Yanning Zheng1, Lingling Li1,2, Qiang Liu1,2, Haibo Zhang1, Yujin Cao1, Mo Xian3, Huizhou Liu4. 1. CAS Key Laboratory of Biobased Materials, Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences, No.189 Songling Road, Laoshan District, Qingdao, 266101, China. 2. College of Food Science, Sichuan Agricultural University, Yaan, 625014, China. 3. CAS Key Laboratory of Biobased Materials, Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences, No.189 Songling Road, Laoshan District, Qingdao, 266101, China. xianmo@qibebt.ac.cn. 4. CAS Key Laboratory of Biobased Materials, Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences, No.189 Songling Road, Laoshan District, Qingdao, 266101, China. liuhz@qibebt.ac.cn.
Abstract
BACKGROUND: Diols are important monomers for the production of plastics and polyurethanes, which are widely used in our daily life. The medium-chain diols with one hydroxyl group at its subterminal end are able to confer more flexibility upon the synthesized materials. But unfortunately, this type of diols has not been synthesized so far. The strong need for advanced materials impelled us to develop a new strategy for the production of these novel diols. In this study, we use the remodeled P450BM3 for high-specificity production of 1,7-decanediol. RESULTS: The native P450BM3 was capable of converting medium-chain alcohols into corresponding α, ω1-, α, ω2- and α, ω3-diols, with each of them accounting for about one third of the total diols, but it exhibited a little or no activity on the short-chain alcohols. Greatly improved regiospecificity of alcohol hydroxylation was obtained by laboratory evolution of P450BM3. After substitution of 12 amino acid residues (J2-F87A), the ratio of 1,7-decanediol (ω-3 hydroxylation) to total decanediols increased to 86.8 % from 34.0 %. Structure modeling and site-directed mutagenesis demonstrated that the heme end residues such as Ala(78), Phe(87) and Arg(255) play a key role in controlling the regioselectivity of the alcohol hydroxylation, while the residues at the mouth of substrate binding site is not responsible for the regioselectivity. CONCLUSIONS: Herein we employ an engineered P450BM3 for the first time to enable the high-specificity biosynthesis of 1,7-decanediol, which is a promising monomer for the development of advanced materials. Several key amino acid residues that control the regioselectivity of alcohol hydroxylation were identified, providing some new insights into how to improve the regiospecificity of alcohol hydroxylation. This report not only provides a good strategy for the biosynthesis of 1,7-decanediol, but also gives a promising approach for the production of other useful diols.
BACKGROUND:Diols are important monomers for the production of plastics and polyurethanes, which are widely used in our daily life. The medium-chain diols with one hydroxyl group at its subterminal end are able to confer more flexibility upon the synthesized materials. But unfortunately, this type of diols has not been synthesized so far. The strong need for advanced materials impelled us to develop a new strategy for the production of these novel diols. In this study, we use the remodeled P450BM3 for high-specificity production of 1,7-decanediol. RESULTS: The native P450BM3 was capable of converting medium-chain alcohols into corresponding α, ω1-, α, ω2- and α, ω3-diols, with each of them accounting for about one third of the total diols, but it exhibited a little or no activity on the short-chain alcohols. Greatly improved regiospecificity of alcohol hydroxylation was obtained by laboratory evolution of P450BM3. After substitution of 12 amino acid residues (J2-F87A), the ratio of 1,7-decanediol (ω-3 hydroxylation) to total decanediols increased to 86.8 % from 34.0 %. Structure modeling and site-directed mutagenesis demonstrated that the heme end residues such as Ala(78), Phe(87) and Arg(255) play a key role in controlling the regioselectivity of the alcohol hydroxylation, while the residues at the mouth of substrate binding site is not responsible for the regioselectivity. CONCLUSIONS: Herein we employ an engineered P450BM3 for the first time to enable the high-specificity biosynthesis of 1,7-decanediol, which is a promising monomer for the development of advanced materials. Several key amino acid residues that control the regioselectivity of alcohol hydroxylation were identified, providing some new insights into how to improve the regiospecificity of alcohol hydroxylation. This report not only provides a good strategy for the biosynthesis of 1,7-decanediol, but also gives a promising approach for the production of other useful diols.
