Ruilong Yang1,2, Mingxia Ren2, Qi Rui1, Dayong Wang2. 1. College of Life Sciences, Nanjing Agricultural University, Nanjing 210095, China. 2. Key Laboratory of Environmental Medicine Engineering in Ministry of Education, Medical School, Southeast University, Nanjing 210009, China.
Abstract
Recently, several dysregulated microRNAs (miRNAs) have been identified in organisms exposed to graphene oxide (GO). However, their biological functions and mechanisms of the action are still largely unknown. Here, we investigated the molecular mechanism of mir-231 in the regulation of GO toxicity using in vivo assay system of Caenorhabditis elegans. We found that GO exposure inhibited the expression of mir-231::GFP in multiple tissues, in particular in the intestine. mir-231 acted in intestine to regulate the GO toxicity, and overexpression of mir-231 in intestine caused a susceptible property of nematodes to GO toxicity. smk-1 encoding a homologue to mammalian SMEK functioned as a targeted gene for mir-231, and was also involved in the intestinal regulation of GO toxicity. Mutation of smk-1 gene induced a susceptible property to GO toxicity, whereas the intestinal overexpression of smk-1 resulted in a resistant property to GO toxicity. Moreover, mutation of smk-1 gene suppressed the resistant property of mir-231 mutant to GO toxicity. In nematodes, SMK-1 further acted upstream of the transcriptional factor DAF-16/FOXO in insulin signaling pathway to regulate GO toxicity. Therefore, mir-231 may encode a GO-responsive protection mechanism against the GO toxicity by suppressing the function of the SMK-1 - DAF-16 signaling cascade in nematodes.
Recently, several dysregulated microRNAs (miRNAs) have been identified in organisms exposed to graphene oxide (GO). However, their biological functions and mechanisms of the action are still largely unknown. Here, we investigated the molecular mechanism of mir-231 in the regulation of GOtoxicity using in vivo assay system of Caenorhabditis elegans. We found that GO exposure inhibited the expression of mir-231::GFP in multiple tissues, in particular in the intestine. mir-231 acted in intestine to regulate the GOtoxicity, and overexpression of mir-231 in intestine caused a susceptible property of nematodes to GOtoxicity. smk-1 encoding a homologue to mammalian SMEK functioned as a targeted gene for mir-231, and was also involved in the intestinal regulation of GOtoxicity. Mutation of smk-1 gene induced a susceptible property to GOtoxicity, whereas the intestinal overexpression of smk-1 resulted in a resistant property to GOtoxicity. Moreover, mutation of smk-1 gene suppressed the resistant property of mir-231 mutant to GOtoxicity. In nematodes, SMK-1 further acted upstream of the transcriptional factor DAF-16/FOXO in insulin signaling pathway to regulate GOtoxicity. Therefore, mir-231 may encode a GO-responsive protection mechanism against the GOtoxicity by suppressing the function of the SMK-1 - DAF-16 signaling cascade in nematodes.
Graphene oxide (GO) is a carbon-based, two-dimensional engineered nanomaterial (ENM) with a high coefficient of thermal conduction and large surface area that is chemically stable, amphipathic and easy to be functionalized1. These properties make GO very attractive for several commercial and medical applications, including drug delivery and bioimaging23. However, toxicological studies in mammals have shown that GO exposure could result in the induction of oxidative stress and organ system dysfunctions such as pulmonary and reproductive toxicity45. The classic model animal of nematode Caenorhabditis elegans is an important non-mammalian alternative for toxicological study67. Previous studies using nematodes have demonstrated that GO exposure could lead to toxic effects on the functions of both primary (such as intestine) and secondary (such as neuron and reproductive organs) targeted organs8910111213. Furthermore, the activation of oxidative stress, enhanced intestinal permeability, disrupted innate immune response, and prolonged defecation cycle length were found to contribute to the formation of GOtoxicity in nematodes91011.So far, the underlying molecular mechanisms of GOtoxicity have for the most part remained elusive. Recent studies have implicated specific signaling pathways, including the Toll-like receptor 4 (TLR4) and the c-Jun N-terminal kinase (JNK) signaling pathways, in the control of GOtoxicity in macrophages or nematodes1415. Moreover, some dysregulated mRNAs or microRNAs (miRNAs) have been identified in GO exposed humanHepG2 and GLC-82 cells as well as in nematodes161718. Short noncoding miRNAs exist in many organisms and usually act post-transcriptionally to inhibit the expression of targeted genes19. Therefore, the characterization of candidate miRNAs and their roles in regulating GOtoxicity will further improve our understanding of the underlying molecular mechanisms of GOtoxicity.Our previous studies have demonstrated that GO exposure resulted in the dysregulation of 1965 mRNAs and 31 miRNAs in nematodes1518. One of these dysregulated miRNAs, mir-231, was down-regulated in response to GO exposure, and mutation of mir-231 induced a resistant property to GOtoxicity in nematodes18. In nematodes, mir-231 is expressed from embryonic through adult stages, and is expressed in the intestine, pharynx, hypodermis, and neurons in adults2021. So far, the biological functions of mir-231 are still largely unknown. In the present study, we employed the in vivo assay system of C. elegans to investigate the molecular mechanisms of mir-231 in regulating GOtoxicity. The C. elegans protein SMK-1 is orthologous to mammalian SMEK (suppressor of MEK null) and essential for the function of DAF-16-mediated longevity22. daf-16 gene encodes the transcriptional factor DAF-16/FOXO in the insulin signaling pathway23. Our results suggest that mir-231 may regulate GOtoxicity by suppressing the function of SMK-1-DAF-16 signaling cascade in nematodes. Our study underlines the importance of mir-231 in encoding a protection mechanism against GOtoxicity.
Results
Physicochemical properties of GO
The thickness of GO was approximately 1.0 nm in topographic height, corresponding to the property of approximately one layer (Fig. 1a). Sizes of most of the GO in K-medium after sonication were in the range of 40–50 nm (Fig. 1b). Raman spectroscopy assay showed the existence of D-band signal of GO, suggesting the introduction of disorder into graphite layer (Fig. 1c). In Raman spectroscopy, GO showed a G band at 1598 cm−1 and a D band at 1331 cm−1, respectively (Fig. 1c). Zeta potential of GO (100 mg/L) in K-medium was −21.5 ± 2.6 mV.
Figure 1
Physiochemical properties of GO.
(a) AFM analysis of GO. (b) Size distribution of GO. (c) Raman spectrum of GO.
Effect of GO exposure on spatial expression of mir-231 in nematodes
Using transgenic strain of maIs218, we investigated the effect of GO exposure on spatial expression of mir-231::GFP in nematodes. mir-231::GFP is expressed in pharynx, intestine, neurons, and hypodermis (Fig. 2). Especially, mir-231::GFP is predominantly expressed in intestine (Fig. 2). GO at the concentration of 100 mg/L caused the reduction in lifespan, decrease in locomotion behavior, and significant induction of reactive oxygen species (ROS) production in nematodes9. After prolonged exposure, we observed that GO (100 mg/L) significantly decreased the fluorescence intensity of mir-231::GFP in pharynx, intestine, neurons, and hypodermis compared with control (Fig. 2). Moreover, the more sharp reduction in fluorescence intensity of mir-231::GFP was observed in intestine of GO (100 mg/L) exposed nematodes (Fig. 2).
Figure 2
Effects of GO exposure on mir-231::GFP expression in nematodes.
Asterisks indicate the pharynx and intestine in the head and mid-region, respectively. Arrowheads indicate the neurons and hypodermis in the head and mid-region, respectively. GO exposure concentration was 100 mg/L. Prolonged exposure was performed from L1-larvae to young adults. Bars represent means ± SD. **P < 0.01 vs control.
Tissue-specific activity of mir-231 in regulating GO toxicity in nematodes
Using tissue-specific promoters, we next investigated the tissue-specific activity of mir-231 in regulating GOtoxicity in nematodes. mir-231(n4571) mutant had a normal lifespan and locomotion behavior (Fig. 3). Loss-of-function mutation of mir-231 induced a resistant property to GOtoxicity on lifespan and locomotion behavior in nematodes (Fig. 3). Rescue assay by expression of mir-231 in the neurons, pharynx, or hypodermis did not significantly affect the resistant property to GOtoxicity on lifespan and locomotion behavior in mir-231(n4571) mutant nematodes (Fig. 3). In contrast, expression of mir-231 in the intestine significantly suppressed the resistant property to GOtoxicity on lifespan and locomotion behavior in mir-231(n4571) mutant nematodes (Fig. 3). Therefore, mir-231 may act in the intestine to positively regulate GOtoxicity in nematodes.
