The mitochondrial acyl carrier protein (ACP) coordinates mitochondrial fatty acid synthesis with iron sulfur cluster biogenesis.

Mitochondrial fatty acid synthesis (FASII) and iron sulfur cluster (FeS) biogenesis are both vital biosynthetic processes within mitochondria. In this study, we demonstrate that the mitochondrial acyl carrier protein (ACP), which has a well-known role in FASII, plays an unexpected and evolutionarily conserved role in FeS biogenesis. ACP is a stable and essential subunit of the eukaryotic FeS biogenesis complex. In the absence of ACP, the complex is destabilized resulting in a profound depletion of FeS throughout the cell. This role of ACP depends upon its covalently bound 4'-phosphopantetheine (4-PP)-conjugated acyl chain to support maximal cysteine desulfurase activity. Thus, it is likely that ACP is not simply an obligate subunit but also exploits the 4-PP-conjugated acyl chain to coordinate mitochondrial fatty acid and FeS biogenesis.

Introduction

The mitochondrial acyl carrier protein (ACP; Figure 1—figure supplement 1) plays a critical role in the evolutionarily conserved type II fatty acid biosynthesis pathway (FASII; Figure 1—figure supplement 2A). Unlike the cytosolic fatty acid biosynthesis pathway (FASI), the mitochondrial FASII system, which is homologous to the prokaryotic fatty acid biosynthesis pathway, utilizes a set of monofunctional enzymes that interact transiently with ACP to catalyze the initiation and elongation of nascent acyl chains (Hiltunen et al., 2010). To facilitate FASII, ACP utilizes a 4’-phosphopantetheine prosthetic group (4-PP), which is covalently bound to an invariant Ser residue (Majerus et al., 1965; Stuible et al., 1998). As such, ACP serves as a soluble scaffold for acyl intermediates during the stepwise process of de novo fatty acid synthesis. Currently, it is thought that the primary product of ACP-dependent FASII is octanoate, which is cleaved from ACP and further processed to generate lipoic acid. Lipoic acid is an obligate cofactor of the pyruvate dehydrogenase and α-ketoglutarate dehydrogenase complexes as well as the branched chain α-keto acid dehydrogenase and glycine cleavage complex (Hiltunen et al., 2010; Brody et al., 1997). In addition, a FASII-derived acyl chain other than lipoic acid is required for RNase P function in tRNA maturation (Schonauer et al., 2008).

Figure 1—figure supplement 1.

Protein sequence alignment of ACP from eukaryotes.

(A) Protein sequence alignment of the ACP proteins from the indicated species (Clustal Omega). D.m. – Drosophila melanogaster, D.r. – Danio rerio, H.s. – Homo sapiens, M.m. – Mus musculus, S.c. – Saccharomyces cerrevisiae, N.c. – Neuropsora crassa. The invariant Ser residue to which 4-PP is conjugated is indicated.

DOI: http://dx.doi.org/10.7554/eLife.17828.004

Figure 1—figure supplement 2.

Eukarotic mitochondrial fatty acid biosynthesis (FASII) pathway.

(A) Eukaryotic cells have maintained two distinct fatty acid synthesis pathways—the canonical cytoplasmic FASI and the mitochondrial FASII, which is homologous to the prokaryotic fatty acid synthesis pathway. FASII, which is dependent on ACP, is comprised of a set of monofunctional enzymes that catalyze the various steps in fatty acid synthesis. In order to facilitate mitochondrial fatty acid synthesis, apo-ACP must first be converted to holo-ACP by a 4’-phosphopanthetheine transferase (Ppt2), which catalyzes the covalent attachment of the 4-phosphopantetheine prosthetic group (4-PP) to an absolutely conserved Ser residue on ACP. The 4-PP contains a terminal thiol that serves as the attachment site to enable Acp1 to scaffold de novo fatty acid synthesis. The enzymes of FASII use malonyl-coA to initiate the fatty acid chain and acetyl-coA for acyl chain elongation. The canonical product of FASII is octanoate, which is the precursor for lipoic acid, an important mitochondrial cofactor. Following ACP-dependent octanoate synthesis, Lip2, Lip3, Lip5, and Gcv3 support the synthesis of lipoic acid and ligation to its target proteins including the E3 component of pyruvate dehydrogenase and α-ketoglutarate dehydrogenase. Ppt2 – 4’phophopantetheine transferase; MCT – malonyl-coA transferase; KAS – ketoacyl synthetase; KAR – ketoacyl reductase; HTD2 – hydroxyacyl-thioester reductase type 2; ETR – enoyl-thioester reductase; Lip2, Lip3, Lip5, Gcv3 – lipoic acid biosynthesis and ligation. (B) acp1Δ heterozygous diploids in the W303 strain background were dissected with and without a plasmid expressing Acp1-V5 and spores were grown on YPAD medium for 2 days. (C) ppt2Δ, lip5Δ, lip2Δ, lip3Δ, and gcv3Δ heterozygous diploids were dissected and spores were grown on YPAD medium for 2 days.

DOI: http://dx.doi.org/10.7554/eLife.17828.005

Biochemical analyses of mammalian FASII enzymes demonstrate that this pathway is capable of generating ACP-bound acyl chains as long as fourteen carbons (Zhang et al., 2005). Since lipoic acid biosynthesis requires an acyl chain of just eight carbons, it is likely that these extended FASII-synthesized fatty acids serve an alternative function in mitochondria (Brody et al., 1997). Indeed, proteomic and structural studies have demonstrated that ACP is a stable accessory subunit of mitochondrial respiratory Complex I (CI) (Sackmann et al., 1991; Angerer et al., 2014). Furthermore, the pool of ACP associated with CI contains a 4-PP-conjugated 3-hydroxymyristic acid, however, the functional importance of this 14-carbon acyl chain has never been investigated in the context of CI activity or assembly (Carroll et al., 2003).

