Literature DB >> 27535718

Mechanosensing by the α6-integrin confers an invasive fibroblast phenotype and mediates lung fibrosis.

Huaping Chen1, Jing Qu1, Xiangwei Huang1, Ashish Kurundkar1, Lanyan Zhu2, Naiheng Yang1, Aida Venado1,3, Qiang Ding1, Gang Liu1, Veena B Antony1, Victor J Thannickal1, Yong Zhou1.   

Abstract

Matrix stiffening is a prominent feature of pulmonary fibrosis. In this study, we demonstrate that matrix stiffness regulates the ability of fibrotic lung myofibroblasts to invade the basement membrane (BM). We identify α6-integrin as a mechanosensing integrin subunit that mediates matrix stiffness-regulated myofibroblast invasion. Increasing α6-expression, specifically the B isoform (α6B), couples β1-integrin to mediate MMP-2-dependent pericellular proteolysis of BM collagen IV, leading to myofibroblast invasion. Human idiopathic pulmonary fibrosis lung myofibroblasts express high levels of α6-integrin in vitro and in vivo. Genetic ablation of α6 in collagen-expressing mesenchymal cells or pharmacological blockade of matrix stiffness-regulated α6-expression protects mice against bleomycin injury-induced experimental lung fibrosis. These findings suggest that α6-integrin is a matrix stiffness-regulated mechanosensitive molecule which confers an invasive fibroblast phenotype and mediates experimental lung fibrosis. Targeting this mechanosensing α6(β1)-integrin offers a novel anti-fibrotic strategy against lung fibrosis.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27535718      PMCID: PMC4992155          DOI: 10.1038/ncomms12564

Source DB:  PubMed          Journal:  Nat Commun        ISSN: 2041-1723            Impact factor:   14.919


Matrix stiffening is a prominent feature of pulmonary fibrosis12. Accumulating evidence suggests that mechano-interactions between fibrotic lung fibroblasts (known as myofibroblasts) and stiffened, fibrotic extracellular matrix (ECM) provide a feed-forward mechanism that amplifies lung fibrosis13456. Elucidating the key mechanosensitive molecules that confer fibrogenic properties to myofibroblasts may uncover novel therapeutic strategies for fibrotic lung diseases, including human idiopathic pulmonary fibrosis (IPF). Fibroblasts sense the mechanical properties of the ECM by integrin and non-integrin mechanoreceptors7. Integrins are cell-surface heterodimers composed of non-covalently associated α- and β-transmembrane subunits. As the major force-bearing molecular links between cells and the ECM, integrins play a central role in determining how cells sense and respond to their mechanical environment. α6-Containing integrins serve as cellular receptors for the members of laminin family, a major structural component of the basement membrane (BM). α6 (ITGA6) dimerizes with either β1- (ITGB1) or β4- (ITGB4) integrin subunit to form α6β1- or α6β4-integrin complex. In normal human embryonic and adult tissues, α6-integrins are found to be prominently expressed in epithelia, whereas normal fibroblasts express little α6-integrins8. α6β4-Integrin is the main component of hemidesmosome and is expressed by airway epithelial cells in healthy adults9. Mice null for α6-integrins are deficient in hemidesmosome formation and die at birth with severe blistering of skin and other epithelia10. A recent study showed that α6β4 marks a subpopulation of lung epithelial progenitor cells which are capable of self-renewal and differentiation into multiple respiratory epithelial cell types11. Although the role of α6-integrins in fibroblasts are limited, increasing α6-integrin expression has been observed in transformed neoplastic fibroblasts in human metastatic fibrosarcoma12. The BM is a dense, sheet-like structure at the interface of epithelial/endothelial and mesenchymal tissues. It maintains the polarity of lung epithelial cells and provides a physical barrier between lung epithelium and the mesenchyme. Cells invade the BM by adhering to BM matrices and engaging proteinase-dependent dissolution of BM at focal adhesions13. Alternatively, cells may transmigrate through the BM by proteinase-independent disassembly of BM superstructure and enlargement of pore size, a process termed mesenchymal–amoeboid transition14. The integrity of the BM maintains a healthy lung epithelium and its integrity is essential for restoration of alveolar epithelial homoeostasis following lung injury15. Loss of the BM integrity has been observed in IPF16. Mechanisms underlying disruption of the BM integrity in IPF are currently not well understood. Disruption of alveolar BMs prevents an orderly repair of the damaged alveolar type I epithelial cells, thus impairing normal reepithelialization17. It has been observed that intact BMs suppress programmed cell death in mammary epithelium and other tissues1819, suggesting that loss of the BM integrity may also promote alveolar epithelial cell apoptosis. Fibrotic lung fibroblasts are characterized by an invasive phenotype2021222324. White et al.20 reported that constitutively lower levels of PTEN in IPF lung myofibroblasts promote cell invasion into the BM, whereas α4β1 ligation-dependent expression of PTEN prevents cell invasion. Li et al.21 found that mouse lung myofibroblasts isolated from hyaluronan synthase 2 transgenic mice acquire an invasive phenotype. In a recent study, Lovgren et al.22 showed that knockdown of β-arrestin2 in IPF lung myofibroblasts attenuates cell invasiveness. Proteinases capable of degrading the BM include MMP2 and MMP9 of type IV collagenases. In the fibroblastic foci of IPF, subepithelial myofibroblasts close to the areas of BM disruption express MMP-2 as well as MMP-9 (ref. 25), suggesting that MMPs may mediate proteinase-dependent IPF myofibroblast invasion into the BM and the disruption of BM integrity. In this study, we report that α6 is a matrix stiffness-regulated mechanosensitive integrin subunit. Stiff matrix-induced upregulation of α6-expression mediates IPF lung myofibroblast invasion into the BM. We explore mechanotransductive mechanisms for α6-integrin expression and demonstrate that the expression of this integrin subunit by lung myofibroblasts is increased in both human IPF and bleomycin injury-induced experimental lung fibrosis. Animal studies using genetic and pharmacological approaches support targeting mechanosensitive α6-integrin as a novel therapeutic strategy for lung fibrosis.