Figure 3
Tissue-specific activity of mir-231 in regulating GO toxicity in nematodes.
(a) Tissue-specific activity of mir-231 in regulating GO toxicity on lifespan in nematodes. (b) Tissue-specific activity of mir-231 in regulating GO toxicity on locomotion behavior in nematodes. GO exposure concentration was 100 mg/L. Prolonged exposure was performed from L1-larvae to young adults. Bars represent means ± SD. **P < 0.01.
Overexpression of mir-231 in the intestine induced a susceptible property to GO toxicity in nematodes
To confirm the intestine-specific activity of mir-231 in positively regulating GOtoxicity, we constructed the transgenic strain Ex(Pges-1-mir-231) which overexpresses mir-231 specifically in the intestine. Overexpression of mir-231 in this transgenic strain was confirmed by assessing the levels of mir-231 transcription (Fig. S1). Transgenic strain of Ex(Pges-1-mir-231) had the similar phenotypes of lifespan, locomotion behavior, and intestinal ROS production to those in wild-type nematodes (Fig. 4). Moreover, GO (10 mg/L) exposed transgenic strain of Ex(Pges-1-mir-231) exhibited more severe reduction in lifespan, decrease in locomotion behavior, and induction of intestinal ROS production than GO (100 mg/L) exposed wild-type nematodes (Fig. 4). These results suggest that mir-231 overexpression in the intestine can induce a susceptible property to GOtoxicity in nematodes.
Figure 4
Effects of mir-231 overexpression in intestine on GO toxicity in nematodes.
(a) Effects of mir-231 overexpression in intestine on GO toxicity in reducing lifespan in nematodes. (b) Effects of mir-231 overexpression in intestine on GO toxicity in decreasing locomotion behavior in nematodes. (c) Effects of mir-231 overexpression in intestine on GO toxicity in inducing intestinal ROS production in nematodes. GO exposure concentration was 100 mg/L. Prolonged exposure was performed from L1-larvae to young adults. Bars represent means ± SD. **P < 0.01 vs N2.
smk-1 might act as a potential targeted gene for mir-231 in nematodes
We identified 93 putative mir-231 targeted genes including smk-1 using the TargetScan tool. The biological functions of the predicted targeted genes for mir-231 were either unknown or associated with the development in nematodes. mir-231 was predicted to act as an upstream regulator for smk-1 by binding its 3′-UTR. The expression of smk-1 gene was significantly higher in the loss-of-function mir-231(n4571) mutant than in wild-type nematodes (Fig. 5a), implying that mir-231 may suppress the expression of smk-1 gene in nematodes.
Figure 5
Effects of smk-1 mutation on GO toxicity in nematodes.
(a) Effect of mir-231 mutation on expression of smk-1 gene. (b) Effects of smk-1 mutation on GO toxicity in reducing lifespan in nematodes. (c) Effects of smk-1 mutation on GO toxicity in decreasing locomotion behavior in nematodes. (d) Effects of smk-1 mutation on GO toxicity in inducing intestinal ROS production in nematodes. GO exposure concentration was 100 mg/L. Prolonged exposure was performed from L1-larvae to young adults. Bars represent means ± SD. **P < 0.01 vs N2.
SMK-1 confered protection against GO toxicity in nematodes
We next investigated the role of SMK-1 in GO susceptibility in nematodes using the smk-1(mn156) mutant. In the absence of GO, the smk-1(mn156) mutant had a reduced lifespan, normal locomotion behavior, and no significant induction of intestinal ROS production (Fig. 5b–d). After prolonged exposure to GO (100 mg/L), smk-1(mn156) mutant showed the more severe reduction in lifespan, decrease in locomotion behavior, and induction of intestinal ROS production than wild-type nematodes (Fig. 5b–d). Since the smk-1(mn156) mutant was more susceptible to GOtoxicity than wild-type nematodes, SMK-1 appears to confer protection against GOtoxicity in nematodes.
