Joana Esteves de Lima1,2,3,4, Marie-Ange Bonnin1,2,3,4, Carmen Birchmeier5, Delphine Duprez1,2,3,4. 1. CNRS UMR 7622, F-75005 Paris, France. 2. Sorbonne Universités, UPMC Univ Paris 06, Paris, France. 3. IBPS-Developmental Biology Laboratory, Paris, France. 4. Inserm U1156, F-75005, Paris, France. 5. Developmental Biology, Max-Delbrück-Center for Molecular Medicine, Berlin, Germany.
Abstract
The importance of mechanical activity in the regulation of muscle progenitors during chick development has not been investigated. We show that immobilization decreases NOTCH activity and mimics a NOTCH loss-of-function phenotype, a reduction in the number of muscle progenitors and increased differentiation. Ligand-induced NOTCH activation prevents the reduction of muscle progenitors and the increase of differentiation upon immobilization. Inhibition of NOTCH ligand activity in muscle fibers suffices to reduce the progenitor pool. Furthermore, immobilization reduces the activity of the transcriptional co-activator YAP and the expression of the NOTCH ligand JAG2 in muscle fibers. YAP forced-activity in muscle fibers prevents the decrease of JAG2 expression and the number of PAX7+ cells in immobilization conditions. Our results identify a novel mechanism acting downstream of muscle contraction, where YAP activates JAG2 expression in muscle fibers, which in turn regulates the pool of fetal muscle progenitors via NOTCH in a non-cell-autonomous manner.
The importance of mechanical activity in the regulation of muscle progenitors during chick development has not been investigated. We show that immobilization decreases NOTCH activity and mimics a NOTCH loss-of-function phenotype, a reduction in the number of muscle progenitors and increased differentiation. Ligand-induced NOTCH activation prevents the reduction of muscle progenitors and the increase of differentiation upon immobilization. Inhibition of NOTCH ligand activity in muscle fibers suffices to reduce the progenitor pool. Furthermore, immobilization reduces the activity of the transcriptional co-activator YAP and the expression of the NOTCH ligandJAG2 in muscle fibers. YAP forced-activity in muscle fibers prevents the decrease of JAG2 expression and the number of PAX7+ cells in immobilization conditions. Our results identify a novel mechanism acting downstream of muscle contraction, where YAP activates JAG2 expression in muscle fibers, which in turn regulates the pool of fetal muscle progenitors via NOTCH in a non-cell-autonomous manner.
Skeletal muscle development, growth and regeneration rely on muscle stem cells. A major goal of muscle research is to understand the signals that regulate the ability of stem cells to self-renew or differentiate.Skeletal muscle formation involves successive and overlapping phases of embryonic, fetal, perinatal and adult myogenesis. The paired homeobox transcription factors, PAX3 and PAX7, define the pool of muscle stem cells during developmental, postnatal and regenerative myogenesis (Gros et al., 2005; Kassar-Duchossoy, 2005; Relaix et al., 2005). Fetal myogenesis depends on PAX7-expressing muscle progenitors and is associated with muscle growth (Hutcheson et al., 2009; Kassar-Duchossoy, 2005; Relaix et al., 2005). Muscle progenitors undergo myogenic differentiation program with the activation of the bHLH Myogenic Regulatory Factors (MRFs), MYF5, MRF4, MYOD, MYOG (Tajbakhsh, 2009). By the end of fetal myogenesis, PAX7+ cells adopt a satellite cell position under the basal lamina of muscle fibers (Biressi et al., 2007; Bröhl et al., 2012). During development, mechanical forces generated by muscle contraction are essential for the correct establishment of the musculoskeletal system. Although the influence of the mechanical forces for cartilage, joint, and bone development has been previously addressed (Nowlan et al., 2010; Rolfe et al., 2014; Shwartz et al., 2013), the consequence of muscle-induced mechanical load for the development of muscle itself is largely unknown.The NOTCH signaling pathway is a central regulator of skeletal muscle stem cells during embryonic, fetal and adult myogenesis [reviewed in Mourikis and Tajbakhsh (2014)]. Activation of the NOTCH signaling pathway requires direct cell-cell contact between a signal-sending cell that expresses the NOTCH ligand and a signal-receiving cell that expresses the NOTCH receptor. Upon ligand activation, the intracellular domain of the NOTCH receptor is cleaved, translocates into the nucleus, associates with the transcription factor RBPJ and activates the transcription of the bHLH transcriptional repressor genes, HES and HEY [reviewed in Andersson et al. (2011)]. In adult myogenesis, NOTCH is involved in satellite cell activation, proliferation and quiescence [reviewed in Mourikis and Tajbakhsh (2014)] and the absence of NOTCH signaling in muscle stem cells results in satellite cell depletion due to premature differentiation (Bjornson et al., 2012). In addition, during development, NOTCH has been described to activate embryonic myogenesis in somites (Rios et al., 2011). During developmental myogenesis, active NOTCH signaling is associated with proliferating muscle progenitors, while NOTCH ligands are expressed in differentiated muscle cells (Delfini et al., 2000; Vasyutina et al., 2007). NOTCH loss-of-function experiments in mice induce a loss of the muscle progenitor pool due to premature muscle differentiation (Bröhl et al., 2012; Czajkowski et al., 2014; Schuster-Gossler et al., 2007; Vasyutina et al., 2007), whereas NOTCH activation represses muscle differentiation in chick and mouse embryos (Delfini et al., 2000; Hirsinger et al., 2001; Mourikis et al., 2012). While studies have identified NOTCH target genes in fetal muscle progenitors (Bröhl et al., 2012; Mourikis et al., 2012), upstream regulators of NOTCH signaling during developmental myogenesis have not attracted attention.Similarly to NOTCH, the co-transcriptional activator YAP (Yes-Associated Protein) promotes satellite cell proliferation and inhibits muscle differentiation in culture (Judson et al., 2012; Watt et al., 2010). In addition to being a nuclear effector of the Hippo pathway, YAP has been identified as a sensor of mechanical activity and mediates cellular and transcriptional responses downstream of mechanical forces (Aragona et al., 2013; Dupont et al., 2011; Porazinski et al., 2015). In addition to other transcription factors, YAP binds to TEAD DNA binding proteins (Varelas, 2014). YAP and TEAD1 have been shown to occupy 80% of the same promoters in human mammary epithelial cells (Zhao et al., 2008), indicating that YAP/TEAD interaction could constitute the major molecular mechanism of YAP-mediated regulation of gene transcription. The TEAD transcription factors recognize and bind to MCAT elements (CATTCC), which are enriched in regulatory regions of muscle-related genes [reviewed in Wackerhage et al. (2014)]. In addition to being involved in muscle stem cell proliferation (Judson et al., 2012; Watt et al., 2010), YAP has been recently shown to be a critical regulator of skeletal muscle fiber size in adult mice (Goodman et al., 2015; Watt et al., 2015).A link between mechanical forces (provided by muscle contraction) and signaling pathways that regulate fetal myogenesis has not been established. In this study, we show the importance of mechanical forces in the regulation of the number of fetal muscle progenitors. We show that immobilization induces a NOTCH loss-of-function phenotype in muscles. We further provide evidence that, downstream of mechanical forces, YAP positively regulates the expression of the NOTCH ligandJAG2 in fibers, which maintains the pool of muscle progenitors by activating NOTCH signaling.
Results
Inhibition of muscle contraction reduces the number of progenitors and increases their differentiation in fetal muscles
To study the effect of mechanical signals on muscle progenitors, we set up an unloading model during chick fetal myogenesis (Figure 1A). We used decamethonium bromide (DMB), which blocks muscle contraction and induces rigid paralysis that leads to immobilization (Nowlan et al., 2010). Two days after the inhibition of muscle contraction, we observed a reduction in the overall muscle size (Figure 1D,H), which is consistent with previous reports (Crow and Stockdale, 1986; Hall and Herring, 1990). In addition, we observed a decrease of 58.07% (±17.66) in the number of PAX7+ muscle progenitors in paralyzed compared to control muscles (Figure 1B,D-F,H-J). Consistently, the relative expression levels of PAX7 and MYF5 genes were significantly decreased in DMB-treated limbs compared to control limbs, as early as 12 hr after DMB application and with a more prominent effect at 48 hr (Figure 1C). In addition to the reduction of the muscle progenitor pool, we also observed an increase of myogenic differentiation assessed by an increase of MYOD and MYOG expression using RT-q-PCR or in situ hybridization in immobilized limbs compared to control limbs (Figure 1C,G,K). The number of MYOD-expressing cells was also increased in paralyzed muscles compared to control muscles (Figure 1M). In addition, muscle fibers were larger in limb muscles of DMB-treated fetuses compared to control muscles (Figure 1E,I). The large muscle fibers were associated with several nuclei in paralyzed muscles, while control muscle fibers displayed only one nucleus on transverse sections (Figure 1L). Injection of pancuronium bromide (PB), a drug that exerts a flaccid skeletal muscle paralysis (Nowlan et al., 2010) led to a similar but less pronounced effect, i.e. a 28.92% (±7.27) reduction in the number of PAX7+ cells and a concomitant increase of muscle differentiation (Figure 1—figure supplement 1). DMB or PB treatments of chick fetal myoblast cultures did neither affect muscle progenitors nor their differentiation and did not change the expression levels of PAX7, MYF5, MYOD and MYOG (Figure 1—figure supplement 2), indicating that DMB and PB did not have any off-target effect on myogenic cells. We conclude that the inhibition of muscle contraction leading to rigid or flaccid paralysis reduces the pool of fetal muscle progenitors and increases their propensity to differentiate.
Figure 1.
Inhibition of muscle contraction decreases the number of limb fetal muscle progenitors.
(A) Chick fetuses were treated with DMB at E7.5 and E8.5, in order to block muscle contraction. (B) Number of PAX7+ cells in paralyzed and control muscles. PAX7+ cell number was counted per unit area in dorsal and ventral muscles of three DMB limbs and three control limbs. Results are shown as percentage of control. Error bars indicate standard deviations. The p-value was obtained using the Mann-Withney test. (C) RT-q-PCR analyses of muscle gene expression levels in limbs 12 hr, 24 hr and 48 hr after DMB treatment compared to control limbs. For each gene, the mRNA levels of control limbs were normalized to 1. Graph shows means ± standard errors of the mean of 11 limbs. The p-values were calculated using the Wilcoxon test. Asterisks indicate the p-values *p<0.05, **p<0.01, ***p<0.001. (D–K) Control limbs (D–G) (N = 5) and limbs from DMB-treated embryos (H–K) (N = 5) were transversely sectioned at the level of the zeugopod and analyzed for muscle progenitors and differentiated cells by immunohistochemistry using the PAX7 and MF20 antibodies, respectively (D–F, H–J), or for MYOD expression by in situ hybridization followed by immunohistochemistry with MF20 antibody (G,K) (N = 4). Nuclei were labeled with Hoechst (blue). Limb sections are dorsal to the top and posterior to the left. u, ulna, r, radius. (L) High magnifications of muscle fibers to show the grouped nuclei in fibers of paralyzed muscles compared to control muscles. (M) Number of Hoechst+ nuclei of MYOD-expressing cells versus all Hoechst+ nuclei. Results are shown as percentage of control. Error bars indicate standard deviations. The p-value was obtained using the Mann-Withney test.
DOI:
http://dx.doi.org/10.7554/eLife.15593.003
Chick embryos were treated with Pancuronium bromide (PB) at E7.5 and E8.5 to induce muscle flaccid paralysis. Embryos were processed 48 hr after PB exposure (at E9.5). Control (A–D) and PB-treated (E–H) limbs were transversely sectioned and analyzed by immunohistochemistry (A–C,E–G) (N = 3) or by in situ hybridization followed by immunohistochemistry (D,H) (N = 3). Immobilized muscles visualized with MF20 were decreased in size compared to control muscles (E versus A). PB-treated embryos displayed a diminution in the number of PAX7+ cells in limb muscles (F,G) compared to limb muscles of control embryos (B,C). (D,H) MYOG expression was increased in immobilized (H) versus control (D) muscles. (I) Number of PAX7+ cells in paralyzed and control muscles. PAX7+ cell number was counted per unit area in dorsal and ventral muscles of three PB limbs and three control limbs. Results are shown as percentage of controls. Error bars indicate standard deviations. The p-value was calculated using the non-parametric Mann-Whitney test. (J) RT-q-PCR analyses of muscle gene expression levels in limbs 48 hr after PB treatment compared to control limbs. For each gene, the mRNA levels of control limbs were normalized to 1. The p-values were calculated using the non-parametric Wilcoxon test. Error bars indicate standard errors of the mean of eleven samples. Asterisks indicate the p-values **p<0.01. u, ulna, r, radius.
DOI:
http://dx.doi.org/10.7554/eLife.15593.004
(A–D) Primary cultures of chick fetal myoblasts were treated with DMB or PB for 48 hr and fixed for immunochemistry. DMB-treated (C) or PB-treated (D) myoblasts displayed similar PAX7 and MF20 staining compared to control cultures (A,B). (E,F) RT-q-PCR analyses of muscle gene expression levels in cultured fetal myoblasts 48 hr after DMB (E) (N = 6) or PB (F) (N = 6) exposure compared to control cultures (N = 6). For each gene, the mRNA levels of control cultures were normalized to 1. Graphs show the means ± standard errors of the mean. The relative mRNA levels of PAX7, MYF5, MYOD and MYOG genes were not significantly changed in fetal myoblasts treated with DMB or PB compared to controls.