In Saccharomyces cerevisiae, ACP1, the gene encoding ACP, is essential for cell viability in multiple strain backgrounds, while the genes required for lipoic acid biosynthesis and ligation are not (Figure 1A, Figure 1—figure supplement 2B,C) (Schonauer et al., 2008; Brody et al., 1997). This is consistent with reports demonstrating that ACP is essential for viability in Yarrowia lipolytica (Dobrynin et al., 2010) and in mammalian cells (Yi and Maeda, 2005; Feng et al., 2009). Moreover, S. cerevisiae mitochondria do not have CI or any structurally similar analog of it. Since neither known function explains the essentiality of ACP1, we reasoned that ACP must perform a distinct, unknown, and essential mitochondrial function.

Figure 1.

Acp1 is a stable subunit of the ISU complex.

(A) acp1Δ heterozygous diploids were dissected with and without a plasmid expressing Acp1-HA (BY4741) and spores were grown on YPAD medium for 2 days. Sporulation of the heterozygous deletion strain failed to generate haploid ACP1 deletion strains unless a vector borne ACP1 gene was present. (B) Purified mitochondria from cells either expressing Acp1-HA or not were solubilized by digitonin (input) and then subjected to anti-HA immunoprecipitation. The resulting eluates and input samples were subjected to SDS-PAGE and BN-PAGE and immunoblot.

DOI: http://dx.doi.org/10.7554/eLife.17828.003

(A) Protein sequence alignment of the ACP proteins from the indicated species (Clustal Omega). D.m. – Drosophila melanogaster, D.r. – Danio rerio, H.s. – Homo sapiens, M.m. – Mus musculus, S.c. – Saccharomyces cerrevisiae, N.c. – Neuropsora crassa. The invariant Ser residue to which 4-PP is conjugated is indicated.

DOI: http://dx.doi.org/10.7554/eLife.17828.004

(A) Eukaryotic cells have maintained two distinct fatty acid synthesis pathways—the canonical cytoplasmic FASI and the mitochondrial FASII, which is homologous to the prokaryotic fatty acid synthesis pathway. FASII, which is dependent on ACP, is comprised of a set of monofunctional enzymes that catalyze the various steps in fatty acid synthesis. In order to facilitate mitochondrial fatty acid synthesis, apo-ACP must first be converted to holo-ACP by a 4’-phosphopanthetheine transferase (Ppt2), which catalyzes the covalent attachment of the 4-phosphopantetheine prosthetic group (4-PP) to an absolutely conserved Ser residue on ACP. The 4-PP contains a terminal thiol that serves as the attachment site to enable Acp1 to scaffold de novo fatty acid synthesis. The enzymes of FASII use malonyl-coA to initiate the fatty acid chain and acetyl-coA for acyl chain elongation. The canonical product of FASII is octanoate, which is the precursor for lipoic acid, an important mitochondrial cofactor. Following ACP-dependent octanoate synthesis, Lip2, Lip3, Lip5, and Gcv3 support the synthesis of lipoic acid and ligation to its target proteins including the E3 component of pyruvate dehydrogenase and α-ketoglutarate dehydrogenase. Ppt2 – 4’phophopantetheine transferase; MCT – malonyl-coA transferase; KAS – ketoacyl synthetase; KAR – ketoacyl reductase; HTD2 – hydroxyacyl-thioester reductase type 2; ETR – enoyl-thioester reductase; Lip2, Lip3, Lip5, Gcv3 – lipoic acid biosynthesis and ligation. (B) acp1Δ heterozygous diploids in the W303 strain background were dissected with and without a plasmid expressing Acp1-V5 and spores were grown on YPAD medium for 2 days. (C) ppt2Δ, lip5Δ, lip2Δ, lip3Δ, and gcv3Δ heterozygous diploids were dissected and spores were grown on YPAD medium for 2 days.

DOI: http://dx.doi.org/10.7554/eLife.17828.005

(A) Isd11-V5 and Acp1- HA were expressed from their endogenous loci and Isd11-V5 was immunoprecipitated from digitonin-solubilized mitochondria followed by the indicated immunoblots. (B) Nfs1-V5 and Acp1- HA were expressed from their endogenous loci and Nfs1-V5 was immunoprecipitated from digitonin-solubilized mitochondria followed by the indicated immunoblots.

DOI: http://dx.doi.org/10.7554/eLife.17828.006

Results and conclusions

To begin to define the essential function of Acp1, we purified endogenously expressed and fully functional Acp1-HA (Figure 1A) from purified mitochondria to discover interacting proteins that might explain the acp1Δ phenotype. We were particularly intrigued by the co-purification of three subunits of the ISU complex—Nfs1, Isd11, and Isu1—each of which is required for FeS biogenesis and essential for viability. The cysteine desulfurase (Nfs1) and Isd11 form the core of the ISU complex and catalyze the conversion of cysteine to alanine thereby generating a persulfide intermediate, which is the source of sulfide ions that combine with ferrous iron on the Isu1 scaffold protein to form [2Fe-2S] clusters (Garland et al., 1999; Mühlenhoff et al., 2004; Adam et al., 2006; Wiedemann et al., 2006). To confirm these interactions, we immunoprecipitated Acp1-HA from isolated mitochondria and analyzed the eluates by immunoblot. Indeed, Nfs1, Isd11, and Isu1 all specifically co-immunoprecipitate with Acp1, although Isu1 appears to interact less avidly than Nfs1 or Isd11 (Figure 1B). In addition to SDS-PAGE, the resultant eluates were also resolved by blue native (BN)-PAGE, which demonstrated that Acp1 co-purifies with the intact core Nfs1-Isd11 complex (Figure 1B). Finally, Nfs1-V5 and Isd11-V5 were each immunoprecipitated from isolated mitochondria. As expected, Acp1-HA was detected in the eluates of each immunoprecipitation (Figure 1—figure supplement 3). These results are further supported by proteomics-based interaction studies, which identify human ACP, NFS1, and ISD11 as mutually interacting proteins in mammalian cells (Huttlin et al., 2015). Taken together these data demonstrate that Acp1 is a stable and evolutionarily conserved subunit of the ISU complex with Nfs1, Isd11, and Isu1.

