC 11555 DQ195448
Pristimantis bromeliaceus KU 291702 EF493351
Pristimantis boulengeri MAV 257 DQ195452
Pristimantis cf. mendaxMTD45080 EU186659
Pristimantis dorsopictus MHUAA 7638 KP082874
Pristimantis galdi QCAZ 32368 EU186670
Pristimantis mindo MZUTI 1382 KF801584
Pristimantis mindo MZUTI 1756 KF801581
Pristimantis moro AJC 1860 JN991454
Pristimantis moro AJC 1753 JN991453
Pristimantis omeviridis QCAZ19664 EU130579
Pristimantis pluvialis CORBIDI 11862 KX155577
Pristimantis pluvialis CORBIDI 16695 KX155578
Pristimantis pulchridormientes sp. n. CORBIDI 15563 KX664106
Pristimantis pulchridormientes sp. n. CORBIDI 15566 KX664107
Pristimantis ridens AJC 1778 KR863320
Pristimantis sp. 1 CORBIDI 17473 KX155579
Pristimantis sp. 2ROM 43978 EU186678
Pristimantis subsigillatus MECN 10117 KF801580
  7 in total

1.  A large-scale phylogeny of Amphibia including over 2800 species, and a revised classification of extant frogs, salamanders, and caecilians.

Authors:  R Alexander Pyron; John J Wiens
Journal:  Mol Phylogenet Evol       Date:  2011-06-23       Impact factor: 4.286

2.  Molecular systematics of terraranas (Anura: Brachycephaloidea) with an assessment of the effects of alignment and optimality criteria.

Authors:  José M Padial; Taran Grant; Darrel R Frost
Journal:  Zootaxa       Date:  2014-06-26       Impact factor: 1.091

3.  MAFFT multiple sequence alignment software version 7: improvements in performance and usability.

Authors:  Kazutaka Katoh; Daron M Standley
Journal:  Mol Biol Evol       Date:  2013-01-16       Impact factor: 16.240

4.  APE: Analyses of Phylogenetics and Evolution in R language.

Authors:  Emmanuel Paradis; Julien Claude; Korbinian Strimmer
Journal:  Bioinformatics       Date:  2004-01-22       Impact factor: 6.937

5.  A new species of Psychrophrynella (Amphibia, Anura, Craugastoridae) from the humid montane forests of Cusco, eastern slopes of the Peruvian Andes.

Authors:  Alessandro Catenazzi; Alex Ttito
Journal:  PeerJ       Date:  2016-03-14       Impact factor: 2.984

6.  A new species of Pristimantis (Amphibia, Anura, Craugastoridae) from the foothills of the Andes in Manu National Park, southeastern Peru.

Authors:  Alexander Shepack; Rudolf von May; Alex Ttito; Alessandro Catenazzi
Journal:  Zookeys       Date:  2016-05-30       Impact factor: 1.546

7.  Insights from Integrative Systematics Reveal Cryptic Diversity in Pristimantis Frogs (Anura: Craugastoridae) from the Upper Amazon Basin.

Authors:  H Mauricio Ortega-Andrade; Octavio R Rojas-Soto; Jorge H Valencia; Alejandro Espinosa de Los Monteros; Juan J Morrone; Santiago R Ron; David C Cannatella
Journal:  PLoS One       Date:  2015-11-24       Impact factor: 3.240

  7 in total
  1 in total

1.  A new species of Pristimantis (Amphibia, Anura, Craugastoridae) from a montane forest of the Pui Pui Protected Forest in central Peru (Región Junín).

Authors:  Edgar Lehr; Jiří Moravec
Journal:  Zookeys       Date:  2017-01-12       Impact factor: 1.546

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.