Results

α6 Is a matrix stiffness-regulated mechanosensitive gene

To determine whether matrix stiffness regulates the expression of cell adhesion and ECM molecules, we performed a qPCR array analysis that contains 84 genes, including 16 integrin subunits in primary lung myofibroblasts isolated from patients with IPF (Supplementary Fig. 1). We found that 10 genes were increased or decreased ⩾twofold under stiff versus soft matrix conditions; the differential mRNA expression of 7 genes was statistically significant (Table 1). The α6-integrin subunit mRNA was increased 5.3-fold on stiff matrix. To validate these gene expression data, we performed additional studies at the protein level to determine if the α6-subunit is regulated by matrix stiffness; we observed a matrix stiffness grade-dependent increase in α6-integrin expression when cells were grown on polyacrylamide (PA) gels with stiffness ranging from 1 to 20 kPa (Fig. 1a). Similar results were obtained when cells were grown on a second stiffness-tunable substrate system of polydimethylsiloxane hydrogels (Supplementary Fig. 2a). Lung myofibroblasts isolated from bleomycin-treated mice also respond to matrix stiffening with increased α6-expression (Supplementary Fig. 2b,c). These results identify, for the first time, the α6-integrin subunit as a matrix stiffness-regulated mechanosensitive gene/protein.
Table 1

Matrix stiffness-regulated cell adhesion and ECM molecules.

GeneWellFold up or downregulation
  Stiff/soft
MMP9F046.4±1.6**
ITGA6C105.3±1.1**
CTGFB084.7±1.3**
MMP12E073.0±1.8*
SPP1G012.4±0.8*
MMP16E112.1±1.1
MMP11E06−5.1±2.1**
VCAM1G11−2.6±0.6**
ADAMTS8A03−2.3±0.8
CLEC3BG09−2.0±1.2

ECM, extracellular matrix.

Results are the means±s.d. of three separate experiments; *P<0.05; **P<0.01.

Figure 1

Stiff matrix upregulates α6-expression by ROCK-dependent activation of c-Fos/c-Jun transcription complex.

(a) IPF lung myofibroblasts were cultured on PA hydrogels with increasing stiffness (1, 5, 11 and 20 kPa). Levels of α6-protein were determined by immunoblot and flow cytometry, respectively. In flow cytometry, non-immune rat IgG2a, κ was used as isotype IgG control. (b) Schematic shows the WT and mutated human α6-promoters. Promoter activities were determined by luciferase assay. (c) Nuclear extracts from myofibroblasts cultured on soft and stiff matrix were incubated with immobilized oligonucleotides containing TREs. The TRE-binding activities of six AP-1 components as indicated were quantified by colorimetric enzyme-linked immunosorbant assay (ELISA). (d) The TRE-binding activity of Fra2 in nuclear extracts was quantified by colorimetric ELISA. Levels of Fra2 protein in cell lyates, cytoplasmic and nuclear fractions were determined by immunoblot. (e) Protein levels of phospho and total c-Fos and c-Jun under soft versus stiff matrix conditions were determined by immunoblot. (f) Effects of ROCK inhibitor Fasudil (Fasu) and ROCK-specific siRNAs on stiff matrix-induced phosphorylation of c-Fos and c-Jun. (g) The binding of c-Fos/c-Jun complex to the α6-promoter under soft versus stiff matrix conditions was measured by quantitative chromatin immunoprecipitation. (h) Schematic shows sgRNA-mediated targeted expression of KRAB transcription repressor at the distal TRE1 and the proximal TRE2 regions in human α6-promoter. Effects of CRISPRi-based disruption of c-Fos/c-Jun-dependent promoter activation on stiff matrix-induced α6-expression were evaluated by immunoblot and flow cytometry analyses. Control (Ctrl) indicates cells transfected with empty vector. (i) Effects of c-Fos/c-Jun inhibitors (T-5224 and c-Jun peptides) on matrix stiffness-regulated α6-expression were evaluated by immunoblot and flow cytometry. Results are the means ±s.d. of at least three separate experiments; *P<0.05; **P<0.01; one-way analysis of variance. a.u., arbitrary units.