Figure 1—figure supplement 3.

Acp1 is a stable subunit of the ISU complex.

(A) Isd11-V5 and Acp1- HA were expressed from their endogenous loci and Isd11-V5 was immunoprecipitated from digitonin-solubilized mitochondria followed by the indicated immunoblots. (B) Nfs1-V5 and Acp1- HA were expressed from their endogenous loci and Nfs1-V5 was immunoprecipitated from digitonin-solubilized mitochondria followed by the indicated immunoblots.

DOI: http://dx.doi.org/10.7554/eLife.17828.006

FeS biogenesis is an essential function of mitochondria and is absolutely dependent on the ISU complex with which Acp1 stably interacts (Lill et al., 1999). Thus, we hypothesized that the essential function of Acp1 might relate to FeS biogenesis. We engineered inducible ACP1 knockdown strains (Acp1KD) using two distinct strategies and strain backgrounds—TetO7-ACP1 in the BY4741 background and Gal-ACP1 in the DY150 background, in which ACP1 expression is suppressed by doxycycline and galactose withdrawal, respectively. As expected, Acp1KD cells from each background displayed attenuated growth upon ACP1 shutdown, which is particularly evident on respiration-requiring glycerol medium (Figure 2—figure supplement 1A–C). Importantly, viability could be restored in each of these strains by episomal expression of the Acp1-HA at endogenous levels. In addition to the expected loss of lipoic acid-containing subunits of pyruvate dehydrogenase and α-ketoglutarate dehydrogenase in the Acp1KD cells, we also observed a specific destabilization of the FeS-containing subunits of Complex II (Sdh2) and Complex III (Rip1) and loss of those assembled respiratory complexes (Figure 2A and Figure 2—figure supplement 2A). A similar destabilization of these complexes occurs in cells depleted for Nfs1 and Isu1 (Adam et al., 2006; Wiedemann et al., 2006). Importantly, Complex III biogenesis stalls in Acp1KD cells at the final stage of assembly – incorporation of the Rieske FeS protein (Rip1) (Figure 2A; IB: Rip1)–resulting in the accumulation of a stable assembly intermediate of Complex III lacking Rip1 (Figure 2A; III2*; IB: Qcr7). The presence of the late stage intermediate III2* indicates that mitochondrial translation of the Cob cytochrome b subunit is normal in Acp1KD cells (Atkinson et al., 2011; Cui et al., 2012). Likewise, translation of the mitochondrial subunits of ATP synthase is normal as seen by the assembled F1F0 complex (Figure 2A). We also observed a loss of activity of aconitase, a mitochondrial enzyme with an obligate FeS cofactor (Figure 2B and Figure 2—figure supplement 2B).

Figure 2—figure supplement 1.

ACP1 expression is required for cell proliferation.

(A) Ten-fold serial dilutions of WT, TetO7-ACP1, and TetO7-ACP1 cells expressing Acp1-HA were plated on synthetic media containing the indicated carbon source with and without 10 μg/mL doxycycline (BY4741 background). (B) Liquid cultures (2% raffinose) with and without 10 μg/mL doxycycline were inoculated to an OD. 025 with either WT or TetO7-ACP1 cells. Growth was monitored by absorbance at 600 nm. (C) Ten-fold serial dilutions of WT, Gal-ACP1, and Gal-ACP1 cells expressing Acp1-HA were serially diluted and plated on synthetic media containing the indicated carbon source. With pre-growth of the Gal-ACP1 strain on glucose medium, subsequent plating of the cells on glucose shows moderate growth impairment. The depletion of Acp1 in TetO7-ACP1 cells is more efficient compared to Gal-ACP1 cells.

DOI: http://dx.doi.org/10.7554/eLife.17828.009

Figure 2.

Acp1 is required for FeS biogenesis.

(A) Isolated mitochondria from the indicated strains were resolved by SDS-PAGE (upper panel) or solubilized in 1% digitonin and resolved by BN-PAGE (lower panel). The time course indicates the time following addition of 10 μg/mL doxycycline to the cultures, which suppresses expression from the TetO7-ACP1 allele. The indicated proteins and protein complexes were assessed by immunoblot. LA indicates lipoic acid-conjugated Lat1 (PDH complex subunit; upper band) and Kgd2 (α-ketoglutarate dehydrogenase complex subunit; lower band). (B) Aconitase activity was measured in whole cell lysates from the indicated strains containing the indicated plasmids 18 hr post-addition of 10 μg/mL doxycycline (± SEM; N = 3 biological replicates. ***p<0.0005, ****p<0.00005). (C) qPCR was used to measure the expression of ACP1, FIT2, and FIT3 in the indicated strains. The Gal-ACP1 strain was harvested at 28 hr post-transfer to raffinose medium to suppress ACP1 expression. The mrs3/4∆ strain lacks both Mrs3 and Mrs4 mitochondrial iron transporters. BPS (80 μM) is a Fe(II) chelator that causes depletion of bioavailable iron. FIT2 and FIT3 are components of the iron regulon that is induced upon loss of cytosolic FeS (± SEM; N = 3 biological replicates. *p<0.05, **p<0.005, ***p<0.0005).

DOI: http://dx.doi.org/10.7554/eLife.17828.007

This file contains raw source data used to make the graphs presented in Figure 2B,C Figure 2—figure supplement 2B and C. PRISM software was used to graph all quantitative data and perform statistical analyses. p values for pairwise comparisons were determined using a Student’s t test.