DOI:
http://dx.doi.org/10.7554/eLife.15593.005
Figure 1—figure supplement 1.
Muscle flaccid paralysis decreases the number of PAX7+ muscle progenitors and increases their differentiation.
Chick embryos were treated with Pancuronium bromide (PB) at E7.5 and E8.5 to induce muscle flaccid paralysis. Embryos were processed 48 hr after PB exposure (at E9.5). Control (A–D) and PB-treated (E–H) limbs were transversely sectioned and analyzed by immunohistochemistry (A–C,E–G) (N = 3) or by in situ hybridization followed by immunohistochemistry (D,H) (N = 3). Immobilized muscles visualized with MF20 were decreased in size compared to control muscles (E versus A). PB-treated embryos displayed a diminution in the number of PAX7+ cells in limb muscles (F,G) compared to limb muscles of control embryos (B,C). (D,H) MYOG expression was increased in immobilized (H) versus control (D) muscles. (I) Number of PAX7+ cells in paralyzed and control muscles. PAX7+ cell number was counted per unit area in dorsal and ventral muscles of three PB limbs and three control limbs. Results are shown as percentage of controls. Error bars indicate standard deviations. The p-value was calculated using the non-parametric Mann-Whitney test. (J) RT-q-PCR analyses of muscle gene expression levels in limbs 48 hr after PB treatment compared to control limbs. For each gene, the mRNA levels of control limbs were normalized to 1. The p-values were calculated using the non-parametric Wilcoxon test. Error bars indicate standard errors of the mean of eleven samples. Asterisks indicate the p-values **p<0.01. u, ulna, r, radius.
DOI:
http://dx.doi.org/10.7554/eLife.15593.004
Figure 1—figure supplement 2.
DMB or PB treatment in primary cultures of chick fetal myoblasts did not change the expression of muscle genes.
(A–D) Primary cultures of chick fetal myoblasts were treated with DMB or PB for 48 hr and fixed for immunochemistry. DMB-treated (C) or PB-treated (D) myoblasts displayed similar PAX7 and MF20 staining compared to control cultures (A,B). (E,F) RT-q-PCR analyses of muscle gene expression levels in cultured fetal myoblasts 48 hr after DMB (E) (N = 6) or PB (F) (N = 6) exposure compared to control cultures (N = 6). For each gene, the mRNA levels of control cultures were normalized to 1. Graphs show the means ± standard errors of the mean. The relative mRNA levels of PAX7, MYF5, MYOD and MYOG genes were not significantly changed in fetal myoblasts treated with DMB or PB compared to controls.
DOI:
http://dx.doi.org/10.7554/eLife.15593.005
Inhibition of muscle contraction decreases the number of limb fetal muscle progenitors.
(A) Chick fetuses were treated with DMB at E7.5 and E8.5, in order to block muscle contraction. (B) Number of PAX7+ cells in paralyzed and control muscles. PAX7+ cell number was counted per unit area in dorsal and ventral muscles of three DMB limbs and three control limbs. Results are shown as percentage of control. Error bars indicate standard deviations. The p-value was obtained using the Mann-Withney test. (C) RT-q-PCR analyses of muscle gene expression levels in limbs 12 hr, 24 hr and 48 hr after DMB treatment compared to control limbs. For each gene, the mRNA levels of control limbs were normalized to 1. Graph shows means ± standard errors of the mean of 11 limbs. The p-values were calculated using the Wilcoxon test. Asterisks indicate the p-values *p<0.05, **p<0.01, ***p<0.001. (D–K) Control limbs (D–G) (N = 5) and limbs from DMB-treated embryos (H–K) (N = 5) were transversely sectioned at the level of the zeugopod and analyzed for muscle progenitors and differentiated cells by immunohistochemistry using the PAX7 and MF20 antibodies, respectively (D–F, H–J), or for MYOD expression by in situ hybridization followed by immunohistochemistry with MF20 antibody (G,K) (N = 4). Nuclei were labeled with Hoechst (blue). Limb sections are dorsal to the top and posterior to the left. u, ulna, r, radius. (L) High magnifications of muscle fibers to show the grouped nuclei in fibers of paralyzed muscles compared to control muscles. (M) Number of Hoechst+ nuclei of MYOD-expressing cells versus all Hoechst+ nuclei. Results are shown as percentage of control. Error bars indicate standard deviations. The p-value was obtained using the Mann-Withney test.DOI:
http://dx.doi.org/10.7554/eLife.15593.003
Muscle flaccid paralysis decreases the number of PAX7+ muscle progenitors and increases their differentiation.
Chick embryos were treated with Pancuronium bromide (PB) at E7.5 and E8.5 to induce muscle flaccid paralysis. Embryos were processed 48 hr after PB exposure (at E9.5). Control (A–D) and PB-treated (E–H) limbs were transversely sectioned and analyzed by immunohistochemistry (A–C,E–G) (N = 3) or by in situ hybridization followed by immunohistochemistry (D,H) (N = 3). Immobilized muscles visualized with MF20 were decreased in size compared to control muscles (E versus A). PB-treated embryos displayed a diminution in the number of PAX7+ cells in limb muscles (F,G) compared to limb muscles of control embryos (B,C). (D,H) MYOG expression was increased in immobilized (H) versus control (D) muscles. (I) Number of PAX7+ cells in paralyzed and control muscles. PAX7+ cell number was counted per unit area in dorsal and ventral muscles of three PB limbs and three control limbs. Results are shown as percentage of controls. Error bars indicate standard deviations. The p-value was calculated using the non-parametric Mann-Whitney test. (J) RT-q-PCR analyses of muscle gene expression levels in limbs 48 hr after PB treatment compared to control limbs. For each gene, the mRNA levels of control limbs were normalized to 1. The p-values were calculated using the non-parametric Wilcoxon test. Error bars indicate standard errors of the mean of eleven samples. Asterisks indicate the p-values **p<0.01. u, ulna, r, radius.DOI:
http://dx.doi.org/10.7554/eLife.15593.004
DMB or PB treatment in primary cultures of chick fetal myoblasts did not change the expression of muscle genes.
(A–D) Primary cultures of chick fetal myoblasts were treated with DMB or PB for 48 hr and fixed for immunochemistry. DMB-treated (C) or PB-treated (D) myoblasts displayed similar PAX7 and MF20 staining compared to control cultures (A,B). (E,F) RT-q-PCR analyses of muscle gene expression levels in cultured fetal myoblasts 48 hr after DMB (E) (N = 6) or PB (F) (N = 6) exposure compared to control cultures (N = 6). For each gene, the mRNA levels of control cultures were normalized to 1. Graphs show the means ± standard errors of the mean. The relative mRNA levels of PAX7, MYF5, MYOD and MYOG genes were not significantly changed in fetal myoblasts treated with DMB or PB compared to controls.DOI:
http://dx.doi.org/10.7554/eLife.15593.005
NOTCH activity is decreased in muscles of immobilized fetuses
The concomitant decrease of the muscle progenitor pool and increase of muscle differentiation following muscle paralysis was reminiscent of a NOTCH loss-of-function phenotype. In the murine system, loss of NOTCH signaling results in a reduction of the progenitor pool due to a precocious shift toward differentiation (Bröhl et al., 2012; Vasyutina et al., 2007). To determine whether NOTCH activity was modified upon immobilization, we examined the expression of components of the NOTCH signaling pathway in paralyzed muscles. During fetal myogenesis, the NOTCH ligandJAG2 was expressed in MF20+ differentiated muscle cells (Delfini et al. 2000), while HES5 a recognized transcriptional readout of NOTCH activity (Andersson et al., 2011) was excluded from differentiated muscle fibers (Figure 2A,D). The NOTCH ligandDLL1 is expressed during chick and mouse embryonic myogenesis (Vasyutina et al. 2007, Delfini et al., 2000) but is not detected by in situ hybridization in chick limb fetal muscles (Delfini et al., 2000). JAG2 and HES5 were also expressed in blood vessels (Figure 2B,E, arrowheads). In immobilized fetuses, the expression of the JAG2 and HES5 was decreased in paralyzed muscles (Figure 2C,F,I) compared to control muscles (Figure 2B,E,H). We believe that the downregulation of JAG2 and HES5 expression in paralyzed muscles reflected a muscle-specific loss of gene expression, since JAG2 and HES5 expression was not affected in blood vessels (Figure 2B,C,E,F,H,I, arrowheads). Moreover, blood vessels are surrounding fetal muscles in normal conditions (Figure 2J,K), when muscle splitting is accomplished (Tozer et al., 2007). Consistently, the JAG2 and HES5 mRNA levels were moderately but significantly downregulated in limbs of immobilized animals (Figure 2G). We believe that the unchanged JAG2 and HES5 expression in blood vessels obscures the changes in JAG2/HES5 expression levels in muscles. HeyL is another transcriptional readout of NOTCH that responds to NOTCH activation in limb fetal muscle cells in mice (Mourikis et al., 2012; Bröhl et al., 2012). The relative mRNA levels of HEYL gene were also significantly downregulated in limbs of immobilized animals compared to controls (Figure 2G). In summary, NOTCH activity was reduced in paralyzed muscles, as assessed by reduced expression of the NOTCH ligandJAG2 in muscle fibers and of the transcriptional readout of NOTCH activity, HES5, in muscles. The downregulation of NOTCH signaling (Figure 2) and the concomitant reduction of the muscle progenitor pool and increase of differentiation (Figure 1, Figure 1—figure supplement 1) observed in unloading conditions led us to conclude that immobilization mimics a NOTCH loss-of-function phenotype in muscles.
Figure 2.
Muscle contraction inhibition decreases NOTCH activity in limb muscles.
(A–F, H–I) In situ hybridization to transverse limb sections at the level of the zeugopod of E9.5 chick fetuses treated (C,F,I) or not treated (A,B,D,E,H) with DMB, with JAG2 (A–C) or HES5 (D–F,H,I) probe followed by immunostaining with MF20 antibody (A–D) (N = 4). The expression of the NOTCH ligand JAG2 was lost in muscle fibers of paralyzed muscles (C) compared to JAG2 normal expression (A,B). (B,C, arrowheads) JAG2 expression in blood vessels was not affected in DMB limbs. The expression of the transcriptional readout of NOTCH, HES5 was also decreased in paralyzed muscles (F,I) compared to control muscles (D,E,H). (G) RT-q- PCR analyses of the expression levels of NOTCH signaling components in limbs of 12 hr and 48 hr DMB-treated fetuses. For each gene, the mRNA levels of control limbs were normalized to 1. Graph shows means ± standard errors of the mean of eight limbs. The p-values were calculated using the Wilcoxon test. Asterisks indicate the p-values, *p<0.05, **p<0.01. (J,K) Transverse limb sections of E9.5 fetuses were immunostained with MEP21 and MF20 antibodies to visualize blood vessels and differentiated muscles, respectively (N = 3). Hoescht was used to visualize nuclei in blue. Limb sections are dorsal to the top and posterior to the left. u, ulna, r, radius.
DOI:
http://dx.doi.org/10.7554/eLife.15593.006
Muscle contraction inhibition decreases NOTCH activity in limb muscles.
(A–F, H–I) In situ hybridization to transverse limb sections at the level of the zeugopod of E9.5 chick fetuses treated (C,F,I) or not treated (A,B,D,E,H) with DMB, with JAG2 (A–C) or HES5 (D–F,H,I) probe followed by immunostaining with MF20 antibody (A–D) (N = 4). The expression of the NOTCH ligandJAG2 was lost in muscle fibers of paralyzed muscles (C) compared to JAG2 normal expression (A,B). (B,C, arrowheads) JAG2 expression in blood vessels was not affected in DMB limbs. The expression of the transcriptional readout of NOTCH, HES5 was also decreased in paralyzed muscles (F,I) compared to control muscles (D,E,H). (G) RT-q- PCR analyses of the expression levels of NOTCH signaling components in limbs of 12 hr and 48 hr DMB-treated fetuses. For each gene, the mRNA levels of control limbs were normalized to 1. Graph shows means ± standard errors of the mean of eight limbs. The p-values were calculated using the Wilcoxon test. Asterisks indicate the p-values, *p<0.05, **p<0.01. (J,K) Transverse limb sections of E9.5 fetuses were immunostained with MEP21 and MF20 antibodies to visualize blood vessels and differentiated muscles, respectively (N = 3). Hoescht was used to visualize nuclei in blue. Limb sections are dorsal to the top and posterior to the left. u, ulna, r, radius.DOI:
http://dx.doi.org/10.7554/eLife.15593.006
The absence of muscle contraction does not affect muscle progenitor proliferation
As the pool of muscle progenitors was decreased after muscle paralysis (Figure 1), we assessed proliferation and apoptosis of muscle progenitors by EdU incorporation and TUNEL analyses in immobilization conditions (Figure 3). EdU incorporation into PAX7+ cells was not altered, indicating that the proliferative rate of PAX7+ cells was not changed during immobilization compared to control conditions (Figure 3A–G). Despite the reduced number of PAX7+ cells in paralyzed muscles (Figure 1), their proliferation capacities were unaffected (Figure 3A–G). While apoptotic cells were very rare in control muscles (Figure 3H,J,L,N), we observed an increase of apoptotic figures in fetal muscles of immobilized animals, 48 hr after DMB treatment (Figure 3I,K,M,O). We found no increase of apoptosis 24 hr after DMB treatment (data not shown). The apoptotic figures were not observed in PAX7+ cells, 48 hr after DMB treatments (Figure 3H–K), nor in MF20+ cells or in Desmin+ cells (Figure 3J–O). The absence of apoptotic figures in myogenic cells suggests that cells undergoing apoptosis upon immobilization are possibly muscle connective tissue cells. Thus, immobilization did neither affect the proliferative capacity nor apoptosis of PAX7+ cells, which was reminiscent of the unchanged proliferation and apoptosis rate of muscle progenitors in NOTCH loss-of-function in mice (Vasuytina et al., 2007).