Diols are of great importance in the manufacture of plastics and polyurethanes, which have molded our society in many ways that make our life much easier [1]. The biosynthesis of short-chain diols such as 1,3-propanediol and 1,4-butanediol has been well developed [2-5], while the long-chain α, ω-diols such as 1,14-tetradecanediol and 1,16-hexadecanediol can be made by the catalytic hydrogenation of long-chain dicarboxylate esters. The medium-chain diols with one subterminal hydroxyl group, for example, 1,7-decanediol, which confer more flexibility upon the synthesized materials, are promising monomers for the synthesis of polymers with better properties. But unfortunately, this type of diols has not yet been synthesized with either chemical or biological method. The strong market demand for new polymers drives us to develop a strategy for the synthesis of these diols.To obtain the carbon backbones, we paid attention to the straight-chain fatty alcohols, whose biosynthesis has been well developed in recent years [6-8]. To finally get the desired diols, an additional hydroxyl group needs to be added to the subterminal carbon of the monohydric alcohols. But it is too difficult for the inorganic catalysts to catalyze the oxidation of a specific subterminal carbon of the monohydric alcohols, as each of the subterminal carbons almost has the same chemical contexts, and the inorganic catalysts usually exhibit poor selectivity. So the biocatalyst was considered as a priority. In seeking such a biocatalyst for the conversion of monohydric alcohols to corresponding diols, P450BM3 seems to be a promising enzyme, which naturally catalyzes the conversion of long-chain fatty acids to corresponding hydroxyfatty acids [9, 10]. P450BM3 is highly soluble in cytosolic environment, and has high catalytic rates and expression level in engineered E. coli, which is the most widely used host for the bioproduction of chemicals [11, 12]. These advantages make it an ideal biocatalyst for biotechnological application. And more importantly, its variants have shown to be able to utilize a wide range of other substrates. The P450BM3 variant 35-E11, whose 17 amino acid residues were substituted, was found to be capable of converting ethane to ethanol [11], and a series of P450BM3 variants were reported the improved activities on non-natural substrates naphthalene, pentane, p-cymene and propylbenzene [13]. These findings suggest that P450BM3 has stunning flexibility in substrate preference. In addition, protein engineering has been widely used as a strategy in the biological production of chemicals [14, 15]. Therefore, an improved regioselectivity for alcohol hydroxylation at ω-3 position can be expected by remodeled P450BM3 (Fig. 1).
Fig. 1
Schematic representation of the substrate specificities and regioselectivities of the native P450BM3 and the remodeled P450BM3. The native P450BM3 has a substrate preference for C12-C18 fatty acids and evenly oxidizes the ω-1, ω-2 and ω-3 carbons of the fatty acid substrates (a), while the remodeled P450BM3 exhibits a greatly improved regiospecificity of decanol hydroxylation, with 1,7-decanediol as the dominant product (b)
Schematic representation of the substrate specificities and regioselectivities of the native P450BM3 and the remodeled P450BM3. The native P450BM3 has a substrate preference for C12-C18 fatty acids and evenly oxidizes the ω-1, ω-2 and ω-3 carbons of the fatty acid substrates (a), while the remodeled P450BM3 exhibits a greatly improved regiospecificity of decanol hydroxylation, with 1,7-decanediol as the dominant product (b)In this study, we are reporting a strategy for high-specificity synthesis of α, ω3-diols from renewable medium-chain fatty alcohols. To improve the regioselectivity for alcohol hydroxylation at ω-3 position, we generated a series of P450BM3 variants by laboratory evolution. We also identified several key amino acid residues that control the regioselectivity of alcohol hydroxylation, and discussed the reason why these residues play a key role in determining the regioselectivity by structural analysis.