A bioinformatics search identified AP-1-specific TPA-response elements (TREs) (TGA(G/C)TCA) in the promoter region of human and mouse α6-integrin genes (Supplementary Fig. 2d). It has been shown that mechanical stretch activates AP-1 in human osteoblastic cells26. Activation of AP-1 transcription complex is associated with cancer cell invasion2728. On the basis of this information, we sought to determine whether the AP-1 transcription complex mediates stiff matrix-induced α6-integrin gene expression. We first determined whether matrix stiffness regulates the promoter activity of α6-gene. A 6,200-bp of wild-type (WT) human proximal α6-promoter reporter and 3 mutated promoter reporters harbouring mutations at the specific AP-1-binding DNA sequences, TRE1 (−4,848 to −4,854 nt), TRE2 (−2,873 to −2,879 nt) or both TRE1 and TRE2, were transfected into IPF lung myofibroblasts (Fig. 1b). In cells transfected with WT α6-promoter reporter, stiff matrix significantly increased luciferase expression (Fig. 1b), suggesting that human α6-promoter activity is enhanced by stiff matrix. Deletion of either TRE1 or TRE2 inhibited stiff matrix-induced increases in α6-promoter activity. Deletion of both TRE1 and TRE2 completely blocked stiff matrix-induced α6-promoter activation (Fig. 1b). Altogether, these data suggest that stiff matrix activates α6-promoter by an AP-1-dependent mechanism. Next, we investigated effects of matrix stiffness on the binding of seven major AP-1 components (c-Fos, c-Jun, FosB, Fra1, Fra2, JunB and JunD) to immobilized TREs. Stiff matrix selectively increased c-Fos and c-Jun binding to immobilized oligonucleotides containing TREs, whereas the binding of FosB, Fra1, JunB and JunD to TREs were not altered by matrix stiffness (Fig. 1c). Previous studies have shown that Fos-related protein Fra2 is associated with human IPF and spontaneous development of lung fibrosis in mice29. In our studies, neither the binding of Fra2 to immobilized TREs nor its expression or cytoplasmic/nuclear distribution were regulated by matrix stiffness (Fig. 1d), suggesting that matrix stiffness is unlikely to regulate Fra2 activity. It has been shown that phosphorylation of c-Fos at Ser32/Thr232 and c-Jun at Ser63/Ser73 is associated with increased DNA-binding activity of c-Fos and c-Jun30. We found that stiff matrix (20 kPa) in comparison with soft matrix (1 kPa) increased the levels of phospho c-Fos at Ser32 and phospho c-Jun at Ser73 (Fig. 1e); the total protein and the mRNA levels of c-Fos and c-Jun were not altered by matrix stiffness (Fig. 1e and Supplementary Fig. 2e). Previously, we have shown that stiff matrix activates protein serine/threonine kinase ROCK in lung myofibroblasts4. Here, we observed that inhibition of ROCK by fasudil or siRNA-based knockdown blocked stiff matrix-induced c-Fos and c-Jun phosphorylation (Fig. 1f), suggesting that ROCK mediates stiff matrix-induced phosphorylation and activation of c-Fos/c-Jun transcription complex. Quantitative chromatin immunoprecipitation assay demonstrated that stiff matrix significantly increased the constitutive enrichment of α6-promoter DNA in phospho c-Fos antibody-immunoprecipitated chromatin of IPF lung myofibroblasts at both the proximal (−2,873/−2,879 nt) and distal (−4,848/−4,854 nt) TRE sites (Fig. 1g). Altogether, these data suggest that the c-Fos/c-Jun complex of AP-1 transcription factor family mediates stiff matrix-dependent transactivation of α6-gene. To determine whether inhibition of c-Fos/c-Jun-dependent α6-promoter activation blocks stiff matrix-induced α6-expression, we used CRISPR interference (CRISPRi) technology, which allows sequence-specific disruption of transcription factor binding to the promoter for gene silencing31. Two single guide RNAs (sgRNAs) were designed to specifically bind to a 20-bp DNA sequence next to each of two TREs in human α6-promoter (Fig. 1h). Expression of deactivated Cas9 (dCas9)-KRAB fusion proteins, in which dCas9 provides a DNA-binding platform at sites defined by sgRNAs for KRAB domain-mediated repression of c-Fos/c-Jun-dependent α6-promoter activation, blocked stiff matrix-induced α6-expression (Fig. 1h). Similar to CRISPRi, pharmacologic inhibition of c-Fos/c-Jun activity by T-5224, a selective c-Fos/AP-1 inhibitor, or by c-Jun peptide inhibitor also blocked stiff matrix-induced α6-integrin expression (Fig. 1i). We also observed that stiff matrix increases c-fos and c-jun binding to immobilized TREs in mouse lung myofibroblasts, whereas the binding of fosB, fra1, fra2, junB and junD to TREs were not altered by matrix stiffness (Supplementary Fig. 2f). Quantitative chromatin immunoprecipitation assay demonstrated that stiff matrix significantly increased the enrichment of mouse α6-promoter DNA in phospho c-Fos antibody-immunoprecipitated chromatin of mouse lung myofibroblasts (Supplementary Fig. 2g). Pharmacologic inhibition of c-Fos/c-Jun activity by T-5224 or decoy oligodeoxynucleotides32 blocked stiff matrix-induced mouse α6-expression (Supplementary Fig. 2h). Taken together, these data support a role for the c-Fos/c-Jun-dependent mechanotransduction pathway in stiff matrix-induced α6-expression.