DOI: http://dx.doi.org/10.7554/eLife.17828.008

(A) Ten-fold serial dilutions of WT, TetO7-ACP1, and TetO7-ACP1 cells expressing Acp1-HA were plated on synthetic media containing the indicated carbon source with and without 10 μg/mL doxycycline (BY4741 background). (B) Liquid cultures (2% raffinose) with and without 10 μg/mL doxycycline were inoculated to an OD. 025 with either WT or TetO7-ACP1 cells. Growth was monitored by absorbance at 600 nm. (C) Ten-fold serial dilutions of WT, Gal-ACP1, and Gal-ACP1 cells expressing Acp1-HA were serially diluted and plated on synthetic media containing the indicated carbon source. With pre-growth of the Gal-ACP1 strain on glucose medium, subsequent plating of the cells on glucose shows moderate growth impairment. The depletion of Acp1 in TetO7-ACP1 cells is more efficient compared to Gal-ACP1 cells.

DOI: http://dx.doi.org/10.7554/eLife.17828.009

(A) Isolated mitochondria from WT, TetO7-ACP1, or TetO7-ACP1 cells expressing Acp1-HA were harvested at the indicated times post addition of doxycycline were resolved by SDS-PAGE (upper panels) or solubilized in 1% digitonin and resolved by BN-PAGE (lower panels). (B) Aconitase activity was measured in mitochondrial lysates from WT and Gal-ACP1 cells at 28 hr post-transfer to raffinose-containing medium (± SEM; N = 3 biological replicates. ***p<0.0005). (C) The cytosolic FeS-containing sulfite reductase activity was measured in whole cell lysates from WT and Gal-ACP1 cells at 28 hr post-transfer to raffinose-containing medium (± SEM; N = 3 biological replicates. **p<0.005).

DOI: http://dx.doi.org/10.7554/eLife.17828.010

Figure 2—figure supplement 2.

Acp1 is essential for FeS biogenesis.

(A) Isolated mitochondria from WT, TetO7-ACP1, or TetO7-ACP1 cells expressing Acp1-HA were harvested at the indicated times post addition of doxycycline were resolved by SDS-PAGE (upper panels) or solubilized in 1% digitonin and resolved by BN-PAGE (lower panels). (B) Aconitase activity was measured in mitochondrial lysates from WT and Gal-ACP1 cells at 28 hr post-transfer to raffinose-containing medium (± SEM; N = 3 biological replicates. ***p<0.0005). (C) The cytosolic FeS-containing sulfite reductase activity was measured in whole cell lysates from WT and Gal-ACP1 cells at 28 hr post-transfer to raffinose-containing medium (± SEM; N = 3 biological replicates. **p<0.005).

DOI: http://dx.doi.org/10.7554/eLife.17828.010

Source data for Figure 2.

The mitochondrial ISU complex is essential for the production of FeS that act in the cytosol as well as ribosome assembly (Kispal et al., 2005). In addition, mitochondrial FeS synthesis is important to attenuate the transcriptional activity of two partially redundant iron-responsive factors Aft1 and Aft2. In Acp1KD cells the expression of Aft1-target genes FIT2 and FIT3 was elevated consistent with impaired mitochondrial FeS synthesis (Figure 2C) (Chen et al., 2004; Rutherford et al., 2005). These Aft1 target genes are also induced in cells lacking the two mitochondrial iron transporters Mrs3 and Mrs4 (Figure 2C). To further assess the perturbation of cytosolic FeS function, we quantified the activity of the cytosolic FeS-containing enzyme sulfite reductase and observed a diminution in Acp1KD cells (Figure 2—figure supplement 2C). Combined with the essential nature of ACP1, these data demonstrate that Acp1 is essential for FeS biogenesis.

We next sought to define the mechanism underlying the observed necessity of Acp1 for FeS biogenesis, focusing specifically on the ISU complex. Acp1KD cells exhibited a marked diminution of the assembled Nfs1-Isd11 complex, similar to depletion of the other ISU complex subunits (Figure 3A, Figure 3—figure supplement 1A,B). Importantly, the Nfs1 and Isd11 protein that remain in these cells is found only in insoluble aggregates in contrast to WT cells where Nfs1 and Isd11 are soluble (Figure 3B). Thus, in the absence of Acp1, the Nfs1-Isd11 complex is destabilized, most likely causing a loss of cysteine desulfurase activity. To determine if mammalian ACP is also necessary for maintaining steady state levels of the FeS biogenesis complex in mammalian cells, C2C12 mouse myoblasts were transfected with a pool of siRNAs targeting NDUFAB1 (the gene encoding mammalian ACP) or a control siRNA. While our methods were unable to detect the mammalian Nfs1-Isd11 complex by BN-PAGE, depletion of ACP in these cells was accompanied by a clear destabilization of the subunits of the mammalian FeS biogenesis machinery, NFS1, ISD11, and ISCU2, which is the mammalian version of Isu1 (Figure 3C). Thus, ACP plays an evolutionarily conserved role in stabilizing the ISU complex thereby enabling FeS biogenesis.

Figure 3.

ACP promotes FeS biogenesis by maintaining the stability of the ISU (Nfs1-Isd11) complex.

(A) Purified mitochondria from the indicated strains were either resolved by SDS-PAGE (lower panels) or solubilized in 1% digitonin and resolved by BN-PAGE (upper panels). Cells were grown for 18 hr in the presence of 10 μg/mL doxycycline. The indicated proteins and protein complexes were assessed by immunoblot. (B) Mitochondria purified from the indicated strains 18 hr post-addition of 10 μg/mL doxycycline were solubilized with 1% Triton X-100. Soluble (S) and pellet (P) fractions were separated by centrifugation at 100,000 g. The fractions, along with the total input (T) were resolved by SDS-PAGE and assessed by immunoblot. (C) C2C12 mouse myoblasts were transfected with a pool of siRNA targeting NDUFAB1 (ACP) or a scrambled control. Isolated mitochondria was resolved by SDS-PAGE and assessed by immunoblot. (D) Isolated mitochondria from the WT and Gal-ACP1 strains expressing the indicated gene via a 2 μ plasmid at 28 hr post-transfer to raffinose-containing medium were either resolved by SDS-PAGE (lower panels) or solubilized in 1% digitonin and resolved by BN-PAGE (upper panels). The indicated proteins and protein complexes were assessed by immunoblot.