Genetic interaction between mir-231 and smk-1 in regulating GO toxicity in nematodes
To assess the interaction between mir-231 and smk-1 in regulating GOtoxicity, we compared the GOtoxicity in double mutant of mir-231(n4571);smk-1(mn156) with that in single mutant of mir-231(n4571) or smk-1(mn156). After exposure to GO (100 mg/L), the lifespan, locomotion behavior, and induction of intestinal ROS production in double mutant of mir-231(n4571);smk-1(mn156) were similar to those in single mutant of smk-1(mn156) (Fig. 6), indicating that the GO resistance of the mir-231(n4571) mutant could be reversed by the loss of smk-1 in nematodes. Therefore, mir-231 may inhibit the ability of smk-1 to protect against GOtoxicity in nematodes.
Figure 6
Genetic interaction between mir-231 and smk-1 in regulating GO toxicity in nematodes.
(a) Genetic interaction between mir-231 and smk-1 in regulating GO toxicity in reducing lifespan in nematodes. (b) Genetic interaction between mir-231 and smk-1 in regulating GO toxicity in decreasing locomotion behavior in nematodes. (c) Genetic interaction between mir-231 and smk-1 in regulating GO toxicity inducing intestinal ROS production in nematodes. GO exposure concentration was 100 mg/L. Prolonged exposure was performed from L1-larvae to young adults. Bars represent means ± SD. **P < 0.01 vs N2 (if not specially indicated).
Tissue-specific activity of smk-1 in regulating GO toxicity in nematodes
In C. elegans, smk-1 gene is expressed in intestine, pharynx, neurons, muscle, and hypodermis23. Using tissue-specific promoters, we investigated the tissue-specific activity of smk-1 in negatively regulating GOtoxicity in nematodes. The tissue-restricted expression of smk-1 in the pharynx, neurons, muscle or hypodermis did not significantly influence the lifespan or locomotion behavior in smk-1(mn156) mutant nematodes exposed to GO (100 mg/L) (Fig. 7). However, expression of smk-1 in the intestine significantly increased the lifespan and locomotion behavior in smk-1(mn156) mutant nematodes exposed to GO (100 mg/L) (Fig. 7). These results suggest that smk-1 may also act in the intestine to protect against GOtoxicity in nematodes.
Figure 7
Tissue-specific activity of smk-1 in regulating GO toxicity in nematodes.
(a) Tissue-specific activity of smk-1 in regulating GO toxicity on lifespan in nematodes. (b) Tissue-specific activity of smk-1 in regulating GO toxicity on locomotion behavior in nematodes. GO exposure concentration was 100 mg/L. Prolonged exposure was performed from L1-larvae to young adults. Bars represent means ± SD. **P < 0.01.
Intestinal overexpression of smk-1 induced a resistant property to GO toxicity in nematodes
To further characterize the intestine-specific activity of smk-1 in negatively regulating GOtoxicity, we constructed the transgenic strain Is(Pges-1-smk-1) which overexpresses smk-1 specifically in the intestine. The transgenic strain of Is(Pges-1-smk-1) had an increased lifespan compared with wild-type nematodes, but had the similar locomotion behavior and intestinal ROS production to those in wild-type nematodes (Fig. 8). Exposure to GO (100 mg/L) did not affect the lifespan of the transgenic strain Is(Pges-1-smk-1) (Fig. 8a). Moreover, the locomotion behavior and intestinal ROS production in GO-treated Is(Pges-1-smk-1) nematodes were comparable to those in wild-type or untreated Is(Pges-1-smk-1) nematodes (Fig. 8b,c). Therefore, our results suggest that the intestinal overexpression of smk-1 can induce resistance to GOtoxicity in nematodes.
Figure 8
Effects of smk-1 over expression in intestine on GO toxicity in nematodes.
(a) Effects of smk-1 overexpression in intestine on GO toxicity in reducing lifespan in nematodes. (b) Effects of smk-1 overexpression in intestine on GO toxicity in decreasing locomotion behavior in nematodes. (c) Effects of smk-1 overexpression in intestine on GO toxicity in inducing intestinal ROS production in nematodes. GO exposure concentration was 100 mg/L. Prolonged exposure was performed from L1-larvae to young adults. Bars represent means ± SD. **P < 0.01 vs N2.