Results and discussion
Substrate specificity and regioselectivity of P450BM3
The P450BM3 was chosen as the starting enzyme for the conversion of alcohols to diols. So the engineered E. coli that overexpresses the native P450BM3 was constructed as the biocatalyst to test P450BM3’s ability of alcohol hydroxylation. The heptanol and decanol were firstly used as the substrates for testing the activity of P450BM3, as the medium chain diols are of more interests for the development of new polymers. P450BM3 exhibited high activities towards these substrates and produced almost an equivalent amount of α, ω1-, α, ω2- and α, ω3-diols, exhibiting the same regioselectivity as its native fatty acid substrates (Figs. 2 and 3). But when using pentanol as the substrate, only a tiny amount of 1,4-pentanediol was obtained (Fig. 2), suggesting P450BM3 has a different regioselectivity for short-chain alcohols. No activity was observed when using propanol and butanol as the substrates.
Fig. 2
GC-MS analysis of diols in the cultures. When pentanol was used as substrate, both BM3 and BM3J produced 1,4-pentanediol as the only product (a, d). When heptanol and decanol were used as substrates, BM3J produced much more 1,4-heptanediol (b, e) and 1,7-decanediol (c, f) than BM3, respectively
Fig. 3
Regiospecificities of the native P450BM3, P450BM3J and corresponding 10 single mutants of P450BM3J. Decanol was used as the substrate, and 1,7-, 1,8- and 1,9-decanediols were analyzed by GC-MS. The ratio of 1,7-decanediol to total decanediols increased from 34.0 % in BM3 to ~50 % in R255S, suggesting the increased ratio of 1,7-decanediol to total decanediols in BM3J is mainly attributed to the substitution of Arg255 to Ser255. The other 9 amino acid substitutions may have a combined effect on the constriction of the substrate-binding channel and the change of the substrate orientation
GC-MS analysis of diols in the cultures. When pentanol was used as substrate, both BM3 and BM3J produced 1,4-pentanediol as the only product (a, d). When heptanol and decanol were used as substrates, BM3J produced much more 1,4-heptanediol (b, e) and 1,7-decanediol (c, f) than BM3, respectivelyRegiospecificities of the native P450BM3, P450BM3J and corresponding 10 single mutants of P450BM3J. Decanol was used as the substrate, and 1,7-, 1,8- and 1,9-decanediols were analyzed by GC-MS. The ratio of 1,7-decanediol to total decanediols increased from 34.0 % in BM3 to ~50 % in R255S, suggesting the increased ratio of 1,7-decanediol to total decanediols in BM3J is mainly attributed to the substitution of Arg255 to Ser255. The other 9 amino acid substitutions may have a combined effect on the constriction of the substrate-binding channel and the change of the substrate orientationAs the typical substrates of P450BM3 are long-chain fatty acids [16], it is not surprising that the short-chain fatty alcohols are poor substrates for P450BM3. Arg47 and Tyr51 were thought to interact with the carboxylate group of the fatty acid substrates [17, 18]. Our finding that P450BM3 is also capable of utilizing fatty alcohols demonstrates that the interaction between Arg47/Tyr51 and carboxylate group is not so strong, and Arg47/Tyr51 is not involved in determining the substrate specificity of P450BM3. If Arg47/Tyr51 is responsible for stabilizing the carboxylate group of the fatty acid substrates, the carboxylate group needs to be recognized by the two amino acid residues, and P450BM3 will not be able to oxidize those hydrocarbons without carboxylate group. Therefore, the size of the substrate-binding pocket plays an important role in determining the substrate specificity of P450BM3, given that the P450BM3 has no activity towards short-chain alcohols and alkanes [19].