DOI: http://dx.doi.org/10.7554/eLife.17828.011

This file contains raw source data used to make the graphs presented in Figure 3—figure supplement 1C. PRISM software was used to graph all quantitative data and perform statistical analyses. p values for pairwise comparisons were determined using a Student’s t test.

DOI: http://dx.doi.org/10.7554/eLife.17828.012

(A) Isolated mitochondria from WT and TetO7-ACP1 cells harvested at the indicated time points post-addition of doxycycline were resolved by SDS-PAGE (upper panel) or solubilized in 1% digitonin and resolved by BN-PAGE (lower panel). (B) Indicated strains were grown in raffinose for 32 hr to repress expression of the indicated genes. YFH1 was depleted in a Met3-YFH1 strain cultured in the presence of 2.5 mM methionine. Isolated mitochondria from each strain was either resolved by SDS-PAGE (upper panel) or solubilized in 1% digitonin and resolved by BN-PAGE (lower panel). Depletion of ISD11, but not ISU1 subunit destabilizes Nfs1-Isu11 complex on BN-PAGE as ACP1 depletion does, suggesting Acp1 acts through Isd11 to destabilize Nfs1. (C) Aconitase activity was measured in mitochondrial lysates from WT and Gal-ACP1 cells overexpressing MRS3 or ISU1 harvested at 28 hr post-transfer to raffinose-containing medium (± SEM; N = 3 biological replicates. *p<0.05, ***p<0.0005). (D) Isolated mitochondria from the WT and Gal-ACP1 strains expressing the indicated gene via a 2 μ plasmid at 28 hr post-transfer to raffinose-containing medium were either resolved by SDS-PAGE (lower panels) or solubilized in 1% digitonin and resolved by BN-PAGE (upper panels). The indicated proteins and protein complexes were assessed by immunoblot. * indicates non-specific band.

DOI: http://dx.doi.org/10.7554/eLife.17828.013

Figure 3—figure supplement 1.

ACP promotes FeS biogenesis by maintaining the stability of the ISU (Nfs1-Isd11) complex.

(A) Isolated mitochondria from WT and TetO7-ACP1 cells harvested at the indicated time points post-addition of doxycycline were resolved by SDS-PAGE (upper panel) or solubilized in 1% digitonin and resolved by BN-PAGE (lower panel). (B) Indicated strains were grown in raffinose for 32 hr to repress expression of the indicated genes. YFH1 was depleted in a Met3-YFH1 strain cultured in the presence of 2.5 mM methionine. Isolated mitochondria from each strain was either resolved by SDS-PAGE (upper panel) or solubilized in 1% digitonin and resolved by BN-PAGE (lower panel). Depletion of ISD11, but not ISU1 subunit destabilizes Nfs1-Isu11 complex on BN-PAGE as ACP1 depletion does, suggesting Acp1 acts through Isd11 to destabilize Nfs1. (C) Aconitase activity was measured in mitochondrial lysates from WT and Gal-ACP1 cells overexpressing MRS3 or ISU1 harvested at 28 hr post-transfer to raffinose-containing medium (± SEM; N = 3 biological replicates. *p<0.05, ***p<0.0005). (D) Isolated mitochondria from the WT and Gal-ACP1 strains expressing the indicated gene via a 2 μ plasmid at 28 hr post-transfer to raffinose-containing medium were either resolved by SDS-PAGE (lower panels) or solubilized in 1% digitonin and resolved by BN-PAGE (upper panels). The indicated proteins and protein complexes were assessed by immunoblot. * indicates non-specific band.

DOI: http://dx.doi.org/10.7554/eLife.17828.013

Source data for Figure 3.

Interestingly, overexpression of the MRS3 iron transporter resulted in robust stabilization of the Nfs1-Isd11 complex in Acp1KD cells, while not restoring lipoic acid biosynthesis (Figure 3D). Elevated Mrs3 expression also restored Sdh2 and Rip1 protein abundance and complex assembly as well as aconitase activity in Acp1KD cells (Figure 3D and Figure 3—figure supplement 1C). We tested whether overexpression of other components of the ISU complex stabilized the Nfs1-Isd11 complex in cells depleted of Acp1. Elevated levels of Isu1 yielded a modest stabilization and restored aconitase activity (Figure 3D and Figure 3—figure supplement 1C), while overexpression of Yfh1, the yeast frataxin homologue, had no effect (Figure 3—figure supplement 1D). We speculate that elevated Mrs3 may increase the Fe(II) occupancy of Isu1, which enables it to more effectively stabilize the ISU complex.

Acp1 requires a 4-PP prosthetic group to support mitochondrial fatty acid synthesis. The gene encoding 4-PP transferase, PPT2, is not essential, but the haploid deletion strain exhibits no growth in respiration-requiring medium and impaired growth on glucose, which does not require respiration (Figure 1—figure supplement 2C and Figure 4—figure supplement 1A). The growth impairment on glucose is not explained by any known function of ACP and therefore may relate to defects in FeS biogenesis.

Figure 4—figure supplement 1.

Acp1 requires a 4-PP-conjugated acyl chain to fully stabilize the ISU complex.