Genetic interaction between smk-1 and daf-16 in regulating GO toxicity in nematodes
An earlier study suggested a possible genetic interaction between smk-1 and daf-16 in regulating biological processes such as longevity23. Under normal condition, the lifespan of the double mutant of daf-16(RNAi);smk-1(mn156) was similar to that in single mutant of daf-16(RNAi) or smk-1(mn156) (Fig. 9a). To determine the interaction between smk-1 and daf-16 in regulating GOtoxicity, we compared the GOtoxicity in the double mutant of daf-16(RNAi);smk-1(mn156) with that in single mutant of daf-16(RNAi) or smk-1(mn156). After exposure to GO (100 mg/L), the lifespan and locomotion behavior in the double mutant of daf-16(RNAi);smk-1(mn156) were similar to those in single mutant of smk-1(mn156) or daf-16(RNAi) nematodes (Fig. 9a,b). Therefore, both smk-1 and daf-16 are required to protect against GOtoxicity and may act in the same genetic pathway in nematodes.
Figure 9
Genetic interaction between smk-1 and daf-16 in regulating GO toxicity in nematodes.
(a) Genetic interaction between smk-1 and daf-16 in regulating GO toxicity in reducing lifespan in nematodes. (b) Genetic interaction between smk-1 and daf-16 in regulating GO toxicity in decreasing locomotion behavior in nematodes. (c) Effect of RNAi knockdown of daf-16 gene on lifespan in GO exposed transgenic nematodes overexpressing smk-1 in intestine. (d) Effect of RNAi knockdown of daf-16 gene on locomotion behavior in GO exposed transgenic nematodes overexpressing smk-1 in intestine. GO exposure concentration was 100 mg/L. Prolonged exposure was performed from L1-larvae to young adults. Bars represent means ± SD. **P < 0.01 vs N2 (if not specially indicated).
SMK-1 acted upstream of DAF-16 to regulate GO toxicity in nematodes
To determine the order in which smk-1 and daf-16 act in regulating GOtoxicity, we examined the effects of RNA interference (RNAi) knockdown of daf-16 gene on lifespan and locomotion behavior in GO exposed transgenic nematodes overexpressing smk-1 in the intestine. Interestingly, we found that the RNAi knockdown of daf-16 gene significantly suppressed the protective effects of smk-1 overexpression on both the lifespan and the locomotion behavior of GO-exposed nematodes (Fig. 9c,d). These results suggest that smk-1 may act upstream of daf-16 to protect against GOtoxicity in nematodes.In addition, loss-of-function mutation of daf-16 gene did not affect mir-231 expression under normal conditions or in response to 100 mg/L GO (Fig. S2). These data imply that mir-231 may not act downstream of the transcriptional factor DAF-16 to regulate biological events in nematodes.
Discussion
In nematodes, GO exposure caused the decrease in both the transcriptional expression of mir-23118 and the mir-231::GFP in the pharynx, intestine, neurons, and hypodermis (Fig. 2). It has been shown that loss-of-function mutation of mir-231 induced a resistant property of nematodes to GOtoxicity (Fig. 3)18. These results imply that mir-231 might encode an important molecular signaling in nematodes to protect against potential GOtoxicity. Previous study has also suggested that mir-231 expression was increased during late developmental stages in adult nematodes24, implying its involvement in the anti-aging protection mechanism in nematodes.In nematodes, mir-231 is expressed in several tissues including the intestine, pharynx, hypodermis, and neurons21. GO exposure could decrease the expression of mir-231::GFP in all these tissues, especially in the intestine (Fig. 2). Tissue-specific activity assays indicated that mir-231 acted in the intestine to regulate the GOtoxicity on lifespan and locomotion behavior in nematodes (Fig. 3). Intestinal barrier has been shown to play crucial roles in protecting nematodes from toxic ENMs such as quantum dots (QDs) or GO in nematodes1325. Our data imply that mir-231 may be involved in the control of intestinal signaling pathways in GO exposed nematodes. The increased sensitivity to GOtoxicity in nematodes overexpressing mir-231 in the intestine further confirmed this possibility (Fig. 4). Nevertheless, the potential functions of mir-231 in the pharynx, hypodermis, and neurons are still unclear in nematodes.Evidence suggests that miRNAs with lengths of about 22 nt may suppress the functions of targeted gene by inhibiting the translation of mRNAs by imprecise antisense base-pairing26. In this study, we raised several lines of evidence to demonstrate that smk-1 may be a targeted gene for mir-231 that functions to protect nematodes against GOtoxicity. First, we observed