Substrate specificity and regioselectivity of P450BM3J
For the high-specificity production of the α, ω3-diols, the native P450BM3 needs to be modified to change its regioselectivity for alcohol hydroxylation. The regioselectivity is connected with the substrate orientation, which could be changed when the substrate channel of P450BM3 is constrained. It was found that a P450BM3 variant (P450BM3J), which contains 10 amino acid substitutions (V78A, T175I, A184V, F205C, S226R, H236Q E252G, R255S, A290V, L353V) with respect to the native P450BM3, changed its substrate preferences for shorter alkanes (C4-C8) when compared with the native P450BM3, which exhibited a substrate preference for Cn > 8 alkanes [19]. It could be expected that P450BM3J will have a higher priority for ω3 hydroxylation when using a longer-chain alcohol substrate. So we generated another engineered E. coliBM3J that overexpressed P450BM3J. The same as BM3, BM3J had no activity on propanol and butanol, and exhibited a low activity on pentanol, with 1,4-pentanediol as the only product (Fig. 2). But when using heptanol and decanol as substrates, BM3J produced more 1,4-heptanediol and 1,7-decanediol than BM3, with 1,4-heptanediol and 1,7-decanediol accounting for 50.1 and 64.5 % of total heptanediols and decanediols, respectively (Figs. 2 and 3).To examine if the increased ω-3 hydroxylation is mainly attributed to a specific amino acid substitution, we made 10 single mutants that correspond to the 10 amino acid substitutions of P450BM3J, namely, V78A, T175I, A184V, F205C, S226R, H236Q, E252G, R255S, A290V and L353V. The ratio of 1,7-decanediol to total decanediols increased from 34.0 % in BM3 to ~50 % in R255S (Fig. 3), suggesting the increased ratio of 1,7-decanediol to total decanediols in BM3J is mainly attributed to the substitution of Arg255 to Ser255, which allows the ω terminal carbon of the decanol substrate to move a little closer to the Ser255, and in the meanwhile to move a little farther away from the heme. This movement makes the ω-1 carbon deviate from its best position for hydroxylation, and thus decreases the efficiency of ω-1 hydroxylation. The other 9 amino acid substitutions may have a combined effect on the constriction of the substrate-binding channel and the change of the substrate orientation (Fig. 4b).
Fig. 4
Three-dimensional structures of P450BM3 and its variants. P450BM3 heme domain with palmitoleic acid bound was obtained from 1FAG (a). SWISS-MODEL derived homology models of P450BM3 variant structures, using 1FAG as the template (b, c, d). The amino acid residues involved in laboratory evolution are depicted in stick symbols. B, P450BM3J; C, P450J2; D, P450J2-F87A
Three-dimensional structures of P450BM3 and its variants. P450BM3heme domain with palmitoleic acid bound was obtained from 1FAG (a). SWISS-MODEL derived homology models of P450BM3 variant structures, using 1FAG as the template (b, c, d). The amino acid residues involved in laboratory evolution are depicted in stick symbols. B, P450BM3J; C, P450J2; D, P450J2-F87A
The effect of heme end residues on the regioselectivity of P450BM3J
To further improve the regioselectivity of P450BM3J, we need to further constrict the substrate-binding channel. The Val78 in P450BM3 is located near the ω terminus of fatty acid substrates, so it may be vital in controlling the substrate orientation. Fatty alcohol substrates should have a quite similar substrate orientation in the active site to the fatty acid substrates, which can be reflected by the regioselectivity for heptanol and decanol hydroxylation. The substitution of Val78 in P450BM3 to Ala78 in P450V78A nearly does not change the regioselectivity for decanol, as alanine has a similar property to valine. But when the Ala78 in P450BM3J was substituted to Phe78, yielding a variant J2, the ratio of 1, 7-decanediol (ω-3 hydroxylation) to total decanediols further increased to 76.3 % from 64.5 % in BM3J (Fig. 5). The phenyl group of Phe78 creates a narrower space between Phe78 and the heme. This conformational change forced the carbon chain bend, made the ω, ω-1 and ω-2 terminal carbons move farther away from the heme, and finally resulted in the decrease of undesired ω-1 and ω-2 hydroxylation (Fig. 4c). Therefore, the residues located around the heme end of the substrate-binding channel indeed play more important roles in determining the regioselectivity of the alcohol hydroxylases for medium-chain alcohol substrates.
