| Literature DB >> 27572850 |
Koji Takayama1,2,3, Yohei Kawakami1,2,3, Mitra Lavasani1,2, Xiaodong Mu1,2,4,5, James H Cummins1,2,4, Takashi Yurube1, Ryosuke Kuroda3, Masahiro Kurosaka3, Freddie H Fu1, Paul D Robbins6, Laura J Niedernhofer6, Johnny Huard1,2,4,5.
Abstract
Mice expressing reduced levels of ERCC1-XPF (Ercc1-/Δ mice) demonstrate premature onset of age-related changes due to decreased repair of DNA damage. Muscle-derived stem/progenitor cells (MDSPCs) isolated from Ercc1-/Δ mice have an impaired capacity for cell differentiation. The mammalian target of rapamycin (mTOR) is a critical regulator of cell growth in response to nutrient, hormone, and oxygen levels. Inhibition of the mTOR pathway extends the lifespan of several species. Here, we examined the role of mTOR in regulating the MDSPC dysfunction that occurs with accelerated aging. We show that mTOR signaling pathways are activated in Ercc1-/Δ MDSPCs compared with wild-type (WT) MDSPCs. Additionally, inhibiting mTOR with rapamycin promoted autophagy and improved the myogenic differentiation capacity of the Ercc1-/Δ MDSPCs. The percent of apoptotic and senescent cells in Ercc1-/Δ MDSPC cultures was decreased upon mTOR inhibition. These results establish that mTOR signaling contributes to stem cell dysfunction and cell fate decisions in response to endogenous DNA damage. Therefore, mTOR represents a potential therapeutic target for improving defective, aged stem cells.Entities:
Keywords: ERCC1-XPF; aging; biology; mTOR; muscle; progeria; senescence; stem cells
Mesh:
Substances:
Year: 2016 PMID: 27572850 PMCID: PMC5516198 DOI: 10.1002/jor.23409
Source DB: PubMed Journal: J Orthop Res ISSN: 0736-0266 Impact factor: 3.494
Primer Sequences and Product Side for Real‐Time PCR
| Gene | 5′ DNA Sequence 3′ | Amplicon Length (bp) | |
|---|---|---|---|
|
| Forward | 5′‐CCAGGCTGCGGAGGCAATCA‐3′ | 115 |
| Reverse | 5′‐GGCCAGCTGCTCTTTCAGGTCG‐3′ | ||
|
| Forward | 5′‐TTCCCTCGAGCAGGCTTCGG‐3′ | 147 |
| Reverse | 5′‐GCCATAGGATGGCGCTCGGG‐3′ | ||
|
| Forward | 5′‐CCGTCGTGGATCTGACGTG‐3′ | 146 |
| Reverse | 5′‐GTTGCTGTTGAAGTCGCAGG‐3′ |
Figure 1Measuring mTOR activity and autophagy in MDSPCs isolated from progeroid Ercc1 −/Δ mice. (A) Shown is a representative image of immunoblotting to measure mTOR, p‐mTOR, p‐4E‐BP1, and p‐p70 S6 expression in MDSPCs isolated from Ercc1 −/Δ and WT mice cultured with and without rapamycin. (B) Quantification of p‐mTOR, p‐4E‐BP1, and p‐p70 S6 expression relative to GAPDH. Error bars indicate the standard deviation. Statistical significance was determined using one‐way ANOVA or the Kruskal–Wallis test with Tukey–Kramer or Scheffe's post hoc test (n = 4). ### p < 0.001 versus WT‐DMSO, ***p < 0.001 versus ERCC1 −/Δ‐DMSO. (C) Representative image of immunoblotting to measure autophagy markers LC3 I and II expression in MDSPCs isolated from Ercc1 −/Δ and WT mice cultured with and without rapamycin. (D) Quantification of LC3II expression relative to GAPDH expression. Error bars indicate the standard deviation. Statistical significance was determined using the Kruskal–Wallis test with Scheffe's post hoc test (n = 4). ### p < 0.001 versus WT‐DMSO, ***p < 0.001 versus Ercc1 −/Δ‐DMSO. (E) Proliferation of MDSPCs measured using live‐cell imaging. Error bars indicate the standard deviation. Statistical significance was determined using one‐way ANOVA with Tukey–Kramer post hoc test (n = 4). ### p < 0.001 versus WT‐DMSO.
Figure 2Measuring the effect of rapamycin on apoptosis in MDSPCs isolated from progeroid Ercc1 −/Δ mice. (A) Representative images of TUNEL assay. Live cells (DAPI: blue), apoptotic cells (yellow–green), and merged figures. Scale bar = 100 µm. (B) The percentage of TUNEL‐positive cells was counted from images obtained from four independent MDSPC populations per genotype and treatment group. Error bars indicate the standard deviation. ### p < 0.001 versus WT‐DMSO, ***p < 0.001 versus ERCC1 −/Δ‐DMSO. Statistical significance was determined using the Kruskal–Wallis test with Scheffe's post hoc test. (C) Immunoblotting to measure the expression of cleaved PARP, an apoptosis‐related marker, in MDSPCs isolated from Ercc1 −/Δ and WT mice cultured with and without rapamycin.
Figure 3Measuring the effect of rapamycin on senescence in MDSPCs isolated from progeroid Ercc1 −/Δ mice. (A) The histogram indicates the percent of SA β‐gal‐positive cells from four independent MDSPC populations from each genotype and treatment group. Error bars indicate the standard deviation. ### p < 0.001 versus WT‐DMSO, ***p < 0.001 versus Ercc1 −/Δ‐DMSO. Statistical significance was determined using one‐way ANOVA test with Scheffe's post hoc test. (B) Immunoblotting to measure the expression of senescence‐related markers p16 and p21 in MDSPCs isolated from Ercc1 −/Δ and WT mice cultured with and without rapamycin.
Figure 4Measuring the effect of rapamycin on the myogenic differentiation of MDSPCs isolated from progeroid Ercc1 −/Δ mice. (A) Images of in vitro myogenic differentiation. Cells were immunostained for the terminal differentiation marker, f‐MyHC (red). Scale bar = 50 µm. (B) Quantification of myogenic differentiation was calculated as the fraction of cells (DAPI, blue) expressing f‐MyHC (red) from four independent MDSPC populations. Error bars indicate the standard deviation. Statistical significance was determined using one‐way ANOVA test with Tukey–Kramer post hoc test. ### p < 0.001 versus WT‐DMSO, ***p < 0.001 versus Ercc1 −/Δ‐DMSO. (C and D). Quantitative RT‐PCR to measure the expression levels of the myogenic differentiation markers MyHC and desmin after myogenic differentiation of MDSPCs isolated from Ercc1 −/Δ and WT mice, cultured with and without rapamycin. Error bars indicate the standard deviation. Statistical significance was determined using one‐way ANOVA test with Tukey–Kramer or Scheffe's post hoc test (n = 4). ### p < 0.001 versus WT‐DMSO, **p < 0.01, ***p < 0.001 versus Ercc1 −/Δ‐DMSO.