that the expression of smk-1 was increased in loss-of-function mutation of mir-231 (Fig. 5a). Furthermore, in contrast to the phenotypes in GO-exposed mir-231 mutant nematodes, GO-exposed smk-1 mutants presented with increased GO sensitivity (Fig. 5b–d). It has also been shown that the smk-1(mn156) mutation results in enhanced radiosensitivity from proton microbeam exposure27. In addition, mutation of smk-1 gene reversed the GO-resistant property of mir-231 mutants (Fig. 6), and overexpression of smk-1 lacking its 3′-UTR prevented the increased GO sensitivity of nematodes overexpressing mir-231 (Fig. S3). Surprisingly, under normal condition, we found that the long-lived phenotype of nematodes overexpressing smk-1 was not observed in mir-231 mutant nematodes. However, it is possible that mir-231 can regulate longevity through other yet to be identified targeted genes with different functions from smk-1 in nematodes.More importantly, genetic interaction assay suggested that SMK-1 and DAF-16 functioned in the same genetic pathway to regulate the GOtoxicity (Fig. 9a,b). We further determined that DAF-16 acted downstream of SMK-1 to protect against GOtoxicity in nematodes (Fig. 9c,d). An earlier study has described the importance of the SMK-1-DAF-16 signaling cascade in the control of longevity23. In the present study, our results further suggest a novel function of the SMK-1-DAF-16 signaling cascade in the control of nanotoxicity in nematodes.Recently, it has been reported that GO exposure could result in the toxicity on nematodes by dysregulating functions of the intestinal insulin signaling pathway, and GO suppressed the expression of daf-16 gene in nematodes28. Therefore, GO exposure may result in a novel dual regulation mechanism in the nematode intestine, a primary targeted organ for GOtoxicity (Fig. 10). On the one hand, GO exposure can induce the toxic effects on lifespan, locomotion behavior, and intestinal function by suppressing the function of DAF-16 in the insulin signaling pathway. At the same time, GO exposure can activate a protection mechanism in nematodes by inhibiting the expression of mir-231. The inhibited expression of mir-231 can lead to the activation of function of the SMK-1-DAF-16 signaling cascade, which in turn reduces GOtoxicity in nematodes. This identified dual regulation mechanism implies that mir-231 could be a potential candidate gene for the design of chemical modification or the selection of certain loaded drugs for GO for the aim of reducing the GOtoxicity. Another dual regulation mechanism between mir-360 and CEP-1 in the control of GO induced germline apoptosis was recently identified in the gonads, a secondary targeted organ of GO in nematodes29.
Figure 10
A diagram showing the mir-231-mediated molecular signaling in the control of GO toxicity in nematodes.
Previous study has demonstrated the important function of DAF-16 in the control of GO toxicity in nematodes29.
In conclusion, we investigated the mir-231-mediated molecular mechanisms underlying the response to GO exposure in C. elegans. We first identified the intestine-specific activity of mir-231 in the regulation of GOtoxicity. In the intestine, mir-231 increased the effects of GOtoxicity by suppressing the function of its target gene smk-1. SMK-1 acted upstream of DAF-16 in the insulin signaling pathway to protect against GOtoxicity. Therefore, we discovered a new dual regulation mechanism between the mir-231 and the SMK-1-DAF-16 signaling cascade in the control of GOtoxicity in the intestine, the primary targeted organ of GO in nematodes. C. elegansmir-231 an ortholog of human miR-99 and miR-55630. Considering the extensive conservation of microRNAs in biology30, our results may lead to the discovery of important functions of mir-231 and its homologues in regulating nanotoxicity in organisms.
Methods
Preparation of GO
GO was prepared from natural graphite powder according to the modified Hummer’s method31. After addition of graphite (2 g) and sodium nitrate (1 g) into a 250-mL flask, concentrated H2SO4 (50 mL) was added on ice, and KMnO4 (7 g) was further added. When temperature of the mixture warmed to 35 °C, H2O (90 mL) was slowly dripped into the paste. Diluted suspension was stirred at 70 °C for 15 min, and treated with a mixture of 7 mL of 30% H2O2 and 55 mL of H2O. The resulting warm suspension was filtered to obtain a yellow-brown filter cake, which was further washed with a solution of 3% HCl, followed by drying at 40 °C for 24 h. GO was obtained by ultrasonication of the as-made graphite oxide in water for 1 h.