Fig. 5
Regioselectivities of native P450BM3 and its variants for decanol. Decanol was used as substrate, and product decanediols were analyzed by GC-MS. 1,7-, 1,8- and 1,9-decanediols represent ω-3, ω-2 and ω-1 hydroxylation, respectively. BM3 expresses the native P450BM3, while BM3J, J2, J2-R47L and J2-F87A express different P450BM3 variants
Regioselectivities of native P450BM3 and its variants for decanol. Decanol was used as substrate, and product decanediols were analyzed by GC-MS. 1,7-, 1,8- and 1,9-decanediols represent ω-3, ω-2 and ω-1 hydroxylation, respectively. BM3 expresses the native P450BM3, while BM3J, J2, J2-R47L and J2-F87A express different P450BM3 variantsTo test this hypothesis, two residues, Arg47 and Phe87, were chosen for further modification. Arg47 is located at the mouth of substrate binding site and its guanidinium group is thought to provide an important ion-pair interaction with the carboxylate group of the fatty acid substrates [20], while Phe87 is located above the heme and is known to be an important factor in determining the regioselectivity of substrate hydroxylation [21]. The substitution of Arg47 to Leu47 was found to increase the hydroxylase activity towards pentane and propylbenzene [13]. The R47L mutation was then incorporated into the variant J2, generating a new variant J2-R47L. As expected, the regiospecificity profile of J2-R47L was nearly the same as that of J2 (Fig. 5), demonstrating the substitution of Arg47 to Leu47 did not change the substrate orientation and had little connection with the regioselectivity for alcohol substrates. But when the Phe87 was substituted to Ala87 (J2-F87A), the ratio of 1,7-decandediol to total decanediols further increased to 86.8 % (Fig. 5). The substitution of Phe87 to Ala87 released the space for the α-terminus of decanol to move towards the heme, and in the meanwhile made the benzene ring of Phe78 rotate away from the ω terminus of decanol (Fig. 4d). This incident allowed the ω, ω-1 and ω-2 terminal carbons of decanol to further move away from the heme, leading to the increased distribution of 1,7-decandediol. The heme end residues are responsible for contraction or expansion of the hydrophobic pocket, so they can affect the alcohol orientation in the substrate-binding channel and finally control the regioselectivity of the alcohol hydroxylation.
Conclusions
The engineering strategy described above inaugurates a new realm for the high-specificity production of 1,7-decanediol, which is a promising monomer for the development of advanced materials. The desired 1,7-decanediol was finally produced, being the first successful report on the biosynthesis of diols with one hydroxyl group at the subterminus. The regiospecificity of alcohol hydroxylation was greatly improved by laboratory evolution. Conservative structural models of the P450BM3 variants demonstrate that the heme end residues in the substrate-binding channel play a key role in determining the regioselectivity for medium-chain alcohols. This study not only provides a good strategy for the biosynthesis of 1,7-decanediol, but also gives a promising approach for the production of other useful diols. More and more advanced materials can be expected once these new diol monomers are available.
Methods
Plasmid construction
The P450 gene was amplified from genomic DNA of Bacillus megaterium ATCC 14581 (NZ_CP009920) with the primer set BM3-NcoF and BM3-BamHR. The PCR product digested with NcoI and BamHI was cloned into pCOLADuet-1 (Novagen, Darmstadt, Germany) cut with the same restriction enzymes, creating pLQ12. P450BM3J was generated by introducing 10 amino acid mutations (V78A, T175I, A184V, F205C, S226R, H236Q, E252G, R255S, A290V, L353V) on P450BM3 [19]. The codon-optimized 1129 bp necleic acids coding for the N-terminal P450BM3J were chemically synthesized, amplified with the primer set BM3J-NcoF and BM3J-EcoR, and integrated into the pCOLADuet-1, creating the plasmid pZZ1-up. The other part of the P450 gene, which is the same as that of P450 gene, was amplified from genomic DNA of B. megaterium (ATCC 14581) with the primer set BM3J-EcoF and BM3J-NotR. The PCR product digested with EcoRI and NotI was cloned into pZZ1-up cut with the same restriction enzymes, creating pZZ1. The whole P450 gene sequence is shown in [Additional file 1: Figure S1].