Figure 3.
The proliferation rate of muscle progenitors is not modified in paralyzed muscles.
Limb muscles of control (A–C) and DMB-treated (D–F) fetuses were analyzed for cell proliferation by EdU incorporation. Control and paralyzed muscles displayed EdU+/PAX7+ cells showing proliferating muscle progenitors (A–F, arrows). The percentage of EdU+/PAX7+ cells on PAX7+ cells was analyzed in three muscles of three DMB limbs and three control limbs. (G) The percentage of EdU+/PAX7+ cells on PAX7+ cells was similar in both control and paralyzed muscles. Error bars show standard deviations. Control (H,J,L,N) and paralyzed (I,K,M,O) muscles were analyzed for apoptosis. TUNEL staining was rarely visualized in control muscles (H,J,L,N), while paralyzed muscles displayed an increase of apoptotic figures (I,K,M,O), which were not located in PAX7+ cells (I), in Myosin+ cells (M) or in Desmin+ cells (O).
DOI:
http://dx.doi.org/10.7554/eLife.15593.007
The proliferation rate of muscle progenitors is not modified in paralyzed muscles.
Limb muscles of control (A–C) and DMB-treated (D–F) fetuses were analyzed for cell proliferation by EdU incorporation. Control and paralyzed muscles displayed EdU+/PAX7+ cells showing proliferating muscle progenitors (A–F, arrows). The percentage of EdU+/PAX7+ cells on PAX7+ cells was analyzed in three muscles of three DMB limbs and three control limbs. (G) The percentage of EdU+/PAX7+ cells on PAX7+ cells was similar in both control and paralyzed muscles. Error bars show standard deviations. Control (H,J,L,N) and paralyzed (I,K,M,O) muscles were analyzed for apoptosis. TUNEL staining was rarely visualized in control muscles (H,J,L,N), while paralyzed muscles displayed an increase of apoptotic figures (I,K,M,O), which were not located in PAX7+ cells (I), in Myosin+ cells (M) or in Desmin+ cells (O).DOI:
http://dx.doi.org/10.7554/eLife.15593.007
Ligand-mediated activation of NOTCH prevented the loss of muscle progenitors in the absence of muscle contraction
The inhibition of muscle contraction mimicked a NOTCH loss-of-function phenotype in fetal muscles (Figures 1–3). To determine whether NOTCH signaling acts downstream of mechanical signals to regulate the muscle progenitor pool, we performed NOTCH rescue experiments in immobilization conditions. DLL1-induced NOTCH activation in chick embryos inhibits muscle differentiation (Delfini et al., 2000; Hirsinger et al., 2001). We first performed ligand-dependent NOTCH activation and analyzed the consequences for PAX7+ cells in normal conditions of muscle activity. In DLL1-activated NOTCH limbs, the pool of PAX7+ cells was maintained at E9.5, despite inhibition of muscle differentiation (Figure 4—figure supplement 1), which is consistent with the maintenance of PAX7+ progenitors in NICD-expressing cells in mouse fetuses (Mourikis et al., 2012). Thus, ligand-activated NOTCH maintained the number of chick fetal muscle progenitors over time and impaired their differentiation. We then forced NOTCH activity in limbs of immobilized fetuses and analyzed the consequences for muscle using the contralateral non-grafted limbs as control (Figure 4). Under immobilization conditions, the left limbs displayed a reduction in progenitor numbers and increased differentiation (Figure 4A,C,E,G). In contrast, in DLL1-expressing regions of (right) limbs, the number of PAX7+ cells was increased by 215.81% (± 29.36) and myosin expression was decreased compared to control (left) limbs (Figure 4A–I). Since immobilization leads to a 2.3-fold (58.07%) reduction in the number of PAX7+ cells (Figure 1B), we estimated that retroviral DELTA1-induced NOTCH rescued around 93% the number of PAX7+ cells in paralyzed muscles. We conclude that NOTCH activation prevents the decrease in the number of PAX7+ cells by preventing their inappropriate differentiation under immobilization conditions.
Figure 4—figure supplement 1.
A continuous source of NOTCH ligand maintained the number of PAX7+ muscle progenitors despite the inhibition of muscle differentiation.
(A) DELTA1/RCAS-producing cells were grafted into limb buds of E3.5 chick embryos. Grafted-embryos were fixed 6 days later at E9.5 (N = 3). DELTA1/RCAS-grafted (B,D,F,H) and contralateral (C,E,G) limbs were cut transversely and analyzed for DLL1 expression by in situ hybridization (B) or for muscle progenitors and differentiated cells by immunohistochemistry using PAX7 and MF20 antibodies (C–H). Hoechst was used to visualize nuclei. Ectopic DLL1 expression visualized in dorsal muscle masses (B) maintained the pool of PAX7+ cells (D,F) compared to contralateral limbs (C,E) despite the decreased number of muscle fibers (H versus G). (I) PAX7+ cell number was counted per unit area in DLL1-infected-muscles of three DELTA1/RCAS-grafted and in equivalent muscles in control limbs. Results are shown as percentage of controls. Error bars indicate standard deviations. Sections are dorsal to the top and posterior to the left. u, ulna, r, radius.
DOI:
http://dx.doi.org/10.7554/eLife.15593.009
Figure 4.
Ligand-induced NOTCH activity prevents the diminution in the number of fetal muscle progenitors and the increase of muscle differentiation in immobilized fetuses.
Transverse sections of contralateral (A,C,E,G) and DELTA1/RCAS grafted (B,D,F,H) limbs of DMB-treated fetuses were hybridized with the DLL1 probe (A,B) to visualize ectopic DLL1 expression in right grafted limbs (B) or immunostained with PAX7 and MF20 antibodies (C–H) (N = 3). (I) The quantification of PAX7+ cell number per unit area and muscle area was performed in DELTA1/RCAS-grafted and contralateral limbs of the same immobilized embryos. Result was presented as percentage of contralateral limbs, in immobilization conditions. Error bars represent standard deviations of six sections originating from three independent experimental embryos. The p-value was calculated using the Wilcoxon test. Limb sections are dorsal to the top and posterior to the left. u, ulna, r, radius.
DOI:
http://dx.doi.org/10.7554/eLife.15593.008
(A) DELTA1/RCAS-producing cells were grafted into limb buds of E3.5 chick embryos. Grafted-embryos were fixed 6 days later at E9.5 (N = 3). DELTA1/RCAS-grafted (B,D,F,H) and contralateral (C,E,G) limbs were cut transversely and analyzed for DLL1 expression by in situ hybridization (B) or for muscle progenitors and differentiated cells by immunohistochemistry using PAX7 and MF20 antibodies (C–H). Hoechst was used to visualize nuclei. Ectopic DLL1 expression visualized in dorsal muscle masses (B) maintained the pool of PAX7+ cells (D,F) compared to contralateral limbs (C,E) despite the decreased number of muscle fibers (H versus G). (I) PAX7+ cell number was counted per unit area in DLL1-infected-muscles of three DELTA1/RCAS-grafted and in equivalent muscles in control limbs. Results are shown as percentage of controls. Error bars indicate standard deviations. Sections are dorsal to the top and posterior to the left. u, ulna, r, radius.
DOI:
http://dx.doi.org/10.7554/eLife.15593.009
Ligand-induced NOTCH activity prevents the diminution in the number of fetal muscle progenitors and the increase of muscle differentiation in immobilized fetuses.
Transverse sections of contralateral (A,C,E,G) and DELTA1/RCAS grafted (B,D,F,H) limbs of DMB-treated fetuses were hybridized with the DLL1 probe (A,B) to visualize ectopic DLL1 expression in right grafted limbs (B) or immunostained with PAX7 and MF20 antibodies (C–H) (N = 3). (I) The quantification of PAX7+ cell number per unit area and muscle area was performed in DELTA1/RCAS-grafted and contralateral limbs of the same immobilized embryos. Result was presented as percentage of contralateral limbs, in immobilization conditions. Error bars represent standard deviations of six sections originating from three independent experimental embryos. The p-value was calculated using the Wilcoxon test. Limb sections are dorsal to the top and posterior to the left. u, ulna, r, radius.DOI:
http://dx.doi.org/10.7554/eLife.15593.008
A continuous source of NOTCH ligand maintained the number of PAX7+ muscle progenitors despite the inhibition of muscle differentiation.
(A) DELTA1/RCAS-producing cells were grafted into limb buds of E3.5 chick embryos. Grafted-embryos were fixed 6 days later at E9.5 (N = 3). DELTA1/RCAS-grafted (B,D,F,H) and contralateral (C,E,G) limbs were cut transversely and analyzed for DLL1 expression by in situ hybridization (B) or for muscle progenitors and differentiated cells by immunohistochemistry using PAX7 and MF20 antibodies (C–H). Hoechst was used to visualize nuclei. Ectopic DLL1 expression visualized in dorsal muscle masses (B) maintained the pool of PAX7+ cells (D,F) compared to contralateral limbs (C,E) despite the decreased number of muscle fibers (H versus G). (I) PAX7+ cell number was counted per unit area in DLL1-infected-muscles of three DELTA1/RCAS-grafted and in equivalent muscles in control limbs. Results are shown as percentage of controls. Error bars indicate standard deviations. Sections are dorsal to the top and posterior to the left. u, ulna, r, radius.DOI:
http://dx.doi.org/10.7554/eLife.15593.009
NOTCH ligand activity in differentiated muscle cells is required to maintain the pool of muscle progenitors
NOTCH signaling depends on the direct contact between signal-sending cells that express the NOTCH ligands and signal-receiving cells that express NOTCH receptors and display active NOTCH (Andersson et al., 2011). Since we observed a concomitant loss of the expression of the NOTCH ligandJAG2 in muscle fibers and reduced expression of NOTCH target genes in paralyzed muscles (Figure 2), it was unclear which cell type, between differentiated fibers and progenitors, first sensed muscle contraction. To test whether the loss of NOTCH ligand in muscle fibers would suffice to reduce the size of the muscle progenitor pool, we blocked NOTCH ligand function specifically in muscle fibers. For this, we overexpressed a dominant-negative form of DELTA1 (DELTA1/DN) (Figure 5A), which prevents NOTCH ligand processing in signal-sending cells and therefore blocked NOTCH activation in signal-receiving cells (Chitnis, 2006; Henrique et al., 1997). We performed chick somite-electroporation at the forelimb level (Figure 5B) using a stable vector that can be integrated into the genome in the presence of a transposase (Bourgeois et al., 2015). This vector co-expresses the Tomato reporter gene and DELTA1/DN under the control of the mouseMyosin Light Chain (MLC) promoter that drives expression in chick-differentiated muscle cells and not in muscle progenitors (Wang et al., 2011). In electroporated Tomato-expressing muscles, 44.94% (±12.88) of MF20+ cells displayed Tomato expression (Figure 5D–E). We observed that the lack of ligand activity in around 45% of differentiated muscle cells significantly decreased the number of PAX7+ cells by 32.42% (±7.23) compared to contralateral limbs (Figure 5F–K). This shows that a diminution of NOTCH ligand activity in muscle fibers suffices to induce a decrease in the number of PAX7+ cells. We conclude that NOTCH ligand activity in muscle fibers is required to maintain the pool of fetal muscle progenitors.
Figure 5.
NOTCH-ligand activity in differentiated muscle cells is required to maintain the pool of fetal muscle progenitors.
(A) Schematic representation of the recombinant vector co-expressing the Tomato reporter gene and a dominant-negative form of DELTA1 (DELTA1/DN) under the control of the Myosin Light Chain (MLC) promoter between two Tol2 transposons, and of the transient vector containing the transposase. (B) E2.5 chick embryos were electroporated at the level of forelimb somites in order to target limb muscle cells. Electroporated and contralateral limbs from the same animals (N = 4) were analyzed 7 days after electroporation, at E9.5. (C,D, F–J) Transverse sections of electroporated and contralateral limbs were immunostained with PAX7 and MF20 antibodies and labeled with Hoechst to visualize nuclei in blue. (D,E) In electroporated muscles displaying Tomato expression (D), an average of 44.94% (±12.88) of MF20+ cells displayed Tomato expression (E). The size and shape of the electroporated muscles was not affected (D) compared to control muscles (C). Electroporated muscles displayed a decrease in the number of PAX7+ cells (G,H,J) compared to contralateral limbs (F,I). (K) The number of PAX7+ cells per unit area and the muscle area were analyzed in electroporated muscles and equivalent muscles of the contralateral limbs (originating from the same experimental animals). Results were presented as percentage of the contralateral limbs (control). The graph shows means ± standard errors of the mean of 14 sections originating from four electroporated embryos. The p-value was calculated using the Wilcoxon test. Limb sections are dorsal to the top and posterior to the left. u, ulna.