Characterization of GO
The prepared GO was characterized by atomic force microscopy (AFM, SPM-9600, Shimadzu, Japan), Raman spectroscopy using 632 nm wavelength excitation (Renishaw Invia Plus laser Raman spectrometer, Renishaw, UK), and zeta potential analyzed using a dynamic light scattering technique. To perform the AFM assay, GO suspension was pipetted on Si substrates, air-dried, and placed under AFM tip.
C. elegans strains and exposure
Nematodes used were wild-type N2, mutants of mir-231(n4571), smk-1(mn156), daf-16(mu86), and mir-231(n4571);smk-1(mn156), and transgenic strains of maIs218[mir-231::GFP], Ex(Pges-1-mir-231), mir-231(n4571)Ex(Pges-1-mir-231), mir-231(n4571)Ex(Pmyo-2-mir-231), mir-231(n4571)Ex(Punc-14-mir-231), mir-231(n4571)Ex(Pdpy-7-mir-231), Is(Pges-1-smk-1), smk-1(mn156)Ex(Pges-1-smk-1), smk-1(mn156)Ex(Pmyo-2-smk-1), smk-1(mn156)Ex(Pmyo-3-smk-1), smk-1(mn156)Ex(Punc-14-smk-1), smk-1(mn156)Ex(Pdpy-7-smk-1), and Ex(Pges-1-mir-231);Is(Pges-1-smk-1). Some of them were from Caenorhabditis Genetics Center (funded by NIH Office of Research Infrastructure Programs (P40 OD010440)). Gravid nematodes were maintained on nematode growth medium (NGM) plates seeded with Escherichia coli OP50 at 20 °C32. Nematodes were lysed with a bleaching mixture (0.45 M NaOH, 2% HOCl) to obtain age synchronous L1-larvae populations as described33.
Exposure and toxicity assessment
GO was sonicated for 30 min (40 kHz, 100 W), and then dispersed in K medium to prepare a stock solution (1 mg/mL). GO at the working concentration (100 mg/L) was prepared by diluting the stock solution with K medium. Prolonged exposure to GO was performed from L1-larvae to young adults in 12-well sterile tissue culture plates at 20 °C in the presence of food (OP50). After exposure, nematodes were used for the toxicity assessment using lifespan, locomotion behavior, and intestinal ROS production as the endpoints.Lifespan was assayed at 20 °C basically as described3435. During the lifespan assay, hermaphrodite nematodes were transferred daily for the first 7 days of adulthood. Nematodes would be checked every day, and were scored as dead if they did not move even after repeated taps with a pick. Sixty nematodes were examined per treatment, and three replicates were performed.Endpoints of head thrash and body bend were used to reflect the locomotion behavior of nematodes as described3637. Head thrash and body bend were assessed by under the dissecting microscope bye eyes. A head thrash is defined as a change in the direction of bending at the mid body. A body bend is defined as a change in the direction of the part of the nematodes corresponding to the posterior bulb of the pharynx along the y axis, assuming that nematode was traveling along the x axis. Twenty nematodes were examined per treatment, and six replicates were performed.Intestinal ROS production was analyzed as described previously3839. Intestinal ROS production reflects the functional state of intestine. The examined nematodes were transferred to 1 μM of 5′,6′-chloromethyl-2′,7′-dichlorodihydro-fluorescein diacetate (CM-H2DCFDA; Molecular Probes) to incubate for 3 h at 20 °C in the dark. Nematodes were then mounted on 2% agar pads for the examination at 488 nm of excitation wavelength and 510 nm of emission filter under a laser scanning confocal microscope (Leica, TCS SP2, Bensheim, Germany). Relative fluorescence intensity in intestine was semi-quantified, and the semiquantified ROS was expressed as relative fluorescence units (RFU) and normalized to autofluorescence. Twenty nematodes were examined per treatment, and six replicates were performed.
Bioinformatics analysis for targeted gene prediction of mir-231
The corresponding targeted genes for mir-231 were predicted using TargetScan version 6.2 (http://www.targetscan.org/worm_52/). TargetScan is a tool used for predicting biological targets of certain miRNA by searching for the presence of conserved sites that match seed region of a miRNA.