(A) Ten-fold serial dilutions of the indicated strains plated on synthetic medium with either glucose or glycerol. (B) Ten-fold serial dilutions of the indicated strains expressing the indicated plasmids were plated on synthetic media containing 10 μg/mL doxycycline and either glucose, raffinose, or glycerol. (C) Purified mitochondria from WT and ppt2Δ cells expressing Acp1-HA were solubilized by digitonin (input) and then subjected to anti-HA immunoprecipitation. The resulting eluates and input samples were subjected to SDS-PAGE.

DOI: http://dx.doi.org/10.7554/eLife.17828.016

To directly test the role of the 4-PP prosthetic group and the acyl chain that is conjugated to it, we investigated the ability of apo-Acp1 lacking 4-PP to support FeS biogenesis. Apo-Acp1 can be generated in vivo by mutating the invariant Ser (S82) to which 4-PP is conjugated (Stuible et al., 1998). While re-expression of WT Acp1 could fully restore the steady state abundance of the Nfs1-Isd11 complex in Acp1KD cells, expression of Acp1S82A had only modest effects (Figure 4A). These modest effects were sufficient to enable the Acp1KD cells expressing Acp1S82A to retain viability, albeit with impaired grow rate, and to exhibit a modest recovery of aconitase activity compared to Acp1KD cells (Figure 4B, Figure 4—figure supplement 1B). Thus, the apparent absence of the Nfs1-Isd11 complex on BN gels is likely the result of a severely destabilized complex that is not capable of surviving the stringent detergent conditions of BN-PAGE and not the complete loss of the complex in vivo.

Figure 4.

Acp1 requires a 4-PP-conjugated acyl chain to fully stabilize the ISU complex.

(A) Isolated mitochondria from the indicated strains expressing the indicated genes by plasmid were either resolved by SDS-PAGE (upper panels) or solubilized in 1% digitonin and resolved by BN-PAGE (lower panels). The indicated proteins and protein complexes were assessed by immunoblot. Cells were grown for 18 hr in the presence of 10 μg/mL doxycycline. (B) Aconitase activity was measured in whole cell lysates from the indicated strains grown for 18 hr in the presence of 10 μg/mL doxycycline (± SEM; N = 3 biological replicates. *p<0.05, **p<0.005, ***p<0.0005). (C) Isolated mitochondria from the indicated strains were either resolved by SDS-PAGE (upper panels) or solubilized in 1% digitonin and resolved by BN-PAGE (lower panels). The indicated proteins and protein complexes were assessed by immunoblot. (D) Aconitase activity was measured in whole cell lysates from the indicated strains (± SEM; N = 3 biological replicates. ***p<0.0005). (E) Sulfite reductase activity was measured in whole cell lysates from the indicated strains (± SEM; N = 3 biological replicates. **p<0.005).

DOI: http://dx.doi.org/10.7554/eLife.17828.014

This file contains raw source data used to make the graphs presented in Figure 4B, Figure 4D, and Figure 4E. PRISM software was used to graph all quantitative data and perform statistical analyses. p values for pairwise comparisons were determined using a Student’s t test.

DOI: http://dx.doi.org/10.7554/eLife.17828.015

(A) Ten-fold serial dilutions of the indicated strains plated on synthetic medium with either glucose or glycerol. (B) Ten-fold serial dilutions of the indicated strains expressing the indicated plasmids were plated on synthetic media containing 10 μg/mL doxycycline and either glucose, raffinose, or glycerol. (C) Purified mitochondria from WT and ppt2Δ cells expressing Acp1-HA were solubilized by digitonin (input) and then subjected to anti-HA immunoprecipitation. The resulting eluates and input samples were subjected to SDS-PAGE.

DOI: http://dx.doi.org/10.7554/eLife.17828.016

Source data for Figure 4.

To further investigate the role of the 4-PP-conjugated acyl chain in FeS biogenesis we interrogated the effects of PPT2 deletion on the function of Acp1 in FeS biogenesis. Like Acp1KD cells expressing Acp1S82A, the Nfs1-Isd11 complex was severely depleted in ppt2Δ cells (Figure 4C). Furthermore, these cells exhibit a clear diminution in activity of FeS-containing enzymes in both the mitochondria and cytosol as represented by aconitase and sulfite reductase activity, respectively (Figure 4D,E). We also interrogated the ability of Acp1 to interact with Nfs1 in WT and ppt2Δ cells. While the steady state levels of Acp1 are not affected in ppt2Δ cells (Figure 4C), we observed a clear defect in the ability of Acp1 to interact with Nfs1 in this strain (Figure 4—figure supplement 1C). Therefore, the Acp1-conjugated 4-PP plays an important role in the interaction of Acp1 with the core Nfs1-Isd11 complex and in FeS biogenesis. Importantly, lip5Δ cells, which cannot synthesize lipoic acid but remain competent for Acp1-dependent fatty acid synthesis (Hiltunen et al., 2010), maintain normal abundance of the Nfs1-Isd11 complex and aconitase and sulfide reductase activity (Figure 4C–E). Thus, the defects in FeS biogenesis observed in cells expressing apo-Acp1 are a result of the inability to generate an acyl-conjugated Acp1 species and not a defect in lipoic acid biosynthesis.

The data presented herein define a new and unexpected role of ACP in FeS biogenesis. ACP functions as a stable subunit of the ISU complex where it acts to stabilize the complex in part by exploiting a 4-PP-conjugated acyl chain. Unlike ACP, however, the acyl chain is not absolutely required for FeS biogenesis and viability, which raises the intriguing possibility that ACP is not simply an obligate subunit, but may exploit this unique interaction modality to provide additional structural or regulatory functions on FeS biogenesis. It is particularly intriguing to speculate that ACP may serve to coordinate mitochondrial fatty acid synthesis and FeS biogenesis, which represent two critical biosynthetic processes performed by mitochondria.