DOI:
http://dx.doi.org/10.7554/eLife.15593.010
NOTCH-ligand activity in differentiated muscle cells is required to maintain the pool of fetal muscle progenitors.
(A) Schematic representation of the recombinant vector co-expressing the Tomato reporter gene and a dominant-negative form of DELTA1 (DELTA1/DN) under the control of the Myosin Light Chain (MLC) promoter between two Tol2 transposons, and of the transient vector containing the transposase. (B) E2.5 chick embryos were electroporated at the level of forelimb somites in order to target limb muscle cells. Electroporated and contralateral limbs from the same animals (N = 4) were analyzed 7 days after electroporation, at E9.5. (C,D, F–J) Transverse sections of electroporated and contralateral limbs were immunostained with PAX7 and MF20 antibodies and labeled with Hoechst to visualize nuclei in blue. (D,E) In electroporated muscles displaying Tomato expression (D), an average of 44.94% (±12.88) of MF20+ cells displayed Tomato expression (E). The size and shape of the electroporated muscles was not affected (D) compared to control muscles (C). Electroporated muscles displayed a decrease in the number of PAX7+ cells (G,H,J) compared to contralateral limbs (F,I). (K) The number of PAX7+ cells per unit area and the muscle area were analyzed in electroporated muscles and equivalent muscles of the contralateral limbs (originating from the same experimental animals). Results were presented as percentage of the contralateral limbs (control). The graph shows means ± standard errors of the mean of 14 sections originating from four electroporated embryos. The p-value was calculated using the Wilcoxon test. Limb sections are dorsal to the top and posterior to the left. u, ulna.DOI:
http://dx.doi.org/10.7554/eLife.15593.010
YAP activity is observed in differentiated muscle fibers and is decreased in paralyzed muscles
We next aimed to identify the signal that could sense mechanical forces and regulate JAG2 expression in muscle fibers. We focused on the transcriptional co-activator YAP that has been shown to sense mechanical signals independently of the Hippo pathway (Aragona et al., 2013; Dupont et al., 2011). YAP1 transcripts and YAP protein were expressed ubiquitously in chick limbs (Figure 6—figure supplement 1A–E). Since the subcellular localization of YAP protein reflects its transcriptional activity (Dupont et al., 2011), we examined nuclear YAP staining in MF20+ and PAX7+ cells. Unexpectedly, given the proliferative role of YAP in organ formation and tumorigenesis (Zanconato et al. 2015, Piccolo et al., 2014), we found that 89.6% (±3.65) of myonuclei of post-mitotic MF20+ cells displayed nuclear YAP protein (Figure 6A-C,G,H; Figure 6—figure supplement 1F,G). Moreover, YAP nuclear staining was stronger than YAP cytoplasmic staining in MF20+ cells; the cytoplasmic domains being delineated with MF20 staining (Figure 6G, Figure 6—figure supplement 1F). In contrast, only a subset of PAX7+ cells showed nuclear YAP staining (Figure 6—figure supplement 1H). Myoblast proliferation has been shown to be associated with increased nuclear YAP in cell cultures (Judson et al., 2012; Watt et al., 2010). However, we did not detect an obvious correlation between nuclear YAP protein and the proliferative state of PAX7+ cells in chick limb fetal muscles, in vivo (Figure 6—figure supplement 1I). ANKRD1 and CTGF are two recognized direct target genes of YAP in many cell types (Lai et al., 2011; Zhao et al., 2008). ANKRD1 is a muscle ankyrin-repeat protein that binds sarcomeric proteins (Kojic et al., 2011), and CTGF is a secreted matricellular protein involved in multiple cellular processes (Malik et al., 2015). ANKRD1 and CTGF expression was observed at the tips of MF20+ muscle fibers (Figure 6I-M,Q). In fetal limbs, ANKRD1 was exclusively expressed in muscle fibers (Figure 6I,K,L), whereas CTGF transcripts were observed also in cartilage (Figure 6M,Q). YAP staining in myonuclei and the expression of YAP target genes in muscle fibers show that YAP is active in differentiated muscle cells of chick fetal limbs. The regionalized location of the YAP target gene transcripts at muscle tips along fibers suggests that additional proteins are regionalized at muscle tips to regulate ANKRD1 and CTGF transcription. In immobilized fetuses, ANKRD1 and CTGF expression was lost in muscle fibers (Figure 6I–R), but CTGF expression was maintained in cartilage (Figure 6M,P–R). Consistently, the mRNA levels of ANKDR1 showed a drastic diminution, while those of CTGF displayed a significant but less strong reduction in immobilization conditions (Figure 6S). CYR61 is another matricellular protein of the same family as CTGF and is also a YAP target gene (Lai et al., 2011). CYR61 mRNA levels were also decreased in limbs 48 hr after DMB treatment (Figure 6S). Moreover, the number of YAP+ myonuclei was significantly decreased in muscle fibers of paralyzed muscles compared to control muscles (dropping from 89.6% ± 3.66 to 15.9% ± 4.36) (Figure 6H). We did not observe any obvious modification of nuclear YAP staining in PAX7+ cells of DMB-treated versus control animals (Figure 6—figure supplement 1J,K), indicating that the nuclear YAP staining in the subpopulation of PAX7+ cells is unrelated to mechanical signals. We conclude that YAP activity is observed in muscle fibers of contracting muscles and that this activity is lost in paralyzed muscles.
Figure 6—figure supplement 1.
YAP expression and activity in limb muscles of control and immobilized fetuses.
Limbs from E9.5 chick fetuses were longitudinally (A,B,D) or transversally (C,E–G) sectioned and analyzed for YAP1 expression by in situ hybridization (blue) followed by immunochemistry with the MF20 antibody to visualize myosins (brown) (A–C) or for YAP protein expression (green) by double immunohistochemistry with MF20 antibody (red) (D–G). Hoechst was used to visualize nuclei. YAP1 transcripts and YAP protein were ubiquitously expressed in limbs. (F,G) High magnifications of muscle transverse sections showed YAP protein in myonuclei of postmitotic MF20+ muscle fibers (G, arrowheads). (F) YAP staining was higher in myonuclei compared to cytoplasms in MF20+ cells. (H) Muscle transverse sections co-immunostained with PAX7 (red) and YAP (green) showed that PAX7+ cells could be either nuclear YAP+ (arrowheads) or nuclear YAP− (arrows). (I) Chick limbs from E9.5 embryos treated with EdU were analyzed by immunohistochemistry for PAX7, YAP and EdU. Transverse limb sections co-immunostained with PAX7 (red), YAP (green) and EdU (grey) antibodies showed that the PAX7+/EdU+ cells were either nuclear YAP+ (I, arrows) or nuclear YAP- (I, arrowheads). (J,K) Transverse limb sections of control (J) or DMB-treated (K) E9.5 embryos were immunostained with YAP and PAX7 antibodies. PAX7+ cells displaying nuclear YAP staining (J, arrows) or no nuclear YAP staining (J, arrowheads) were observed in control and paralyzed muscles (J,K, arrows and arrowheads). u, ulna, r, radius.
DOI:
http://dx.doi.org/10.7554/eLife.15593.012
Figure 6.
YAP activity is observed in contracting muscle fibers and lost in paralyzed muscles.
(A–F) Transverse limb muscle sections of E9.5 control (A–C) and DMB-treated fetuses (D–F) were immunostained with YAP and MF20 antibodies and labeled with Hoechst to visualize nuclei in blue (N = 3). (A–C) In myofibers, YAP was preferentially localized in myonuclei (arrows). (D–F) In paralyzed limb muscles, the nuclear localization of YAP protein in muscle fibers (MF20+ cells in red) was lost (D–F, arrows) compared to control muscles (A–C, arrows). (G) Focus on YAP+ myonuclei in MF20+ cells in control muscles and YAP- myonuclei in paralyzed muscles (DMB). (H) Quantification of the percentage of YAP+ myonuclei in MF20+ cells in control and paralyzed muscles. In situ hybridization to YAP target genes, ANKRD1 (I,K,L,N,O) and CTGF (J,M,Q,R) followed by immunohistochemistry with MF20 antibody in control limbs (I-M, Q) and paralyzed muscles (N,O,P,R) (N = 4). (I–M, Q) The YAP target genes were expressed at the tips of muscle fibers (blue staining in MF20+ cells in brown) visualized on longitudinal (I–K,Q) and transverse (L,M) muscle sections. ANKRD1 was exclusively expressed in limb muscles (L,K), while CTGF (M,Q) displayed additional expression in cartilage. (N,O,P,R) In the absence of muscle contraction, the expression of ANKRD1 and CTGF was lost in muscles but not in cartilage for CTGF. u, ulna, r, radius. For transverse limb sections, dorsal is to the top and posterior to the left. For longitudinal sections, dorsal is to the top and proximal to the left. (S) RT-q-PCR analyses of the expression levels of YAP target genes in limbs of 12 hr and 48 hr DMB-treated embryos. For each gene, the mRNA levels of control limbs were normalized to 1. The graph shows means ± standard errors of the mean of nine biological replicates. The p-values were calculated using the Mann-Whitney test. Asterisks indicate the p-value, **p<0.01, ***p<0.001, ****p<0.0001.
DOI:
http://dx.doi.org/10.7554/eLife.15593.011
Limbs from E9.5 chick fetuses were longitudinally (A,B,D) or transversally (C,E–G) sectioned and analyzed for YAP1 expression by in situ hybridization (blue) followed by immunochemistry with the MF20 antibody to visualize myosins (brown) (A–C) or for YAP protein expression (green) by double immunohistochemistry with MF20 antibody (red) (D–G). Hoechst was used to visualize nuclei. YAP1 transcripts and YAP protein were ubiquitously expressed in limbs. (F,G) High magnifications of muscle transverse sections showed YAP protein in myonuclei of postmitotic MF20+ muscle fibers (G, arrowheads). (F) YAP staining was higher in myonuclei compared to cytoplasms in MF20+ cells. (H) Muscle transverse sections co-immunostained with PAX7 (red) and YAP (green) showed that PAX7+ cells could be either nuclear YAP+ (arrowheads) or nuclear YAP− (arrows). (I) Chick limbs from E9.5 embryos treated with EdU were analyzed by immunohistochemistry for PAX7, YAP and EdU. Transverse limb sections co-immunostained with PAX7 (red), YAP (green) and EdU (grey) antibodies showed that the PAX7+/EdU+ cells were either nuclear YAP+ (I, arrows) or nuclear YAP- (I, arrowheads). (J,K) Transverse limb sections of control (J) or DMB-treated (K) E9.5 embryos were immunostained with YAP and PAX7 antibodies. PAX7+ cells displaying nuclear YAP staining (J, arrows) or no nuclear YAP staining (J, arrowheads) were observed in control and paralyzed muscles (J,K, arrows and arrowheads). u, ulna, r, radius.
DOI:
http://dx.doi.org/10.7554/eLife.15593.012
YAP activity is observed in contracting muscle fibers and lost in paralyzed muscles.
(A–F) Transverse limb muscle sections of E9.5 control (A–C) and DMB-treated fetuses (D–F) were immunostained with YAP and MF20 antibodies and labeled with Hoechst to visualize nuclei in blue (N = 3). (A–C) In myofibers, YAP was preferentially localized in myonuclei (arrows). (D–F) In paralyzed limb muscles, the nuclear localization of YAP protein in muscle fibers (MF20+ cells in red) was lost (D–F, arrows) compared to control muscles (A–C, arrows). (G) Focus on YAP+ myonuclei in MF20+ cells in control muscles and YAP- myonuclei in paralyzed muscles (DMB). (H) Quantification of the percentage of YAP+ myonuclei in MF20+ cells in control and paralyzed muscles. In situ hybridization to YAP target genes, ANKRD1 (I,K,L,N,O) and CTGF (J,M,Q,R) followed by immunohistochemistry with MF20 antibody in control limbs (I-M, Q) and paralyzed muscles (N,O,P,R) (N = 4). (I–M, Q) The YAP target genes were expressed at the tips of muscle fibers (blue staining in MF20+ cells in brown) visualized on longitudinal (I–K,Q) and transverse (L,M) muscle sections. ANKRD1 was exclusively expressed in limb muscles (L,K), while CTGF (M,Q) displayed additional expression in cartilage. (N,O,P,R) In the absence of muscle contraction, the expression of ANKRD1 and CTGF was lost in muscles but not in cartilage for CTGF. u, ulna, r, radius. For transverse limb sections, dorsal is to the top and posterior to the left. For longitudinal sections, dorsal is to the top and proximal to the left. (S) RT-q-PCR analyses of the expression levels of YAP target genes in limbs of 12 hr and 48 hr DMB-treated embryos. For each gene, the mRNA levels of control limbs were normalized to 1. The graph shows means ± standard errors of the mean of nine biological replicates. The p-values were calculated using the Mann-Whitney test. Asterisks indicate the p-value, **p<0.01, ***p<0.001, ****p<0.0001.DOI:
http://dx.doi.org/10.7554/eLife.15593.011
YAP expression and activity in limb muscles of control and immobilized fetuses.