α6 Mediates lung myofibroblast invasion

Fibrotic lung myofibroblasts isolated from patients with IPF are characterized by an invasive phenotype2021222324. To determine whether the mechanical properties of the ECM may regulate the ability of IPF lung myofibroblasts to invade the BM, we pre-cultured primary lung myofibroblasts isolated from patients with IPF on soft (1 kPa) and stiff (20 kPa) PA hydrogel substrates. The stiffness grades of soft and stiff PA gels were within the physiologic stiffness ranges of normal and fibrotic lungs12. Lung myofibroblasts adapted to soft and stiff matrix were trypsinized and transferred to the invasion chambers containing BM matrices (Matrigel). We observed that cells derived from stiff PA gels had a significantly higher invasion index than cells derived from soft PA gels (Fig. 2a). Similar findings were observed when cells were cultured on soft (2 kPa) and stiff (30 kPa) polydimethylsiloxane hydrogels (Supplementary Fig. 3a). These data suggest that stiff matrix promotes IPF lung myofibroblasts to invade the BM. To confirm these findings, we designed a ‘sandwich' invasion assay in which cells cultured on soft and stiff PA gels were directly transferred to invasion chambers with the apical (dorsal) side of cells in close contact with the BM matrices (Supplementary Fig. 3b). We observed enhanced invasive properties of lung myofibroblasts on stiff matrices using this second approach (Supplementary Fig. 3c). Since Matrigel may not fully replicate BM matrices found in vivo, we isolated rat mesenteric BM that has been used to study cancer cell invasion33 to determine effects of matrix stiffness on the ability of IPF lung myofibroblasts to invade biological BMs (Supplementary Fig. 3d). We observed that IPF lung myofibroblasts pre-cultured on stiff PA gels had a higher invasive index than cells pre-cultured on soft PA gels (Supplementary Fig. 3e). Altogether, these findings indicate that matrix stiffness confers an invasive property to IPF lung myofibroblasts, specifically through the BM.
Figure 2

α6 Mediates matrix stiffness-dependent lung myofibroblast invasion into the BM.

(a) The ability of IPF myofibroblasts cultured on soft versus stiff matrix to invade the BM was evaluated by Matrigel invasion assay. (b) α6-Expression on the cell surface of invading myofibroblasts versus total (myo)fibroblasts was evaluated by flow cytometry. (c) Effects of NKI-GoH3 and T-5224 on stiffness-regulated myofibroblast invasion into the BM. α6-Expression on the cell surface was evaluated by flow cytometry using FITC-labelled GoH3. PVP, a vehicle for T-5224; IgG, FITC-labelled isotype control IgG for NKI-GoH3; Nega ctrl, plain cells with no treatments and no incubation with FITC-labelled GoH3/IgG. (d) Overexpression of α6-GFP fusion protein by lentivirus and knockdown of α6 by siRNA in cell lysates were determined by immunoblot and flow cytometry. (e) Effects of overexpression or knockdown of α6 on stiffness-regulated myofibroblast invasion into the BM. (f–j) α6-expression (red) and proteolytic activation of DQ-collagen IV (green) in the absence (f) or presence of NKI-GoH3 (g), T-5224 (h), α6-siRNA (i) and Lenti-α6 (j) were determined by confocal immunofluorescent microscopy. Nuclei (blue) were stained by DAPI. Results are the means±s.d. of at least three separate experiments; *P<0.05, **P<0.01; one-way analysis of variance. Scale bar, 20 μm.