Structure modeling and site-directed mutagenesis
The models of the P450 variant structures were built on a public server Swiss-Model, using 1FAG as the template [22-24]. A method based on the amplification of the entire plasmid using primers that include the desired changes was employed for the site-directed mutagenesis [25]. All the plasmids and strains used in this work are listed in Table 1, and the oligonucleotide primers are given in Table 2.
Table 1
Bacterial strains and plasmids used in this study
Plasmid or strain
Relevant genotype or description
Reference
Plasmids
pCOLADuet-1
ColA origin; KanR; PT7
Novagen
pLQ12
ColA origin; KanR; PT7:: P450BM3
This study
pZZ1
ColA origin; KanR; PT7:: P450BM3J
This study
pV78A
ColA origin; KanR; PT7:: P450BM3V78A
This study
pT175I
ColA origin; KanR; PT7:: P450BM3T175I
This study
pA184V
ColA origin; KanR; PT7:: P450BM3A184V
This study
pF205C
ColA origin; KanR; PT7:: P450BM3F205C
This study
pS226R
ColA origin; KanR; PT7:: P450BM3S226R
This study
pH236Q
ColA origin; KanR; PT7:: P450BM3H236Q
This study
pE252G
ColA origin; KanR; PT7:: P450BM3E252G
This study
pR255S
ColA origin; KanR; PT7:: P450BM3R255S
This study
pA290V
ColA origin; KanR; PT7:: P450BM3A290V
This study
pL353V
ColA origin; KanR; PT7:: P450BM3L353V
This study
pJ2
ColA origin; KanR; PT7:: P450BM3JA78F
This study
pJ2-R47L
ColA origin; KanR; PT7:: P450BM3JA78FR47L
This study
pJ2-F87A
ColA origin; KanR; PT7:: P450BM3JA78F87A
This study
Strains
BL21(DE3)
E. coli B dcm ompT hsdS(rB−mB−) gal
Invitrogen
LQ12
BL21(DE3) harboring pLQ12
This study
ZZ1
BL21(DE3) harboring pZZ1
This study
V78A
BL21(DE3) harboring pV78A
This study
T175I
BL21(DE3) harboring pT175I
This study
A184V
BL21(DE3) harboring pA184V
This study
F205C
BL21(DE3) harboring pF205C
This study
S226R
BL21(DE3) harboring pS226R
This study
H236Q
BL21(DE3) harboring pH236Q
This study
E252G
BL21(DE3) harboring pE252G
This study
R255S
BL21(DE3) harboring pR255S
This study
A290V
BL21(DE3) harboring pA290V
This study
L353V
BL21(DE3) harboring pL353V
This study
J2
BL21(DE3) harboring pJ2
This study
J2-R47L
BL21(DE3) harboring pJ2-R47L
This study
J2-F87A
BL21(DE3) harboring pJ2-F87A
This study
Table 2
Primers used in this study
Name
Sequence (5′ → 3′)
BM3-NcoF
CTTGCCATGGGCATGACAATTAAAGAAATGCCTCAG
BM3-BamR
CGGGATCCTTACCCAGCCCACACGTCTTTTG
BM3J-NcoF
CATGCCATGGGCATGACAATTAAAGAAATGCCTCAG
BM3J-EcoR
GACGGAATTCTTCCACATCG
BM3J-EcoF
GAAGAATTCCGTCCAGAGCGTTTTG
BM3J-NotR
ATAAGAATGCGGCCGCTTACCCAGCCCACACGTCTTTTG
BM3-V78A-F
GCTTAAATTTGCACGTGATTTTGCAGGAGACGG
BM3-V78A-R
CAAAATCACGTGCAAATTTAAGCGCTTGACTTAAG
BM3-T175I-F
CCATTTATTATCAGTATGGTCCGTGCACTGGATG
BM3-T175I-R
GACCATACTGATAATAAATGGATGAGGCTGATC
BM3-A184V-F
GGATGAAGTAATGAACAAGCTGCAGCGAGC
BM3-A184V-R
CTTGTTCATTACTTCATCCAGTGCACGGACC