Limbs from E9.5 chick fetuses were longitudinally (A,B,D) or transversally (C,E–G) sectioned and analyzed for YAP1 expression by in situ hybridization (blue) followed by immunochemistry with the MF20 antibody to visualize myosins (brown) (A–C) or for YAP protein expression (green) by double immunohistochemistry with MF20 antibody (red) (D–G). Hoechst was used to visualize nuclei. YAP1 transcripts and YAP protein were ubiquitously expressed in limbs. (F,G) High magnifications of muscle transverse sections showed YAP protein in myonuclei of postmitotic MF20+ muscle fibers (G, arrowheads). (F) YAP staining was higher in myonuclei compared to cytoplasms in MF20+ cells. (H) Muscle transverse sections co-immunostained with PAX7 (red) and YAP (green) showed that PAX7+ cells could be either nuclear YAP+ (arrowheads) or nuclear YAP− (arrows). (I) Chick limbs from E9.5 embryos treated with EdU were analyzed by immunohistochemistry for PAX7, YAP and EdU. Transverse limb sections co-immunostained with PAX7 (red), YAP (green) and EdU (grey) antibodies showed that the PAX7+/EdU+ cells were either nuclear YAP+ (I, arrows) or nuclear YAP- (I, arrowheads). (J,K) Transverse limb sections of control (J) or DMB-treated (K) E9.5 embryos were immunostained with YAP and PAX7 antibodies. PAX7+ cells displaying nuclear YAP staining (J, arrows) or no nuclear YAP staining (J, arrowheads) were observed in control and paralyzed muscles (J,K, arrows and arrowheads). u, ulna, r, radius.DOI:
http://dx.doi.org/10.7554/eLife.15593.012
YAP forced-activity in differentiated muscle cells rescues JAG2 expression and the muscle phenotype in paralyzed muscles
The concomitant loss of YAP activity and JAG2 expression in muscle fibers of paralyzed muscles prompted us to test whether YAP controlled JAG2 expression. We overexpressed chick fetal myoblasts in a constitutively active form of mouseYap that cannot be phosphorylated at Ser112 and is therefore preferentially translocated to the nucleus (Xin et al., 2013). Transfection of YapS112A/RCAS into fetal myoblasts increased the expression levels of YAP target genes (CTGF and CYR61) (Figure 7—figure supplement 1A). In addition, we also observed changes in muscle gene expression, previously described in C2C12 cells and satellite cell-derived myoblasts (Judson et al., 2012; Watt et al., 2010), i.e. concomitant increase of PAX7 and MYF5 and reduction of MYOD and MYOG expression. YapS112A also activated JAG2 expression and NOTCH target genes (Figure 7—figure supplement 1A). JAG2 expression was also upregulated in differentiated muscle cells after transfection with MLC-Tomato-YapS112A (Tomato+ FACS-sorted cells) (Figure 7—figure supplement 1B). Thus, YAP positively regulated JAG2 expression in cultured fetal muscle cells. In order to assess whether YAP would rescue JAG2 expression and the muscle phenotype observed in immobilization conditions, in vivo, we electroporated the MLC-Tomato-YapS112A construct in chick limb somites of embryos that were then treated with DMB. We observed that YAP forced-activity in differentiated muscle cells activated ANKRD1 expression in paralyzed muscles compared to the loss of ANKRD1 in paralyzed muscles (Figure 7A,B,D,E). This shows that YapS112A activates YAP target gene expression in paralyzed muscles. YAP forced-activity also rescued JAG2 expression in paralyzed muscles compared to the loss of JAG2 in paralyzed muscles (Figure 7A,C,D,F). Moreover, the number of PAX7+ cells was increased of 55.19% (± 10.2) in muscles displaying YapS112A expression in differentiated muscle cells (visualized with Tomato expression) compared to muscles of contralateral limbs (Figure 7G–N). We conclude that YAP forced-activity in muscle fibers prevents the loss of JAG2 expression in muscle fibers and the decrease in the number of adjacent muscle progenitors in immobilization conditions.
Figure 7—figure supplement 1.
Forced YAP activity increases JAG2 expression in chick fetal myoblasts.
(A) RT-q-PCR analysis of the mRNA levels of muscle genes, YAP target genes and components of the NOTCH pathway in primary cultures of fetal myoblasts transfected with YapS112A/RCAS (N = 6). Graph shows means ± standard errors of the means. For each gene, the mRNA levels of cultured fetal myoblasts transfected with a control vector (Empty/RCAS) was normalized to 1. The relative expression levels of YAP target genes CTGF and CYR61 were significantly increased. The relative expression levels of PAX7 and MYF5 were increased, while those of MYOD and MYOG were downregulated. The expression levels of the NOTCH ligand JAG2 were increased upon forced YAP activation as those of the HES4 and HEYL compared to control cultures. (B) RT-q-PCR analysis of the mRNA levels of ANKRD1 and JAG2 of differentiated muscle cells obtained after Tomato FACS-sorting of primary cultures of fetal myoblasts after transfection of MLC-Tomato-YapS112A. For each gene, the mRNA levels of cultured fetal myoblasts transfected with a MLC-Tomato was normalized to 1. The p-values were calculated using the Mann-Whitney test. Asterisks indicate the p-value, *p<0.05; **p<0.01; ***p<0.001.
DOI:
http://dx.doi.org/10.7554/eLife.15593.014
Figure 7.
Forced YAP activity in differentiated muscle fibers prevents the decrease of ANKRD1 and JAG2 expression and in the number of fetal muscle progenitors in immobilized fetuses.
E2.5 chick embryos were electroporated at the level of forelimb somites with MLC-Tomato-YapS112A to force YAP activity in differentiated muscle cells, and then treated with DMB. Contralateral and electroporated limbs from the same immobilized animals (N = 4) were analyzed 7 days after electroporation, at E9.5. (A–F) Adjacent sections of contralateral (A–C) and electroporated (D–F) limbs were immunostained with MF20 and labeled with Hoechst to visualize nuclei in blue (A,D) or hybridized with ANKRD1 (B,E) and JAG2 (C,F) probes. (D) Tomato indicates the electroporated muscle fibers. (A–F) ANKRD1 (E) and JAG2 (F) expression was activated in paralyzed muscles in the presence of YapS112A (D) in differentiated muscle cells compared to paralyzed muscles (A–C). (I) Tomato expression in wholemount MLC-Tomato-YapS112A-electroporated limbs. (G,H,J–L) Transverse sections of contralateral left (G,J) and MLC-Tomato-YapS112A electroporated right (H,K,L) limbs of DMB-treated fetuses were co-immunostained with PAX7 and MF20 antibodies. (L) Tomato expression in the same limb section as (H,K) to visualize electroporated muscle fibers. (M) High magnifications of dorsal muscle areas of DMB and DMB+YapS112A fetuses showing PAX7/TOMATO/HOECHST and MF20/HOECHST. (N) PAX7+ cell number was counted per unit area in muscles displaying Tomato expression in electroporated limbs and in equivalent muscles of contralateral limbs of four embryos. Results are shown as percentage of control. Error bars indicate standard deviations. The p-value was obtained using the Mann-Withney test. Limb sections are dorsal to the top and posterior to the left. u, ulna, r, radius.
DOI:
http://dx.doi.org/10.7554/eLife.15593.013
(A) RT-q-PCR analysis of the mRNA levels of muscle genes, YAP target genes and components of the NOTCH pathway in primary cultures of fetal myoblasts transfected with YapS112A/RCAS (N = 6). Graph shows means ± standard errors of the means. For each gene, the mRNA levels of cultured fetal myoblasts transfected with a control vector (Empty/RCAS) was normalized to 1. The relative expression levels of YAP target genes CTGF and CYR61 were significantly increased. The relative expression levels of PAX7 and MYF5 were increased, while those of MYOD and MYOG were downregulated. The expression levels of the NOTCH ligand JAG2 were increased upon forced YAP activation as those of the HES4 and HEYL compared to control cultures. (B) RT-q-PCR analysis of the mRNA levels of ANKRD1 and JAG2 of differentiated muscle cells obtained after Tomato FACS-sorting of primary cultures of fetal myoblasts after transfection of MLC-Tomato-YapS112A. For each gene, the mRNA levels of cultured fetal myoblasts transfected with a MLC-Tomato was normalized to 1. The p-values were calculated using the Mann-Whitney test. Asterisks indicate the p-value, *p<0.05; **p<0.01; ***p<0.001.
DOI:
http://dx.doi.org/10.7554/eLife.15593.014
Forced YAP activity in differentiated muscle fibers prevents the decrease of ANKRD1 and JAG2 expression and in the number of fetal muscle progenitors in immobilized fetuses.
E2.5 chick embryos were electroporated at the level of forelimb somites with MLC-Tomato-YapS112A to force YAP activity in differentiated muscle cells, and then treated with DMB. Contralateral and electroporated limbs from the same immobilized animals (N = 4) were analyzed 7 days after electroporation, at E9.5. (A–F) Adjacent sections of contralateral (A–C) and electroporated (D–F) limbs were immunostained with MF20 and labeled with Hoechst to visualize nuclei in blue (A,D) or hybridized with ANKRD1 (B,E) and JAG2 (C,F) probes. (D) Tomato indicates the electroporated muscle fibers. (A–F) ANKRD1 (E) and JAG2 (F) expression was activated in paralyzed muscles in the presence of YapS112A (D) in differentiated muscle cells compared to paralyzed muscles (A–C). (I) Tomato expression in wholemount MLC-Tomato-YapS112A-electroporated limbs. (G,H,J–L) Transverse sections of contralateral left (G,J) and MLC-Tomato-YapS112A electroporated right (H,K,L) limbs of DMB-treated fetuses were co-immunostained with PAX7 and MF20 antibodies. (L) Tomato expression in the same limb section as (H,K) to visualize electroporated muscle fibers. (M) High magnifications of dorsal muscle areas of DMB and DMB+YapS112A fetuses showing PAX7/TOMATO/HOECHST and MF20/HOECHST. (N) PAX7+ cell number was counted per unit area in muscles displaying Tomato expression in electroporated limbs and in equivalent muscles of contralateral limbs of four embryos. Results are shown as percentage of control. Error bars indicate standard deviations. The p-value was obtained using the Mann-Withney test. Limb sections are dorsal to the top and posterior to the left. u, ulna, r, radius.DOI:
http://dx.doi.org/10.7554/eLife.15593.013
Forced YAP activity increases JAG2 expression in chick fetal myoblasts.
(A) RT-q-PCR analysis of the mRNA levels of muscle genes, YAP target genes and components of the NOTCH pathway in primary cultures of fetal myoblasts transfected with YapS112A/RCAS (N = 6). Graph shows means ± standard errors of the means. For each gene, the mRNA levels of cultured fetal myoblasts transfected with a control vector (Empty/RCAS) was normalized to 1. The relative expression levels of YAP target genes CTGF and CYR61 were significantly increased. The relative expression levels of PAX7 and MYF5 were increased, while those of MYOD and MYOG were downregulated. The expression levels of the NOTCH ligandJAG2 were increased upon forced YAP activation as those of the HES4 and HEYL compared to control cultures. (B) RT-q-PCR analysis of the mRNA levels of ANKRD1 and JAG2 of differentiated muscle cells obtained after Tomato FACS-sorting of primary cultures of fetal myoblasts after transfection of MLC-Tomato-YapS112A. For each gene, the mRNA levels of cultured fetal myoblasts transfected with a MLC-Tomato was normalized to 1. The p-values were calculated using the Mann-Whitney test. Asterisks indicate the p-value, *p<0.05; **p<0.01; ***p<0.001.DOI:
http://dx.doi.org/10.7554/eLife.15593.014
YAP is recruited to JAG2 promoter in chick limb muscles
To define whether YAP directly regulates JAG2 transcription, we performed in vivo ChIP experiments using chick limbs as chromatin source. ChIP sequencing data on chick limb cells analyzing promoter-associated histone marks allowed us to characterize the promoter of the chickJAG2 gene (Figure 8—figure supplement 1). We identified a putative regulatory region (−629 bp; −1023 bp) in the JAG2 promoter, which contained a MCAT element (CATTCC), the known binding motif for TEAD complexes (Davidson et al., 1988). We found that YAP was recruited to this regulatory region based on PCR (Figure 8B) and RT-q-PCR (Figure 8D) analyses. Further sequences, upstream of the JAG2 transcription initiation site, containing (−8481 −8960 bp) or not containing (−4500 bp −4894 bp) MCAT elements were not occupied by YAP (Figure 8A,B). This result showed that YAP was recruited to the JAG2 promoter region in limb fetal skeletal muscles. The YAP occupancy to this region was decreased in immobilized fetuses based on PCR (Figure 8C) and RT-q-PCR (Figure 8D) analyses, consistent with the decrease of JAG2 expression in muscle fibers in immobilization conditions (Figure 2). The YAP recruitment to JAG2 promoter (containing MCAT elements) provides a possible mechanism for the contraction-dependent control of JAG2 expression in fetal muscle fibers.