α6-Integrin is a major cellular receptor for laminin, a protein component of BMs. Next, we determined whether the mechanosensing α6-integrin regulates stiff matrix-induced lung myofibroblast invasion into the BM. We first compared the levels of α6-integrin on the cell surface in the subpopulation of IPF lung myofibroblasts, that is, myofibroblasts that penetrated into the BM in comparison with the total population of IPF lung myofibroblasts. Flow cytometry analysis demonstrated a higher expression of α6 on the cell surface of invading lung myofibroblasts relative to the total lung myofibroblast population (Fig. 2b). When lung myofibroblasts were pre-treated with NKI-GoH3 (a specific antibody that blocks α6-mediated cell adhesion) or T-5224 (an inhibitor of c-Fos), stiff matrix-dependent lung myofibroblast invasion into the BM was significantly inhibited (Fig. 2c). In these experiments, flow cytometry analysis demonstrated that treatment with T-5224 and GoH3 inhibited α6-integrin on the cell surface (Fig. 2c). Vehicle controls (IgG isotype control antibody for GoH3; polyvinylpyrrolidone (PVP) for T-5224) had no effects on lung myofibroblast invasion and α6-expression on the cell surface. To further determine the role of α6-integrin in matrix stiffness-regulated lung myofibroblast invasion into the BM, we generated lung myofibroblasts that overexpress α6-GFP fusion proteins or GFP alone with a lentiviral vector-based approach; an siRNA-based approach was utilized to generate lung myofibroblasts deficient in α6-integrin expression (Fig. 2d). Overexpression of α6 significantly enhanced stiff matrix-induced IPF lung myofibroblast invasion into the BM, whereas knockdown of α6 significantly inhibited lung myofibroblast invasion (Fig. 2e). In addition, overexpression of α6 was sufficient to induce BM invasion of lung myofibroblasts cultured on soft matrices. GFP control lentiviruses and control siRNA had no effects on matrix stiffness-regulated myofibroblast invasion into the BM (Fig. 2e). Altogether, these loss- and gain-of-function studies support a key role for the mechanosensitive α6-integrin in mediating matrix stiffness-regulated IPF lung myofibroblast invasion into the BM. Proteolytic degradation of the BM proteins is critical for cellular invasion into the BM34. Next, we determined whether the α6-integrin mediates proteolysis of collagen IV, a major component of the BM, using fluorescent dye-quenched (DQ)-collagen IV which is quenched in its native form and emits strong fluorescence on proteolytic hydrolysis35. Confocal immunofluorecent microscopy showed that IPF lung myofibroblasts derived from stiff matrix expressed α6-integrin subunit; fluorescent signals from DQ-collagen IV were observed in the periphery of α6-positive lung myofibroblasts, indicative of pericellular proteolysis of collagen IV in the BM (Fig. 2f). Blocking α6-mediated cell adhesion with NKI-GoH3 antibody (Fig. 2g), inhibition of mechano-induction of α6-expression by T-5224 (Fig. 2h), and knockdown of α6-expression with α6-specific siRNA (Fig. 2i) inhibited pericellular proteolysis of collagen IV. Overexpression of α6-integrin enhanced pericellular proteolysis of collagen IV (Fig. 2j). The IgG isotype control antibody, PVP and scrambled control siRNA had no effects on proteolysis of collagen IV (Supplementary Fig. 4). The matrix metalloproteinases (MMPs), MMP-2 and MMP-9, are known to degrade collagen IV36. In this study, we observed that stiff matrix induced an average of sixfold increases in MMP-9 mRNA as compared with soft matrix (Table 1), whereas MMP-2 mRNA expression was not altered by matrix stiffness. However, a direct comparison of relative mRNA expression in IPF lung myofibroblasts showed that the baseline MMP-2 was >20,000-fold higher than MMP-9 (Supplementary Fig. 5a). Zymographic analysis detected MMP-2 activities in both the conditioned media and cell lysates collected from IPF lung myofibroblasts cultured on soft and stiff matrix, whereas MMP-9 activities were undetectable (Supplementary Fig. 5b). Consistent with the qPCR findings, MMP-2 activities were not altered by matrix stiffness. These data suggest that IPF lung myofibroblasts primarily express MMP-2 of type IV collagenases. Next, we investigated whether MMP-2 is involved in α6-mediated collagen IV degradation. Knockdown of MMP-2 by siRNA blocked pericellular proteolysis of DQ-collagen IV (Supplementary Fig. 5c) and IPF lung myofibroblast invasion into BM matrices (Supplementary Fig. 5d). Collectively, these data suggest that α6-dependent invasion of IPF lung myofibroblasts requires pericellular proteolysis of BM collagen IV by MMP-2.

α6-Expression is upregulated in lung myofibroblasts

Next, we determined whether myofibroblast expression of α6 is altered in a human fibrotic disorder, IPF, and in a murine model of experimental lung fibrosis. Confocal immunofluorescent microscopy demonstrated high levels of α6-expression in αSMA-positive lung myofibroblasts in fibroblastic foci of lung tissues of human subjects with IPF, as well as in fibrotic lesions following bleomycin lung injury in mice; in contrast, α6-expression was primarily observed in the airway epithelium of normal human and mouse lungs (Fig. 3a). Primary lung myofibroblasts isolated from human subjects with IPF expressed significantly higher levels of α6 than primary lung fibroblasts isolated from control subjects (Fig. 3b,c). α6-Integrin contains two structural variants, α6A and α6B, owing to alternatively spliced transcripts37. In addition, α6-subunit pairs with either the β1- or β4-subunit to form functional integrin complexes. We demonstrated that although both α6A and α6B were expressed in human and mouse lung tissues at equivalent levels, lung (myo)fibroblasts primarily express the shorter α6B isoform (Fig. 3d). Interestingly, both normal lung fibroblasts and fibrotic lung myofibroblasts express similar levels of the β1-integrin subunit, while β4-protein expression in lung (myo)fibroblasts is not detectable (Fig. 3b,c). These results indicate that, in the context of fibrotic lung injury in vivo both in mice and humans, lung myofibroblasts express high levels of the α6-integrin; the α6Bβ1 is the primary α6-integrin complex expressed by lung (myo)fibroblasts.
Figure 3

Lung myofibroblasts demonstrate increased α6-expression.

(a) Frozen lung tissue sections obtained from failed normal human donors, patients with IPF, saline-treated mice and bleomycin-treated mice were double-stained for α6 (green) and αSMA (red). Nuclei were stained by DAPI (blue). Confocal immunofluorescent images were overlaid to show α6-expression in αSMA-positive lung myofibroblasts. Scale bar, 50 μm; scale bar, 20 μm for mouse with bleo images. (b) Comparison for α6-expression in lung (myo)fibroblasts isolated from patients with IPF (n=10) and non-ILD control human subjects (n=6) by immunoblot; Relative levels of α6-protein normalized to GAPDH expression. Results are the means±s.d. Representative blots for α6-expression as well as β1- and β4-expression were shown. A549 cells were used as positive control for β4-expression in immunoblot analysis. Relative levels of α6-, β1- and β4-expression on the cell surface of IPF lung myofibroblasts were analysed by flow cytometry. (c) Detection of α6β1- and α6β4-complexes in IPF lung myofibroblasts by immunoprecipitation and immunoblot. (d) Identification of α6A and α6B expression in human and mouse lung tissues and fibroblasts by immunoblot; *P<0.05, one-way analysis of variance.