Materials and methods

Yeast strains and growth conditions

Saccharomyces cerevisiae BY4741 (MATa, his3 leu2 met15 ura3), Saccharomyces cerevisiae R1158 (BY4741 derivative; MATa, URA3::CMV-tTA, his3 leu2 met15), Saccharomyces cerevisiae W303a (MATa, his3 leu2 met15 trp1 ura3), and Saccharomyces cerevisiae DY150 (MATa ade2-1 his3-11 leu2-3,112 trp1-1 ura3-52 can1-100(oc)) were used as the wild-type strains where indicated. Each mutant was generated using a standard PCR-based homologous recombination method. The genotypes of all strains used in this study are listed in Supplementary file 1. Yeast transformation was performed by the standard TE/LiAc method and transformed cells were recovered and grown in synthetic complete glucose (SD) medium lacking the appropriate amino acid(s) for selection purposes. Medium used in this study includes YPA and synthetic minimal medium supplemented with 2% glucose, 2% raffinose, or 2% glycerol.

Growth assays were performed using synthetic minimal media supplemented with the appropriate amino acids and indicated carbon source. For plate-based growth assays, overnight cultures were back-diluted to equivalent ODs and spotted as 10-fold serial dilutions. For liquid culture growth assays, overnight cultures were back-diluted to equivalent ODs and grown at 30°C. Growth was monitored by absorbance at 600 nm.

To shut down expression of ACP1 in TetO7-ACP1, over-night cultures were used to inoculate synthetic media containing either 2% glucose or 2% raffinose and 10 μg/mL DOX to an approximate OD600 of 0.05 and incubated for 16–24 hr as indicated. To shut down the expression in Gal-ACP1, Gal-NFS1, Gal-ISD11, Gal-ISU1, and Met3-YFH1, over-night cultured cells were used to inoculate in synthetic media containing 2% raffinose to an approximate OD600 of 0.05 and incubated from 24 to 32 hr as indicated. For YFH1 shut down 2.5 mM methionine was added in the media.

Isolation of yeast mitochondria

Cell pellet was washed once with ddH2O and incubated in TD buffer (100 mM Tris-SO4, pH 9.4 and 100 mM DTT) for 15 min at 30°C. Spheroplasts were obtained by incubating cells in SP buffer (1.2 M Sorbitol and 20 mM potassium phosphate, pH 7.4) supplemented with 0.3 mg/mL lyticase for 1 hr at 30°C to remove the cell wall. Spheroplasts were gently washed once and homogenized in ice-cold SEH buffer (0.6 M sorbitol, 20 mM HEPES-KOH, pH 7.4, 2 mM MgCl2, 1 mM EGTA) using a dounce homogenizer applied with 30–40 strokes. Crude mitochondria were then isolated by differential centrifugation.

Immunoprecipitation

Crude mitochondria were isolated and resuspended to a concentration of 5 mg/mL. Mitochondria was solubilized in 0.7% digitonin for 30 min. Followed by centrifugation at 20,000 ×g for 20 min. Cleared mitochondrial lysates were incubated with anti-HA antibody conjugated agarose (Sigma) for 2 hr. at 4°C. The agarose was washed 3–5 times and eluted in Laemmli buffer (65°C, 10 min). Elutions were resolved by SDS-PAGE and assessed by immunoblot.

Steady-state protein analysis

Yeast mitochondria were solubilized in Laemmli buffer. Samples were resolved by SDS-PAGE and assessed by immunoblot.

Blue native polyacrylamide gel electrophoresis (BN-PAGE)

BN-PAGE was performed as described previously (Wittig et al., 2006). Mitochondria were resuspended in lysis buffer (Invitrogen) and solubilized with 1% digitonin. Lysates were resolved on a 4%–16% gradient native gel (Invitrogen).

Protein aggregation assays

Mitochondria were solubilized in Triton-X100 lysis buffer (0.5% Triton-X100, 20 mM HEPES-KOH, pH 7.4, 150 mM KCl). The samples were incubated on ice for 30 min. and centrifuged at 30,000 ×g for 10 min.

Aconitase activity assays

Yeast cells were grown in SD medium to early log phase, resuspended in lysis buffer (50 mM Tris-HCl, 50 mM KCl, 2 mM sodium citrate dihydrate, 10% glycerol, 1 mM PMSF, and 7 mM β-mercaptoethanol), and stored at –80°C overnight. After thawing on ice, cells were homogenized by vortexing with glass beads and cleared lysate was collected by centrifugation. Aconitase activity was measured by coupling with NADP+- dependent isocitrate dehydrogenase activity. 30 μl of crude lysate was mixed with 150 μl of reaction mixture (1 M Tris-Cl pH 8.0, 10 mM MgCl2, 10 mM NADP+, 0.32 units of NADP+- dependent Isocitrate Dehydrogenase), and 10 μl of 50 mM citrate. The reaction mixture was recorded at 340 nm for 2 min (15 s intervals). Aconitase activity was normalized to total protein concentration.

Sulfite reductase assays

To measure cytosolic iron, cells (50 ml cultures) were grown in SC –Met (To avoid repression of the enzyme expression by methionine) medium containing 2% glucose or raffinose as a carbon source till 1 of OD600 nm. Total cell lysate preparation and the enzyme assay was performed as described in (Rutherford et al., 2005) with modifications. Briefly, cell pellets were resuspended in buffer A (0.1 M Tris-Cl pH7.4, 10% glycerol, 1 mM EDTA pH 8.0, 1 mM phenylmethlysulfony fluoride (PMSF)) with lyticase and incubated 30°C for 45 min. After disruption using glass beads, 50 μl of cell lysates were mixed with 400 µl of assay mix with or without sulfite. After incubation at 37°C for 20 min, 100 μl of N,N-diethyl-p-phenylenediamine sulfate (DPD) and 100 μl of ferric chloride were added to the reaction mix to stop the reaction and incubated in the dark to develop the color for 20 min. The production of methylene blue was measured at 669 nm.

qPCR analysis

To quantify the expression of Fe regulon genes, total RNAs were extracted from yeast spheroplasts using RNeasy mini kit (QIAGEN). cDNA were synthesized from 1 μg of total RNA using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). 2 μl of 10X diluted cDNA reaction mix were mixed with SYBR Green real-time PCR master mix (Thermo Fisher) with primers and the PCR reaction were performed using the Mastercycler ep realplex (Eppendorf). Expression of genes of interesting was normalized to actin and fold changes was analyzed using the 2−ΔΔ method.