Figure 8—figure supplement 1.
ChiP sequencing data with promoter histone marks on the chick JAG2 gene.
ChiP sequencing was performed from chick limb cell cultures with H3K4me2 and H3Kme3, which are promoter and active promoter marks, respectively.
DOI:
http://dx.doi.org/10.7554/eLife.15593.016
Figure 8.
YAP is recruited to a MCAT element-containing promoter region of the chick JAG2 gene in fetal muscles upon muscle contraction.
ChIP assay was performed from eight limbs of E9.5 chick control or immobilized fetuses with antibodies against YAP, AcH4 for positive control, or without antibody as a negative control in two independent biological experiments. ChIP products were analyzed by PCR (B,C) (N = 4) or by RT-q-PCR (N = 2) (D). Primers targeting a 394 pb fragment named region 1 (−629 bp −1023 bp) in the JAG2 promoter region (A) identified a DNA sequence immunoprecipitated by YAP by PCR (B) or by RT-q-PCR (D), while primers targeting regions 2 and 3 did not show any immunoprecipitation by PCR (B). (D) Experiment showing the signal of relative YAP recruitment to JAG2 regulatory region 1 in control and immobilized limbs. Results were represented as percentage of the input. Error bars show standard deviations. The YAP recruitment to JAG2 regulatory region 1 was lost in the absence of muscle contractions assessed by PCR (C) and RT-q-PCR (D) analyses.
DOI:
http://dx.doi.org/10.7554/eLife.15593.015
ChiP sequencing was performed from chick limb cell cultures with H3K4me2 and H3Kme3, which are promoter and active promoter marks, respectively.
DOI:
http://dx.doi.org/10.7554/eLife.15593.016
YAP is recruited to a MCAT element-containing promoter region of the chick JAG2 gene in fetal muscles upon muscle contraction.
ChIP assay was performed from eight limbs of E9.5 chick control or immobilized fetuses with antibodies against YAP, AcH4 for positive control, or without antibody as a negative control in two independent biological experiments. ChIP products were analyzed by PCR (B,C) (N = 4) or by RT-q-PCR (N = 2) (D). Primers targeting a 394 pb fragment named region 1 (−629 bp −1023 bp) in the JAG2 promoter region (A) identified a DNA sequence immunoprecipitated by YAP by PCR (B) or by RT-q-PCR (D), while primers targeting regions 2 and 3 did not show any immunoprecipitation by PCR (B). (D) Experiment showing the signal of relative YAP recruitment to JAG2 regulatory region 1 in control and immobilized limbs. Results were represented as percentage of the input. Error bars show standard deviations. The YAP recruitment to JAG2 regulatory region 1 was lost in the absence of muscle contractions assessed by PCR (C) and RT-q-PCR (D) analyses.DOI:
http://dx.doi.org/10.7554/eLife.15593.015
ChiP sequencing data with promoter histone marks on the chick JAG2 gene.
ChiP sequencing was performed from chick limb cell cultures with H3K4me2 and H3Kme3, which are promoter and active promoter marks, respectively.DOI:
http://dx.doi.org/10.7554/eLife.15593.016
Discussion
Muscle contraction maintains the fetal muscle progenitor pool by preventing differentiation
The influence of muscle contraction has been extensively studied for skeleton (reviewed in Schwartz et al. (2013) and Shea et al. (2015)) but not for skeletal muscle development. We show here that mechanical signals are required to maintain the PAX7+ muscle progenitor pool during fetal myogenesis. However, muscle contraction does not change cell proliferation but rather affects the maintenance of PAX7+ cells by preventing their differentiation. Although chondrocyte proliferation is reduced in growth plates of long bone in the absence of muscle contraction (Roddy et al., 2011), skeletogenesis is also affected by proliferation-independent mechanisms after immobilization. Muscle contraction is necessary to maintain progenitors of the joint in an undifferentiated state and prevents their differentiation into chondrocytes (Kahn et al., 2009). Muscle contraction also controls chondrocyte convergence extension during cartilage development in zebrafish and mice (Shwartz et al., 2012). This indicates that progenitor cells of the musculoskeletal system are sensitive to mechanical signals generated by muscle contraction during development and respond to mechanical activity by several mechanisms. Interestingly in plants, physical forces contribute to stem cell maintenance acting on a master regulator (STM homeobox) of Arabidopsis shoot meristems, and this is achieved by a mechanism that is independent of cell proliferation (Landrein et al., 2015).In the adult, changes in mechanical loading are known to cause variation of muscle size, but the contribution of satellite cells (adult muscle stem cells) to muscle atrophy or hypertrophy is a debated issue [reviewed in Brooks and Myburgh (2014)]. However, a reduction in the number of satellite cells has been described in adult muscle disuse/unloading animal models (Mitchell and Pavlath, 2004; Verdijk et al., 2012). Conversely, training exercises result in an increase of satellite cell number in humans (Crameri et al., 2004, 2007; Suetta et al., 2013). Moreover, physiological exercise has been shown to increases satellite cell numbers and to be beneficial for sarcopenic muscles [reviewed in Arthur and Cooley (2012)]. Thus, our data and the available information in literature indicate that muscle stem cells are sensitive to mechanical forces during muscle development, homeostasis and ageing. It remains to be determined whether similar molecular or cellular mechanisms are active in these diverse settings.
NOTCH signaling pathway acts downstream of mechanical signals during fetal myogenesis
Muscle paralysis causes a reduction of NOTCH activity and consequently muscle changes that are similar to those observed in NOTCH loss-of-function experiments. This shows that NOTCH activity is sensitive to mechanical signals during developmental myogenesis. Furthermore, ligand-induced NOTCH activation prevents the concomitant reduction of the fetal progenitor pool and increase muscle differentiation that is observed in the absence of muscle contraction. NOTCH components are also downregulated in bones of muscleless limbs of Spd mutant mice (Rolfe et al., 2014), although there is no described NOTCH loss-of-function phenotype in bones of muscleless limbs or immobilized embryos. NOTCH signaling is known to control the development of the cardiovascular system, which experiences mechanical forces. The NOTCH pathway has been proposed as an intermediary between mechanical forces and heart development [reviewed in Granados-Riveron and Brook (2012)], although the precise mechanotransduction pathway has not been identified. In adult muscle, NOTCH signaling has been extensively studied during muscle homeostasis, ageing and regeneration [reviewed in Mourikis and Tajbakhsh (2014)], and correlations between mechanical forces and NOTCH have been established (Carlson et al., 2009; Conboy et al., 2003). In summary, there is evidence for a change of NOTCH activity in different tissues during development and adult life upon muscle loading, but a functional link between mechanical signals and NOTCH has not been reported. We provide evidence that NOTCH signaling emerges as a molecular pathway that acts downstream of mechanical forces to regulate the pool of muscle progenitors during development. We believe that muscle activity acts on NOTCH ligand expression in fetal muscle fibers, since JAG2 expression is lost in fibers upon unloading and the blockade of NOTCH ligand function in muscle fibers suffices to decrease the number of adjacent muscle progenitors. In zebrafish, swimming-induced exercises lead to extensive transcriptional changes in fast muscles, including modification of the expression of NOTCH ligands, Dll1, Jag1 and Jag2 in addition to other NOTCH components (Palstra et al., 2014). Interestingly, on a molecular level, mechanical forces exerted by the signal-sending cell are required for ligand-induced NOTCH activation in a receiving cell that does not appear to sense forces directly (Gordon et al., 2015; Wang and Ha, 2013). Lastly, the NOTCH ligandJagged1 rescues the Duchenne muscular dystrophy phenotype in zebrafish embryos and is upregulated in mildly affected dystrophin-deficient dogs (Vieira et al., 2015). All these data converge to the idea that mechanical forces provided by muscle contraction are sensed by NOTCH ligands in muscle fibers.
The molecular sensor of mechanical forces YAP regulates JAG2 transcription in post-mitotic muscle fibers
We show here that YAP activity is sensitive to mechanical stimuli in fetal muscles in vivo. The preferential loss of YAP protein in myonuclei and YAP target gene expression in differentiated muscle cells in immobilized fetuses indicate that muscle fibers directly sense mechanical signals. Our results do not provide evidence that muscle progenitors directly sense mechanical signals, since nuclear YAP protein, proliferation rate and apoptosis were not modified in PAX7+ cells in immobilization conditions. Moreover, within fetal muscles, we did not detect any expression of the YAP target genes, ANKRD1 and CTGF elsewhere than in MF20+ muscle fibers. YAP is, however, known to be expressed in activated satellite cells and has been shown to enhance satellite cell proliferation and to inhibit their differentiation in culture (Judson et al., 2012; Watt et al., 2010). Consistently, YAP is upregulated in alveolar rhabdomyosarcoma and is a potent modulator of rhabdomyosarcoma formation (Crose et al., 2014; Tremblay et al., 2014). However, in addition to YAP function in muscle cell proliferation, YAP was recently shown to be upregulated in muscle fibers by mechanical overload and to be critical for the size of skeletal muscle fibers in adult mice (Goodman et al., 2015; Watt et al., 2015), highlighting an additional YAP function in post-mitotic muscle fibers upon loading. YAP and NOTCH pathways have been shown to converge in many biological systems in mice (Li et al., 2012, Yimlamai et al., 2014, Manderfield et al., 2015). Oncogenic YAP variants activate the NOTCH ligandJAG1 and consequently NOTCH signaling in hepatocellular carcinoma cells (Tschaharganeh et al., 2013). Moreover, TEAD binds to regulatory sequences of the JAG1 gene in humanbreast cancer cells (Zhao et al., 2008). The current view is that YAP and NOTCH pathways converge to promote proliferation, cell fate and differentiation in a cell-autonomous manner in vertebrates. Using muscle unloading during fetal myogenesis, we provide evidence that YAP acts on muscle progenitors in a NOTCH–dependent and non-cell autonomous manner. This mechanism is reminiscent of that of the DrosophilaYAP equivalent, Yorkie, during crystal cell differentiation in hematopoiesis, where Yorkie activates Serrate to induce responses in neighboring cells (Ferguson and Martinez-Agosto, 2014). We demonstrate a mechanistic link between YAP activity in muscle fibers and the regulation of the muscle progenitor pool and show that this is mediated by a transcriptional regulation of the NOTCH ligandJAG2 (Figure 9). It remains to be determined if a similar link exists between YAP and NOTCH ligands in adult muscle fibers that could explain changes in satellite cell number during unloading or uploading of muscles. We believe that the molecular mechanism that we identify during fetal development might be central to control muscle maintenance upon mechanical loading.
Figure 9.
Schematic representation of YAP and NOTCH signaling pathways in normal contracting muscles and paralyzed muscles.
(A) In contracting muscles, nuclear YAP (green myonuclei) and YAP target gene transcripts (green) are present in post-mitotic muscle fibers. YAP positively regulates JAG2 transcription upon muscle contraction. Ligand-dependent NOTCH activation regulates the muscle progenitor pool, by preventing muscle progenitors to differentiate. (B) In paralyzed muscles, nuclear YAP, YAP target genes and JAG2 transcripts are lost in post-mitotic muscle fibers. The absence of the NOTCH ligand JAG2 in fibers, due to the loss of mechanical signals, induces a NOTCH loss-of-function phenotype i.e. a diminution in the number of muscle progenitors and a shift toward differentiation, in a non-cell autonomous manner.
DOI:
http://dx.doi.org/10.7554/eLife.15593.017
Schematic representation of YAP and NOTCH signaling pathways in normal contracting muscles and paralyzed muscles.
(A) In contracting muscles, nuclear YAP (green myonuclei) and YAP target gene transcripts (green) are present in post-mitotic muscle fibers. YAP positively regulates JAG2 transcription upon muscle contraction. Ligand-dependent NOTCH activation regulates the muscle progenitor pool, by preventing muscle progenitors to differentiate. (B) In paralyzed muscles, nuclear YAP, YAP target genes and JAG2 transcripts are lost in post-mitotic muscle fibers. The absence of the NOTCH ligandJAG2 in fibers, due to the loss of mechanical signals, induces a NOTCH loss-of-function phenotype i.e. a diminution in the number of muscle progenitors and a shift toward differentiation, in a non-cell autonomous manner.DOI:
http://dx.doi.org/10.7554/eLife.15593.017
Materials and methods
Chick embryos
Fertilized chick eggs from commercial sources (White Leghorn, HAAS, Strasbourg, France and JA57 strain, Morizeau, Dangers, France) were incubated at 37.5°C. Chick embryos were staged according to days in ovo.
Drug administration
Decamethonium bromide (DMB) (Sigma, France) and pancuronium bromide (PB) (Sigma) solutions were freshly prepared before each experiment at 12 mM or 11 mM, respectively, in Hank’s solution (Sigma) with Penicillin-Streptomycin at 1% (Gibco, France). The control solution was prepared using Hank’s solution with 1% of Penicillin-Streptomycin. 100 µl of DMB, PB or control solutions were administrated in chick embryos at E7.5 and E8.5. Embryos were fixed at E8 for the 12 hr time point, at E8.5 for the 24 hr time point and at E9.5 for the 48 hr time point.