Inhibition of α6 protects against experimental lung fibrosis

To determine whether α6-expression in lung myofibroblasts plays a causal role in lung fibrogenesis, we generated conditional α6-knockout (α6-CKO) mice in which α6-gene is specifically deleted in collagen I-producing cells by intraperitoneal injection of tamoxifen. In pilot studies, we confirmed that tamoxifen treatment induces a time-dependent deletion of α6-expression in mouse lung fibroblasts (Fig. 4a). Almost complete deletion of α6-expression was observed after treatment of tamoxifen for 9 consecutive days. No significant reduction of α6-expression was observed in mouse whole-lung homogenates, suggesting that α6 deletion was mesenchymal cell-specific (Fig. 4a). Consistent with our previous findings (Fig. 3d), we observed that primary lung fibroblasts isolated from mice primarily express α6B isoform. On the basis of these time-course studies, we designed our experimental procedures as depicted in Fig. 4b: α6-CKO mice were given intratracheal bleomycin or saline on day 0. Since bleomycin-induced mouse lung fibrosis is characterized by acute lung injury and inflammation in the early phase (day 0–10) followed predominantly by lung fibrosis (day >14), we started intraperitoneal tamoxifen or corn oil (vehicle control for tamoxifen) treatment on day 5 post-bleomycin administration so that a complete knockout of α6 in lung fibroblasts would be expected to occur at ∼14 days after lung injury; this minimizes potential effects of α6 deletion on the early phases of lung injury and inflammation. Mouse lungs were collected at day 21 and evaluated for lung fibrosis. Confocal immunofluorescent microscopy confirmed that αSMA-positive lung myofibroblasts in corn oil-treated control mice expressed α6-integrin, whereas lung myofibroblasts in tamoxifen-treated mice did not (Fig. 4c). Mice with conditional deletion of the α6-gene during the post-inflammatory fibrotic phase of lung repair demonstrated marked attenuation of fibrotic responses, as assessed by trichrome staining of the lung for collagen (Fig. 4d), whole-lung hydroxyproline content (Fig. 4e), protein levels of fibronectin and αSMA in whole-lung homogenates (Fig. 4f), and micro-CT-based measurements of aerated lung volume, an inverse surrogate marker for pulmonary fibrosis38 (Fig. 4g). In addition, Mmp-2 expression was found in the area of αSMA-expressing lung myofibroblasts in both corn oil-treated control mice and tamoxifen-treated α6-CKO mice (Fig. 4h). Saline-treated WT and α6-CKO mice and bleomycin-treated α6-CKO mice showed intact continuous BMs, as demonstrated by immunostain of the BM component laminin. In contrast, the BM signals were largely disrupted in myofibroblast-enriched fibrotic regions of lungs from bleomycin-treated WT mice (Fig. 4i). Primary lung myofibroblasts isolated from bleomycin-treated α6-CKO mice (α6−/− MFBs) demonstrated reduced capacity for BM invasion as compared with primary lung myofibroblasts isolated from bleomycin-treated WT mice (α6+/+ MFBs); primary lung fibroblasts isolated from saline-treated α6-CKO mice (α6−/− FBs) and WT mice (α6+/+ FBs) showed minimal invasion into the BM (Fig. 4j).
Figure 4

Fibroblast-specific deletion of α6 protects mice against bleomycin injury-induced experimental lung fibrosis.

(a) Time-dependent deletion of α6-expression in lung fibroblasts in conditional α6−/− mice following tamoxifen (Tam) administration. Levels of α6-protein in cell lysates and on the cell surface were determined by immunoblot and flow cytometry. (b) Schematic shows the design of animal experiments. (c) Frozen lung tissue sections from bleomycin-treated mice were double-stained for α6 (green) and αSMA (red). Nuclei were stained by DAPI (blue). Confocal immunofluorescent images were overlaid to show α6-expression in αSMA-positive lung myofibroblasts. Epithelial α6-expression in tam-treated mice was shown in the inset. Scale bar, 20 μm. (d) Representative images for trichrome staining of collagens in paraffin-embedded lung tissue sections. Scale bar, 150 μm. (e) Quantification of hydroxyproline contents in right lungs of mice from four mouse groups: Sal+C.O., Sal+Tam, Bleo+C.O. and Bleo+Tam. (f) Quantification of fibronectin (FN) and αSMA protein expression in left lungs by immunoblot. Shown are representative blots. (g) Shown are representative images for ex vivo mid-lung transaxial μCT scans. The average percentages of aerated lung volumes of mice in four groups (n=5 per group) are shown in the bar graph. (h) Immunohistochemical staining of two adjacent lung sections shows Mmp-2 expression in the areas of αSMA-expressing lung myofibroblasts. Nuclei were stained by hematoxylin (blue). Scale bar, 100 μm. (i) Frozen lung tissue sections were stained for laminin (green) (a component of the BMs) and αSMA (red). Nuclei were stained by DAPI (blue). Inset shows laminin and αSMA staining in the relatively normal area of the same lung section. Scale bar, 20 μm. (j) Lung (myo)fibroblasts (FB and MFB) were isolated from mice in four groups. The ability of (M)FBs to invade the BM matrices was determined by invasion assay. Results are the means±s.d. of three separate experiments, each performed in triplicates; *P<0.05 and **P<0.01; one-way analysis of variance. Bleo, bleomycin; C.O., corn oil; Sal, saline.