Reverse-transcription and quantitative real-time polymerase chain reaction (qRT-PCR)
Total RNAs were extracted using RNeasy Mini kit (Qiagen), and reverse transcribed using PrimeScript TM RT reagent kit (Takara, Otsu, Shiga, Japan). After cDNA synthesis, real-time PCR was performed using SYBR Premix Ex Taq™ (Takara) for the amplification of PCR products. Real-time PCR was performed using primers for target gene of smk-1 (forward primer, 5′-ATGTCGGACACAAAAGAGGT-3′; reverse primer, 5′-ATCCACCTGTTTTTCATCAA-3′), and reference gene of tba-1 (forward primer, 5′-TCAACACTGCCATCGCCGCC-3′; reverse primer, 5′-TCCAAGCGAGACCAGGCTTCAG-3′). Real-time PCR was run at the optimized annealing temperature of 58 °C. Relative quantification of targeted gene in comparison to reference tba-1 gene was determined, and the final results were expressed as relative expression ratio between targeted gene and reference gene. To analyze the transcriptional expression of mir-231, the primer used for the transcription of mir-231 was GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTACAAG. The primer for qRT-PCR of mir-231 was CTGACTGTTTCAAAAGCTTGTA, and the common reward primer was GTGCAGGGTCCGAGGT. All reactions were performed in triplicate.
DNA constructs and germline transformation
To generate entry vector carrying promoter sequence, promoter region for ges-1 gene specially expressed in intestine, unc-14 gene specially expressed in neurons, myo-3 gene specially expressed in muscle, dpy-7 gene specially expressed in hypodermis, or myo-2 gene specially expressed in pharynx was amplified by PCR from wild-type C. elegans genomic DNA. These promoter fragments were inserted into pPD95_77 vector in the sense orientation. smk-1/F41E6.4a cDNA or mir-231 was amplified by PCR, and inserted into corresponding entry vector carrying the ges-1, unc-14, myo-3, dpy-7, or myo-2 promoter sequence. Germline transformation was performed as described by coinjecting testing DNA at the concentration of 10–40 μg/mL and marker DNA of Pdop-1::rfp at the concentration of 60 μg/mL into the gonad of nematodes40. Primer information for promoter amplification is shown in Table S1.
RNAi
RNAi assay was performed by feeding animals with E. coli strain HT115 (DE3) expressing certain double-stranded RNA for daf-16 gene as described41. E. coli HT115 (DE3) grown in LB broth containing ampicillin (100 μg/mL) was plated onto NGM containing ampicillin (100 μg/mL) and isopropyl 1-thio-β-D-galactopyranoside (IPTG, 5 mM). L2 larvae were transferred onto RNAi plates for 2 days until the nematodes became the gravid at 20 °C. Gravid adults were further transferred to fresh RNAi-expressing bacterial lawns to let them lay eggs for 2 h in order to obtain the second generation of RNAi population. Eggs were allowed to develop into young adults at 20 °C for the subsequent assays.
Statistical analysis
Data in this article were expressed as means ± standard deviation (SD). Graphs were generated using Microsoft Excel software (Microsoft Corp., Redmond, WA). Statistical analysis was performed using SPSS 12.0 software (SPSS Inc., Chicago, USA). Differences between groups were determined using analysis of variance (ANOVA), and probability levels of 0.05 and 0.01 were considered statistically significant. The lifespan data were analyzed using a 2-tailed 2 sample t-test (Minitab Ltd, Coventry, UK).
Additional Information
How to cite this article: Yang, R. et al. A mir-231-Regulated Protection Mechanism against the Toxicity of Graphene Oxide in Nematode Caenorhabditis elegans.
Sci. Rep.
6, 32214; doi: 10.1038/srep32214 (2016).
Authors: Lee P Lim; Nelson C Lau; Earl G Weinstein; Aliaa Abdelhakim; Soraya Yekta; Matthew W Rhoades; Christopher B Burge; David P Bartel Journal: Genes Dev Date: 2003-04-02 Impact factor: 11.361
Authors: Natalia J Martinez; Maria C Ow; John S Reece-Hoyes; M Inmaculada Barrasa; Victor R Ambros; Albertha J M Walhout Journal: Genome Res Date: 2008-11-03 Impact factor: 9.043
Authors: Maxwell C K Leung; Phillip L Williams; Alexandre Benedetto; Catherine Au; Kirsten J Helmcke; Michael Aschner; Joel N Meyer Journal: Toxicol Sci Date: 2008-06-19 Impact factor: 4.849