Grafts of DELTA1-RCAS-expressing cells
Chick embryonic fibroblasts (CEFs) obtained from E10 chick embryos were transfected with DELTA1/RCAS using the Calcium Phosphate Transfection Kit (Invitrogen, France). Cell pellets of approximately 50–100 µm in diameter were grafted into limb buds of E3.5 embryos as previously described (Bonnet et al., 2010; Delfini et al., 2000). DELTA1/RCAS-grafted embryos were either harvested at E9.5 or treated with DMB or control solution and harvested at E9.5.
Construction of electroporation vectors and electroporation
The pT2AL-MLC-Tomato-2A-DELTA1/DN was designed as follows: the dominant negative form of DELTA1 was defined as a truncated form of DELTA1 that lacks the intracellular domain (Henrique et al., 1997) and was amplified by PCR from the DELTA1/RCAS (Delfini et al., 2000) using the following primer sequences: Fw GACTTCGAAATGGGAGGCCGCT and Rv CACGTGTTACTATCACCTGCAGGCCTCG. The DELTA1/DN PCR product was inserted in the pT2AL-MLC-Tomato-2A-GFP (Bourgeois et al., 2015) after GFP removal to obtain pT2AL-MLC-Tomato-2A-DELTA1/DN (named as pT2AL-MLC-Tomato-DELTA1/DN). The pT2AL-MLC-Tomato-2A-mYapS112A was designed as follows: mYapS112A (Xin et al. 2013) was amplified by PCR from the mYapS112A/RCAS (McKey et al., 2016) using the following primer sequences: Fw CAATTCGAAATGGAGCCCGCG and Rv GGCCACGTGCTATAACCACGTGAGAAA. The mYapS112A PCR product was inserted in the pT2AL-MLC-Tomato-2A-GFP (Bourgeois et al., 2015) after GFP removal to obtain pT2AL-MLC-Tomato-2A-mYapS112A (named as pT2AL-MLC-Tomato-YapS112A). Forelimb somite electroporation was performed as previously described (Wang et al., 2011). The DNA solution was composed of the pT2AL-MLC-Tomato-DELTA1/DN or pT2AL-MLC-Tomato-YapS112A vectors and a transient transposase-containing vector pCAGGS-T2TP, at a molar ratio of 3:1. This vector set allows the stable integration of the MLC-Tomato-DELTA1/DN or the MLC-Tomato-YapS112A cassettes into the chick genome. Embryos electroporated with pT2AL-MLC-Tomato-YapS112A were immobilized with DMB treatment.
Myoblast cultures
Primary myoblasts were obtained from hindlimbs of E10 chick embryos, as previously described (Havis et al., 2012). DMB and PB were applied to proliferating myoblast cultures in high-serum conditions (10%), at a final concentration of 50 µM and 5 µM, respectively, for 48 hr. Myoblasts were then analyzed by immunohistochemistry for PAX7+ muscle progenitors and MF20+ differentiated cells and for muscle gene expression by RT-q-PCR. To force YAP activity in muscle cells, myoblasts were transfected with YapS112A/RCAS (McKey et al., 2016). Muscle cells were amplified in high-serum conditions until confluence, collected and analyzed for gene expression by RT-q-PCR. To obtain differentiated muscle cells that overexpress YapS112A, chick fetal myoblasts were transfected with pT2AL-MLC-Tomato-YapS112A or pT2AL-MLC-Tomato as control and cultured for 4 days. Cells were collected into PBS 1X 10% fetal bovine serum (FBS), stained with DAPI to exclude dead cells and purified via FACS Aria gating on the Tomato+ cell fraction.
RNA extraction and quantitative real-time PCR
Total RNAs were extracted from control limbs, experimental limbs or primary fetal myoblast cultures. 500 ng to 1 µg of RNA was reverse-transcribed using the High-Capacity Retrotranscription kit (Applied Biosystems, France). RT-q-PCR was performed using SYBR Green PCR Master Mix (Applied Biosystems). Primer sequences used for RT-q-PCR are listed in Supplementary file 1. The relative mRNA levels were calculated using the 2^-ΔΔCt method (Livak and Schmittgen, 2001). The ΔCts were obtained from Ct normalized with GAPDH and RPS17 levels in each sample. Twelve DMB, PB or control limbs, originating from four independent experiments, were used as independent RNA samples. Six samples of cultured myoblasts originating from three independent experiments were used as independent RNA samples for DMB, PB, YapS112A/RCAS or pT2AL-MLC-Tomato-YapS112A experiments. Each RNA sample was analyzed in duplicate. Errors bars in RT-q-PCR results represent standard error of the mean.
EdU experiments
Fifty microliters of EdU (Invitrogen) solution (5 mg/ml) was injected into the circulation in E9.5 chick embryos for 1.5 hr. Embryos were then fixed and immunohistochemistry was performed on limb transverse sections.
Immunohistochemistry
Forelimbs of control or manipulated (DMB, PB, DELTA1/RCAS, DELTA1/RCAS+DMB, pT2AL-MLC-Tomato-DELTA1/DN, pT2AL-MLC-Tomato-YapS112A+DMB) chick embryos were fixed in 4% paraformaldehyde overnight at 4°C and then processed in gelatin/sucrose for 12 µm cryostat sections. The monoclonal antibodies, MF20 that recognizes sarcomeric myosin heavy chains and PAX7 that recognizes muscle progenitors, developed by D.A. Fischman and A. Kawakami, respectively, were obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the NICHD and maintained by The University of Iowa, Department of Biology Iowa City, IA 52242. The Desmin antibody was obtained from Sigma (dilution 1/100). The YAPmouse monoclonal antibody was obtained from Santa Cruz Biotechnology (dilution 1/50). The MEP21 antibody originates from (McNagny et al., 1997). Proliferation analysis (EdU) was performed using the Click-iT kit (Thermo Fisher Scientific, France). Apoptosis was detected using the ApoTag kit (Millipore, France). Secondary antibodies were conjugated with Alexa-488 or Alexa-555 (Invitrogen). Nuclei were detected with Hoechst staining (Molecular Probes).
In situ hybridization
Chick forelimbs of control or manipulated (DMB, PB, DELTA1/RCAS, DELTA1/RCAS+DMB, pT2AL-MLC-Tomato-DELTA1/DN, pT2AL-MLC-Tomato-YapS112A+DMB) embryos were fixed in Farnoy (60% ethanol, 30% formaldehyde (stock at 37%) and 10% acetic acid) overnight at 4°C, and processed for in situ hybridization on wax tissue sections, as previously described (Wang et al., 2010). The digoxigenin-labeled mRNA probes were obtained as follows: DLL1, JAG2 and MYOD (Delfini et al., 2000); HES5 (Henrique et al., 1997). CTGF (EST clones) and YAP1 (McKey et al., 2016) probes were linearized with NotI and SacII and synthetized with T3 and SP6, respectively. ANKRD1 probe was obtained by PCR from E9.5 limb tissues using the following primers: Fw: TGGCTCACGGGAAGGAGAAG; Rv: GGTGCTCGGCACAGTCG, cloned into the pCRII-TOPO vector (Invitrogen), linearized with KpnI and synthetized with T7.
Chromatin immunoprecipitation assay
ChIP assay was performed as previously described (Havis et al., 2012). Eight limbs from E9.5 chick embryos were homogenized using a mechanical disruption device (Lysing Matrix A, Fast Prep MP1, 40 s at 6 m/s). 10 µg of the YAPrabbit polyclonal antibody (Santa Cruz Biotechnology) or 10 µg of the anti-acetylated histone H4 (AcH4) antibody (Upstate Biotechnology) was used to immunoprecipitate 20 µg of sonicated chromatin. ChIP products were analyzed by PCR to amplify three regions upstream the JAG2 coding sequence or by RT-q-PCR to amplify the region 1 (Figure 8A). The primer list is displayed in Supplementary file 1. ChIP assay was performed with or without DMB treatment in two independent biological replicates.
Image capturing
After immunohistochemistry or in situ hybridization experiments, images were obtained using a Nikon epifluorescence microscope, a Leica DMI600B fluorescence microscope or a Leica SP5 confocal system.
Cell number and muscle area measurements
All cell number and muscle area measurements were performed using the free software ImageJ (Rasband, W.S., ImageJ, U. S. National Institutes of Health, Bethesda, Maryland, USA, http://imagej.nih.gov/ij/, 1997–2012). To quantify the number of PAX7+ cells in limb muscles of DMB- and PB-treated fetuses, the number of PAX7+ cells was counted per unit area in dorsal and ventral muscles on three sections of each three different limbs originating from either DMB-treated, PB- treated or control embryos. The quantification of PAX7+ cells and muscle area (delineated with PAX7 and MF20 expression domains) in DELTA1/RCAS-grafted embryos was performed in three sections of each grafted (right) and contralateral (left) limbs of three immobilized and three control embryos. Quantification was performed in ectopic DLL1-expressing muscles of grafted right limbs and compared with equivalent muscles of the contralateral left limbs originating from the same embryos. The quantification of the Tomato+/MF20+ cells, MF20+ cells, PAX7+ cells and muscle area in pT2AL-MLC-Tomato-DELTA1/DN electroporated embryos was performed in five sections of each electroporated (right) and contralateral (left) of four embryos. Quantification was performed in Tomato-expressing muscles of electroporated right limbs and compared with equivalent muscles of the contralateral left limbs originating from the same embryos. The quantification of PAX7+ cells in pT2AL-MLC-Tomato-YapS112A electroporated and immobilized fetuses was performed in four sections of each electroporated (right) and contralateral (left) of four immobilized fetuses. Quantification was performed in Tomato-expressing muscles of electroporated right limbs and compared with equivalent muscles of the contralateral left limbs originating from the same embryos. Hoechst+ nuclei overlapping with MYOD expression were counted in four different muscles over four different sections and compared with the total number of Hoechst+ nuclei in paralyzed (DMB 48 hrs) and control muscles.