Since stiff matrix upregulates α6-expression through a c-Fos/c-Jun-dependent mechanotransduction pathway (Fig. 1), we determined whether pharmacological blockade of c-Fos/c-Jun pathway protects WT C57BL6 mice against bleomycin injury-induced experimental lung fibrosis. To minimize the potential effects of T-5224 on lung injury and inflammation, we started T-5224 or PVP (vehicle control) treatment at day 10 post-bleomycin administration (Fig. 5a). Mice treated with vehicle control showed α6-expression in αSMA-expressing lung myofibroblasts, whereas α6-expression in lung myofibroblasts was greatly reduced in mice treated with T-5224 (Fig. 5b). In mice treated with bleomycin, phospho c-Jun was observed in the nuclei of αSMA-positive lung myofibroblasts (Fig. 5c). In contrast, phospho c-Jun was absent in the lungs of saline-treated control mice. These data suggest that c-Fos/c-Jun signalling is activated in mouse lung fibrosis. Similar to genetic ablation of α6 in lung mesenchymal cells, we observed that administration of T-5224 during the post-inflammatory fibrotic phase abrogated bleomycin injury-induced experimental lung fibrosis in mice (Fig. 5d, hydroxyproline content; Fig. 5e, immunoblot for fibronectin and α-SMA; Fig. 5f, Masson's trichrome staining; Fig. 5g, micro-CT analysis of aerated lung volume). Control studies showed that tamoxifen had no effect on bleomycin-induced lung fibrosis in Itga6 floxed mice (Supplementary Fig. 6a,b). Quantification of inflammatory cells in bronchoalveolar lavage on day 14 demonstrated that post-inflammatory deletion of α6 in mesenchymal cells or T-5224 treatment did not alter the inflammatory response to bleomycin lung injury (Supplementary Fig. 6c,d). Immunostaining of nuclear Ki-67, a cell proliferation marker, revealed that the vast majority of αSMA-positive lung myofibroblasts were non-proliferative (Supplementary Fig. 6e). Neither α6 deletion nor T-5224 treatment altered the proliferative rate of lung myofibroblasts. Altogether, these results provide strong support for a critical pro-fibrotic role for the mechanosensitive α6-integrin subunit, at least in part, by its capacity to mediate myofibroblast invasion.
Figure 5

Pharmacological inhibition of c-Fos/c-Jun protects mice against bleomycin injury-induced experimental lung fibrosis.

(a) Animal experimental design. (b) Overlaid confocal immunofluorescent images show α6-expression (green) in αSMA-positive lung myofibroblasts (red) in mice with treatments as indicated. Nuclei were stained by DAPI (blue). Scale bar, 20 μm. (c) Overlaid confocal immunofluorescent images show phospho c-Jun (green) in the nuclei of αSMA-positive lung myofibroblasts (red) (arrows) in mice treated with saline or bleomycin. Nuclei were stained by DAPI (blue). Scale bar, 20 μm. (d) Quantification of hydroxyproline contents in right lungs of C57BL6 mice in four groups: Sal+PVP, Sal+T-5224, Bleo+PVP and Bleo+T-5224. Results are the means ±s.d. (e) Quantification of FN and αSMA protein expression in left lungs by immunoblot. Shown are representative blots. (f) Representative images for trichrome staining of collagens in paraffin-embedded lung tissue sections. Scale bar, 150 μm. (g) Shown are representative images for ex vivo mid-lung transaxial μCT scans. The average percentages of aerated lung volumes are shown in the bar graph (n=5 mice per group). Results are the means±s.d.; *P<0.05 and **P<0.01; one-way analysis of variance. O.G., oral gavage.

Discussion

In this study, we identified that the α6-integrin subunit is a matrix stiffness-regulated mechanosensitive protein. Stiff matrix upregulates α6-integrin expression by ROCK-dependent activation of a c-Fos/c-Jun transcription complex in fibroblasts. Increased expression of α6-integrin is associated with enhanced capacity for lung myofibroblast invasion into the BM. We predict that α6-mediated myofibroblast-BM interactions bring myofibroblasts into the close proximity to the BM, which facilitates MMP-2-dependent pericellular proteolysis of collagen IV in the BM, thus promoting myofibroblast invasion (Fig. 6). Furthermore, we show that genetic deletion of α6 in (myo)fibroblasts or pharmacological blockade of the c-Fos/c-Jun mechanotransduction pathway, which regulates α6-expression, protects mice against experimental lung fibrosis. These in vivo studies suggest that targeting mechanosensing α6-integrins, specifically α6Bβ1, may provide a novel anti-fibrotic strategy against pulmonary fibrosis. Previous studies have shown that mechanosensing by integrins may involve unmasking of cryptic sites within the cytoplasmic domains that allow for the binding of signalling molecules and/or transition of integrins from low- to high-affinity binding states39. The present study, along with that of others4041, suggests that regulation of integrin expression per se is an important mechanism for integrin-mediated mechanosensing.
Figure 6

A model for mechanosensing α6 in the regulation of lung myofibroblast invasion into the BM.

Stiff/fibrotic matrix upregulates α6-expression by ROCK-dependent activation of c-Fos/c-Jun transcription complex. Interactions between α6-integrins, specifically α6Bβ1-integrins, and the BM bring lung myofibroblasts into the close proximity to the BM. This facilitates MMP-2-mediated pericellular proteolysis of BM component collagen IV, leading to lung myofibroblast invasion.