BM3-F205C-F
CAAGCGCCAGTGTCAAGAAGATATCAAGGTG
BM3-F205C-R
CTTCTTGACACTGGCGCTTGTTTTCATCATAAG
BM3-S226R-F
CGCAAAGCACGCGGTGAACAAAGCGATG
BM3-S226R-R
GTTCACCGCGTGCTTTGCGATCTGC
BM3-H236Q-F
CGCAGATGCTAAACGGAAAAGATCCAG
BM3-H236Q-R
CCGTTTAGCATCTGCGTTAATAAATCATC
BM3-E252G-F
GATGACGGGAACATTCGCTATCAAATTATTAC
BM3-E252G-R
GCGAATGTTCCCGTCATCAAGCGGCTCACCCG
BM3-R255S-F
GACGAGAACATTAGCTATCAAATTATTACATTC
BM3-R255S-R
GATAGCTAATGTTCTCGTCATCAAGCGGCTCAC
BM3-A290V-F
GTATTACAAAAAGTAGCAGAAGAAGCAGC
BM3-A290V-R
CTTCTGCTACTTTTTGTAATACATGTGG
BM3-L353V-F
GCGACGAAGTAATGGTTCTGATTCCTCAGC
BM3-L353V-R
GAACCATTACTTCGTCGCCTTTTTCTAAAGG
BM3J-A78F-F
GCGCTGAAATTTTTCCGTGATTTTGCAGGTGACGG
BM3J-A78F-R
CAAAATCACGGAAAAATTTCAGCGCTTGACTTAAG
J2-R47L-F
GCGCCTGGTCTGGTAACGCGCTACTTATCAAG
J2-R47L-R
CGCGTTACCAGACCAGGCGCCTCGAATTTAAAG
J2-F87A-F
GACGGGTTGGCTACAAGCTGGACGCATG
J2-F87A-R
GCTTGTAGCCAACCCGTCACCTGCAAAATC
Underlines indicate restriction enzyme sites
Bacterial strains and plasmids used in this studyPrimers used in this studyUnderlines indicate restriction enzyme sites
Bacterial strains, media and growth conditions
The bacterial strains used in this study are listed in Table S1. E. coliBL21(DE3) (Invitrogen, Carlsbad, CA) was used as the host to overproduce proteins. During strain construction, cultures were grown aerobically at 37 °C in LB medium (10 g/L tryptone, 10 g/L NaCl, and 5 g/L yeast extract). Kanamycin (50 mg/L) was added if necessary. For initial protein over-production in shake flasks, cultures were firstly grown in LB medium containing 50 mg/L kanamycin, then induced with 0.5 mM isopropyl β-D-thiogalactoside (IPTG), next incubated at 30 °C for 10 h, and finally harvested by centrifugation. The cell catalysts obtained from 50 ml cultures were transferred into 25 ml M9 medium (37.8 g/L Na2HPO4 · 12H2O, 7.5 g/L KH2PO4, 1 g/L NH4Cl, 0.5 g/L NaCl, 4 mM MgSO4) supplemented with 50 mg/L kanamycin, 0.25 mM IPTG and 5 mM alcohols, and incubated at 30 °C for 48 h.
Analysis of diols by GC-MS
Different diols produced by the engineered strains were identified by gas chromatography–mass spectrometry (GC–MS). These diols were isolated by ethyl acetate extraction. After concentrated by a rotary evaporator and redissolved with ethanol, 1 μl sample was injected for GC-MS analysis. The system consisted of model 7890A network GC system (Agilent Technologies) and a model 5975C network mass selective detector (Agilent Technologies, Santa Clara, CA). A HP-INNOWAX capillary column (30 m × 0.25 mm; 0.25 μm film thickness; Agilent Technologies) was used, with helium as the carrier gas. The following oven temperature program was carried out: 50 °C for 2 min, increase of 10 °C/min to 240 °C, 240 °C for 5 min. The injector was maintained at 250 °C.
Fig. 1
Fig. 2
Fig. 3
Fig. 4
Fig. 5