Statistical analyses
Data were analyzed using non-parametric two-tailed tests, Mann-Withney test for unpaired samples or Wilcoxon test for paired samples using Graphpad Prism V6. Results were shown as means ± standard deviations or standard errors of the mean, depending on the size of the samples. The p-values are indicated either with the number on the graphs or with asterisks. Asterisks indicate the different p-values *p<0.05, **p<0.01 and ***p<0.001.In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.Thank you for submitting your article "Muscle contraction is required to maintain the pool of muscle progenitors via YAP and NOTCH during fetal myogenesis" for consideration by eLife. Your article has been reviewed by two peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Fiona Watt as the Senior Editor. The following individual involved in review of your submission has agreed to reveal her identity: Gabrielle Kardon (Reviewer #2).The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.The regulation of the pool of muscle progenitors during development is a critical determinant of muscle size. In this paper, the authors test the novel hypothesis that muscle contraction is important for regulating the number of muscle progenitors during development. By using drugs that block the contraction of muscles in the chick embryo and by molecular manipulations, they describe the possible role that YAP and NOTCH signaling may play in this process. Altogether this is a nice study with interesting hypotheses put forward which have potentially important implications, however a number of important points need to be addressed before publication can be envisaged.1) In the Introduction, presentation of the role of the Notch pathway in myogenesis is inadequate. This is a complex situation (see for instance Mourikis and Tajbakhsh in 2014 for a partial outlook on this complexity) and presenting it as linear and simple is bound to attract criticism. The authors only refer to the role of Notch in the inhibition of myogenic differentiation of resident progenitors and satellite cells. However, opposite results have been described, e.g. in the Notch3 null mutation or the early differentiation of progenitors from the dermomyotome in the chick embryo (Kitamoto and Hanaoka, 2010; Rios et al., 2011). What this variety of responses means is that during myogenesis, Notch has different roles depending on the cellular and molecular context where it acts. This is something that should be clearly presented so that the text is less dogmatic from the start. As it is, it seems that studies that don't fit to the general hypothesis developed here are just not mentioned. In general, there is a bias towards citing much of the authors and co-authors work (and views) on what Notch is doing during myogenesis and missing other important references not only when they do not fit to the picture (see above) but even when they support the general idea (e.g. Bjornson et al. 2012).2) The authors show that there is an increase of MyoD or Myog expression after drug treatment, which is paralleled by a decrease of PAX7 expression. They draw the conclusion that PAX7-positive cells have undergone myogenic differentiation. However, there is no definite proof that this is the case. The number of MyoD+ (or Myog+) cells could be the same after treatment, but with the number of PAX7+ cells decreasing, the proportion of MyoD+ or Myog+ cells would automatically increase (in particularly since the PAX7+ population is large). A more direct proof that this a differentiation process would be to demonstrate that the number of PAX7+ cells (per area unit) at t=0 is similar to that of MyoD+ cells per unit area at t=12 or 48 hrs. Since the authors claim there is no apoptosis (see below) the numbers should match. Furthermore a time course on MyoD and PAX7-positive cells would help.3) The authors show that there is no change in EdU labelling in the PAX7+ population, and they conclude that there is no change in the proliferation of resident progenitors, thus supporting the hypothesis of an increase in differentiation (see above). However, the authors show that there is an increase of apoptosis in PAX7-negative cells in the muscle masses. How can they exclude that after drug treatment, the resident progenitors lose PAX7 expression, then undergo apoptosis? It is a concern that the cell population undergoing apoptosis is not identified.4) The Notch ligandJag2 and the Notch response (Hes5 and HeyL) are more strongly reduced after 12 than 48h, while the phenotype is stronger after 48h (Figure 1C). The authors should discuss an explanation for this time difference.5) The over-expression of Dll1 with RCAS viruses will target both the resident progenitors and the differentiated fibers. Since it is known that Notch is activated in trans and inhibited in cis (see del Alamo et al. Curr. Biol. 2011 for review), what conclusion can be drawn from this experiment? It would be important in these overexpression experiments to check cell type specificity, using the available tools.In addition, since the authors claim it is Jag2 that is the ligand, why not use its cDNA? They could have used electroporation of Jag2 in combination with the muscle-specific promoter they used with the next experiment (DN Dll1) that would drive its expression in differentiated fibers. It would also have been appropriate to use siRNA directed against Jag2. The reviewers do not insist on redoing the experiments with Jag2, although if the authors have these data they should be included. in any case, since Jag2 is membrane bound, they should show that they have an effect only in cells in direct contact with the Jag2/ Dll1 over-expressing fibers.6) It is not clear that Yap activation is downstream of muscle contraction and also that Yap activates Jag2 expression in myofibers. Of course, the most convincing data would be for the authors to show that ectopic activation of YAP in myofibers (via Tol2 MLC electroporation) rescues the loss of PAX7+ progenitors when myofibers have been immobilized. This experiment would considerably strengthen the paper and should be do-able by the authors since they have the Tol2 MLC construct.7) Since YAP is such an ubiquitously expressed molecule, the authors should be careful in the phrasing of the conclusions.1) In the Introduction, presentation of the role of the Notch pathway in myogenesis is inadequate. This is a complex situation (see for instance Mourikis and Tajbakhsh in 2014 for a partial outlook on this complexity) and presenting it as linear and simple is bound to attract criticism. The authors only refer to the role of Notch in the inhibition of myogenic differentiation of resident progenitors and satellite cells. However, opposite results have been described, e.g. in the Notch3 null mutation or the early differentiation of progenitors from the dermomyotome in the chick embryo (Kitamoto and Hanaoka, 2010; Rios et al., 2011). What this variety of responses means is that during myogenesis, Notch has different roles depending on the cellular and molecular context where it acts. This is something that should be clearly presented so that the text is less dogmatic from the start. As it is, it seems that studies that don't fit to the general hypothesis developed here are just not mentioned. In general, there is a bias towards citing much of the authors and co-authors work (and views) on what Notch is doing during myogenesis and missing other important references not only when they do not fit to the picture (see above) but even when they support the general idea (e.g. Bjornson et al. 2012).In the original Introduction section describing the NOTCH pathway, we focused on limb foetal myogenesis, which involves the inhibition of muscle differentiation and the maintenance of muscle progenitors. We are aware that additional roles of NOTCH have been described during embryonic and adult myogenesis. We now mention the role of NOTCH during the activation of embryonic myogenesis in axial somites (Rios et al., 2011) and during activation, proliferation and quiescence of satellite cells. We also cite the Bjornson et al. (2012) paper, which shows a role for NOTCH in maintaining the number of satellite cells by inhibiting differentiation.2) The authors show that there is an increase of MyoD or Myog expression after drug treatment, which is paralleled by a decrease of PAX7 expression. They draw the conclusion that PAX7-positive cells have undergone myogenic differentiation. However, there is no definite proof that this is the case. The number of MyoD+ (or Myog+) cells could be the same after treatment, but with the number of PAX7+ cells decreasing, the proportion of MyoD+ or Myog+ cells would automatically increase (in particularly since the PAX7+ population is large). A more direct proof that this a differentiation process would be to demonstrate that the number of PAX7+ cells (per area unit) at t=0 is similar to that of MyoD+ cells per unit area at t=12 or 48 hrs. Since the authors claim there is no apoptosis (see below) the numbers should match. Furthermore a time course on MyoD and PAX7-positive cells would help.Unfortunately, there is no good commercial antibody against chickMYOD or MYOG (in contrast to the situation in mice), so we cannot calculate the number of PAX7+ and MYOD+ cells. In order to estimate the number of MYOD-expressing cells, we therefore counted the number of Hoechst+ nuclei of MYOD-expressing cells (based on MYOD in situ hybridization) versus the total number of Hoechst+ nuclei in muscles. We observed an increase in the percentage of MYOD-expressing cells in paralyzed muscles compared to control muscles (New Figure 1I). Moreover, we observed larger Myosin+ fibres, with multiple grouped nuclei in paralyzed muscles compared to control muscles (New Figure 1H). The increase in the number of MYOD-expressing cells, of MYOD and MYOG expression (in situ hybridization and RT-q-PCR) combined with the larger muscle fibres with multiple nuclei in paralyzed muscles compared to control muscles leads us to conclude that the decrease in the number of PAX7+ cells is due to increased differentiation. Lastly, the reversion of the muscle phenotype i.e. diminution of differentiation (and increase in the number of PAX7+ cells) upon DLL1- activated NOTCH in immobilisation conditions, is also an indirect argument that there is an increase of differentiation (in addition to the decrease in the number of PAX7+ cells) in immobilisation conditions (Figure 4).We have added the 24 hour time point for PAX7, MYF5, MYOD and MYOG expression levels in immobilised limbs versus control limbs in Figure 1C. This provides us with an intermediary time point between 12 hours and 48 hours.3) The authors show that there is no change in EdU labelling in the PAX7+ population, and they conclude that there is no change in the proliferation of resident progenitors, thus supporting the hypothesis of an increase in differentiation (see above). However, the authors show that there is an increase of apoptosis in PAX7-negative cells in the muscle masses. How can they exclude that after drug treatment, the resident progenitors lose PAX7 expression, then undergo apoptosis? It is a concern that the cell population undergoing apoptosis is not identified.We have looked at apoptosis 24 hours after DMB treatment and there is no increased apoptosis in paralysed muscles compared to control muscles. Since there are no double labeled PAX7+/Tunel+ cells 48 hours after immobilisation, we conclude that muscle progenitors do not undergo apoptosis in paralyzed muscles (48 hours after immobilisation).The apoptosis observed in muscles paralyzed for 48 hours is rarely observed in MF20 + cells or Desmin+ cells (now added in Figure 3). Desmin expression allows us to cover myogenic cells between progenitors (PAX7) and fibres (MF20). This result shows that myogenic cells do not undergo apoptosis upon immobilisation. One likely hypothesis is that apoptosis is observed in non-myogenic cells, such as muscle connective tissue cells.4) The Notch ligandJag2 and the Notch response (Hes5 and HeyL) are more strongly reduced after 12 than 48h, while the phenotype is stronger after 48h (Since JAG2 is also expressed in vessels, it is difficult to speculate on a stronger effect at 12 h 4 than 48h. We believe that the q-PCR experiments confirm the decrease of JAG2 expression in limbs, which is clearly observed in limb muscles by in situ hybridisation (Figure 2).5) The over-expression of Dll1 with RCAS viruses will target both the resident progenitors and the differentiated fibers. Since it is known that Notch is activated in trans and inhibited in cis (see del Alamo et al. Curr. Biol. 2011 for review), what conclusion can be drawn from this experiment? It would be important in these overexpression experiments to check cell type specificity, using the available tools.DLL1 overexpression experiments with the RCAS virus lead to a NOTCH gain-of-function phenotype in chick limbs (Delfini et al., 2000, Bonnet et al., 2010, Havis et al., 2012) or in chick somites (Hirsinger et al., 2001). DLL1-activated NOTCH maintains the expression of muscle progenitor markers including PAX3, MYF5 and FGFR4, while inhibiting the expression of muscle differentiation genes, MYOD, MYOG, DES and MEF2C and Myosins (Bonnet et al., 2010, Havis et al., 2012). Based on the RCAS system, DLL1 will be overexpressed only in a subset of proliferating cells (any cell types). Consequently, DLL1 will act in trans to adjacent cells. Therefore, even if a subset of proliferating cells overexpressing DLL1 inhibited NOTCH in cis, the DLL1 signal is sufficient to activateNOTCH in trans according to the phenotypes observed after DLL1 overexpression in muscles, as reported in the papers cited above.In addition, since the authors claim it is Jag2 that is the ligand, why not use its cDNA? They could have used electroporation of Jag2 in combination with the muscle-specific promoter they used with the next experiment (DN Dll1) that would drive its expression in differentiated fibers. It would also have been appropriate to use siRNA directed against Jag2. The reviewers do not insist on redoing the experiments with Jag2, although if the authors have these data they should be included.We used the DLL1/RCAS virus since it has been proven to induce consistently a NOTCH gain-of-function phenotype in limb muscles, i.e. an inhibition of muscle differentiation (based on the inhibition of differentiation muscle markers) and maintenance of progenitors (based on the expression of muscle progenitor markers) (Delfini et al., 2000; Bonnet et al., 2010; Havis et al., 2012). Moreover, we now show that the long-term activation of (DLL1-mediated) NOTCH maintains the number of PAX7+ cells despite the absence of differentiated muscle cells (Figure 4—figure supplement 1). This result is fully consistent with mouse data that show that activated Notch (NICD in Myf5+ cells) sustains muscle progenitors despite a block of differentiation (Mourikis et al., 2012).To block NOTCH ligand activity, we have used an already described dominant negative form of DLL1, which has been shown to block the activity of all NOTCH ligands by preventing NOTCH ligand processing in signal-sending cells and therefore blocked NOTCH activation in signal-receiving cells (Chitnis, 2006; Henrique et al., 1997).The DLL1/RCAS and DLL1/DN tools were already available and have been proven to be efficient to increase NOTCH activity and block NOTCH ligand function, respectively, so we did not repeat the experiments with JAG2.In any case, since Jag2 is membrane bound, they should show that they have an effect only in cells in direct contact with the Jag2/ Dll1 over-expressing fibers.The phenotype observed is a decrease in the number of PAX7+ cells upon loss of NOTCH ligand function in differentiated muscle cells (Figure 5). So it will be difficult to visualize a direct contact with the DLL1/DN overexpressing fibres (Tomato) and the absent PAX7+ cells.6) It is not clear that Yap activation is downstream of muscle contraction and also that Yap activates Jag2 expression in myofibers. Of course, the most convincing data would be for the authors to show that ectopic activation of YAP in myofibers (via Tol2 MLC electroporation) rescues the loss of PAX7+ progenitors when myofibers have been immobilized. This experiment would considerably strengthen the paper and should be do-able by the authors since they have the Tol2 MLC construct.We have now performed the YAP rescue experiments in differentiated muscle cells (using the MLC promoter and the Tol2 stable vectors). We indeed found that forced YAP activity (YapS112A) in differentiated muscle cells (using the MLC promoter) prevented the decrease in the number of PAX7+ cells in immobilization conditions. It also prevented the downregulation of JAG2 transcription in muscles. Moreover, YapS112A activated the expression of ANKRD1 in paralyzed muscles. All these data are now included in a new Figure 7. In agreement with the referees, we believe that this YAP rescue experiment greatly strengthens the conclusion of the paper.7) Since YAP is such an ubiquitously expressed molecule, the authors should be careful in the phrasing of the conclusions.We have tried to be careful in our conclusions. Although YAP transcripts and protein are observed in many (if not all) cell types, our data nevertheless show that YAP acts downstream of muscle contraction to regulate JAG2 transcription in muscle fibres, which then regulates the pool of muscle progenitors via NOTCH.
Authors: Dean Yimlamai; Constantina Christodoulou; Giorgio G Galli; Kilangsungla Yanger; Brian Pepe-Mooney; Basanta Gurung; Kriti Shrestha; Patrick Cahan; Ben Z Stanger; Fernando D Camargo Journal: Cell Date: 2014-06-05 Impact factor: 41.582
Authors: Morgan E Carlson; Charlotte Suetta; Michael J Conboy; Per Aagaard; Abigail Mackey; Michael Kjaer; Irina Conboy Journal: EMBO Mol Med Date: 2009-11 Impact factor: 12.137
Authors: Thomas Volckaert; Tingting Yuan; Jie Yuan; Eistine Boateng; Seantel Hopkins; Jin-San Zhang; Victor J Thannickal; Reinhard Fässler; Stijn P De Langhe Journal: Development Date: 2019-01-16 Impact factor: 6.868
Authors: Michael R Hicks; Julia Hiserodt; Katrina Paras; Wakana Fujiwara; Ascia Eskin; Majib Jan; Haibin Xi; Courtney S Young; Denis Evseenko; Stanley F Nelson; Melissa J Spencer; Ben Van Handel; April D Pyle Journal: Nat Cell Biol Date: 2017-12-18 Impact factor: 28.824
Authors: Kevin A Murach; Christopher S Fry; Esther E Dupont-Versteegden; John J McCarthy; Charlotte A Peterson Journal: FASEB J Date: 2021-10 Impact factor: 5.834