Primers used (Primers were designed to have 60°C of Tm using Primer3Plus online program)

ACT1_For ATTATATGTTTAGAGGTTGCTGCTTTGG

ACT1_Rev CAATTCGTTGTAGAAGGTATGATGCC

FIT2_For ACAAAGGTTGTCACCGAAGG

FIT2_Rev GATGATTCGACGGCTTGAGT

FIT3_For TCCGCTTTGGTTCTATCTGC

FIT3_Rev AGTGCTGCTGGCGTAAGAGT

ACP1_For ACTCTCCCAACATTGCCAAC

ACP1_Rev CAGCCACTTTGTCAGGGATT

Statistics

PRISM software was used to graph all quantitative data and perform statistical analyses. p values for pairwise comparisons were determined using a Student’s t test.

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

Thank you for submitting your article "The mitochondrial acyl carrier protein (ACP) coordinates mitochondrial fatty acid synthesis with FeS cluster biogenesis" for consideration by eLife. Your article has been reviewed by two peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Michael Marletta as the Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: John Markley (Reviewer #2).

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

Summary:

In this paper, the authors find that in addition to its role as a scaffold for acyl chain elongation, Acp1 (S. cerevisiae homolog) is also a subunit of the ISU complex involved in FeS biogenesis, a result that was also recently reported in human cells in the context of a large scale interactome study. Using genetic tools in yeast, the authors demonstrate loss of the ISU complex and FeS biogenesis (specifically OXPHOS complexes II and III subunits), as well as loss of a lipoic acid-containing PDH subunit as expected. Cytosolic FeS-containing systems were also affected and convincingly demonstrated (qPCR of transcripts known to be upregulated upon impaired mito FeS synthesis, activity of cytosolic sulfite reductase). Turnover of mammalian ISU subunits upon knockdown of NDUFAB1 (human ACP) was also demonstrated, suggesting the phenomenon is conserved (however more work will be needed to establish this given the complexities of the dually and now potentially triple localized human ACP, although this is probably out of the scope of this short report). Finally, using a mutant of ACP unable to conjugate the acyl chain, the authors demonstrate its importance in lipoic acid synthesis as expected, as well as FeS biogenesis. Interestingly, cells expressing only ACP unable to conjugate the acyl chain remain viable, suggesting the essentiality of ACP is in fact due to its involvement in FeS biogenesis. Knockout of the enzyme conjugating the acyl chain to ACP had a similar effect. The authors also found that overexpression of a mitochondrial ion transporter and to a lesser extent another subunit of the ISU complex, restored the levels of the ISU complex (and substrates). Taken together the assumption is that the stability of the ISU complex is being impaired or increased respectively, and also that the acyl chain has a primarily structural role in the ISU complex rather than a functional one. This is very nicely controlled report demonstrating a totally unexpected role for ACP in FeS biogenesis.

Essential revisions:

The reviewers felt that the paper is very strong but there was a consensus that a stronger caveat should be made with respect to the possible role of the acyl carrier group, based on the phenotype of the S82 mutant. It is possible that there is exclusively a structural role but that there is a structural defect in the S82 mutant that reduces folding/assembly to some extent. This would require a textual change.

Essential revisions:

The reviewers felt that the paper is very strong, and primarily minor changes are needed (see below).

There was a consensus that a stronger caveat should be made with respect to the possible role of the acyl carrier group, based on the phenotype of the S82 mutant. It is possible that there is exclusively a structural role but that there is a structural defect in the S82 mutant that reduces folding/assembly to some extent. This would require a textual change.

We agree with the critique and have no direct evidence to prove that apo-Acp1 folds analogously to holo-Acp1 however we have several pieces of data that suggest the defects observed in the S82A mutant can be attributed to the absence of a covalently bound acylated 4’-phosphopantetheine cofactor. While this alone does not prove that the S82A mutant achieves a native confirmation, we also know that apo-Acp1 has wild-type stability as it accumulates to the same degree as holo-Acp1 and is fully soluble. Furthermore, it is not completely unable to bind Isd11 and Nfs1. Newly included data demonstrates that apo-Acp1 can still bind the core ISU complex albeit with much reduced affinity. This is consistent with the observations that ACP and ISD11 make protein-protein contacts independent of those mediated by the acylated –PP. Taken together we feel strongly that the defects observed in cells expressing Acp1S82A, which mirror the defects seen in ppt2Δ cells, stem from a failure to make essential cofactor-protein and lipid-protein contacts. So while this does not prove the lack of some misfolding, we feel that the data strongly supports a structural role for the acylated cofactor in the ISU complex. Therefore, we are reluctant to add a statement in the text that we are quite confident is wrong and will be strongly disproven in the next several months with the publication of the structure. However, if the reviewers still feel strongly about this point, we will, of course, include the caveat as a possible interpretation.

New data: Figure 4—figure supplement 1C. In order to further interrogate the defects observed in cells expressing apo-Acp1, Acp1 was immunoprecipitated from WT and ppt2Δ cells. While Acp1 accumulated to similar extents and was readily soluble in each both strains, Acp1 in ppt2Δ cells pulled down far less Nfs1 than Acp1 from WT cells. This demonstrates that the 4-PP promotes, but is not absolutely essential, for mediating the Acp1-Nfs1 interaction.