We observe that α6-expression is increased in lung myofibroblasts of human IPF and bleomycin injury-induced lung fibrosis in mice. It has been reported that in IPF, lung epithelial cells express high levels of laminins adjacent to fibroblast foci42. This finding is consistent with our observations that interactions between stiff matrix-regulated α6 in lung myofibroblasts and the BM mediate IPF myofibroblast invasion. Interestingly, BM-associated laminin-5 is associated with stromal fibroblastic reaction at the invasive front of lung adenocarcinoma, which may facilitate its invasiveness43. In addition, human prostate cancer cells express high levels of α6-integrins; α6β1-integrins mediate prostate cancer metastasis to laminin-rich bone microenvironment44. α6-Integrins also regulate the invasive phenotype of HT 1080 fibrosarcoma cells45, and the levels of α6-integrins correlate with the degree of tumorigenicity of human neoplastic fibroblasts12. In addition to the regulation of cell invasion, there is accumulating evidence that α6β1-integrins promote cell survival through both PI3K/Akt-dependent and -independent pathways4647. It has been reported that α6β1-integrins mediate collagen deposition in gingival fibroblasts48, although the underlying mechanisms remain to be determined. Thus, it is possible that stiff matrix-induced α6-expression may not only regulate lung myofibroblast invasion, but contribute to their anti-apoptotic and matrix-remodelling properties as well. We previously demonstrated that matrix stiffening activates RhoA/ROCK mechanosensitive signal pathway in lung (myo)fibroblasts4. In this study, we showed that stiff matrix-induced phosphorylation of c-Jun and c-Fos requires ROCK activity. ROCK is a serine/threonine kinase49. ROCK also activates serine/threonine kinases, p38 MAPK and PKC5051. It has been shown that both p38 MAPK and PKC induce phosphorylation of c-Fos and c-Jun in vitro and in vivo5253. It remains to be determined whether ROCK directly or indirectly mediates c-Fos and c-Jun phosphorylation in response to matrix stiffening. Although our studies implicate a definitive role for c-Fos/c-Jun in the ‘upstream' regulation of α6-expression in response to matrix stiffness, the ‘downstream' effects of α6 induction on cellular invasiveness may involve intracellular pathways that require further study. It has been shown that α6-integrins activate the small GTPase RAC by a PI3K-dependent mechanism54. RAC activation promotes mesenchymal cell invasion into matrix barriers through mesenchymal–amoeboid transition14. α6-Integrins also activate Src family kinase5556. Src family kinase signalling is known to promote cancer cell invasion57. In this study, we found that lung (myo)fibroblasts primarily express α6B. Compared with α6A, α6B contains an alternative cytoplasmic domain that is 17 amino acids shorter and bears no sequence homology with α6A37. Whether the distinct cytoplasmic domain of α6B plays a functional role in the regulation of lung myofibroblast invasion into the BM, either by modulating myofibroblast adhesion to laminins in the BM and/or by activating cellular signals that mediate invasion is currently not known. Previous studies have shown that macrophages expressing α6Aβ1 or α6Bβ1 differ markedly in their morphology and migration on laminin matrix58. Macrophage adhesion to laminin matrix is regulated by phosphorylation of the cytoplasmic domain of α6-integrins at the serine residues59. It has also been reported that α6Aβ1 and α6Bβ1 differentially regulate tyrosine phosphorylation of paxillin on laminin matrix60. AP-1 is a heterodimer composed of proteins belonging to the c-Fos, c-Jun, ATF and JDP families. We demonstrated that the prototypic members of AP-1 transcription factor family, c-Fos and c-Jun, mediate stiff matrix-induced α6-gene expression. In previous studies, Eferl et al.29 have shown that Fos-related Fra2 transgenic mice develop spontaneous fibrosis in various organs with predominant involvement of the lung. Fichtner-Feigl et al.32 have reported that the Fra2/c-Jun complex mediates IL-13/IL-13α2 receptor-dependent activation of the TGF-β1 promoter in bleomycin-induced mouse lung fibrosis. However, in our studies, Fra2 does not appear to be involved in matrix stiffness-regulated a6 expression. Thus, distinct AP-1 transcription factor complexes may be responsible for different components of fibrogenic signalling pathways. Since AP-1 is a heterodimer, blocking c-Fos/c-Jun with T-5224, a selective Fos inhibitor, may interrupt the function of other Fos-containing AP-1 complexes. Therefore, T-5224 treatment might not only block stiff matrix-induced α6-expression and myofibroblast invasion, but other potential fibrogenic signals regulated by Fos-containing AP-1 complexes. MMPs, including MMP-2 and MMP-9 of type IV collagenases, are critical players in the pathogenesis of human IPF61. In this study, we demonstrated that MMP-2 is the primary type IV collagenase that mediates matrix stiffness-regulated IPF lung myofibroblast invasion into the BM. Interestingly, matrix stiffness regulates MMP-9 expression at the mRNA level, although MMP-9 activity is not detected. In addition to MMP-9, matrix stiffness also regulates mRNA expression of MMP-11, MMP-12 and MMP-16 (Table 1). AP-1 has been shown to mediate MMP expression in response to phorbol myristate acetate and cytokines62. Although bioinformatics analyses identified potential AP-1-binding sites in the promoter region of MMP-9, MMP-11, MMP-12 and MMP-16, we found that neither T-5224 nor AP-1 decoy oligodeoxynucleotides blocked matrix stiffness-regulated MMP-9, MMP-11, MMP-12 and MMP-16 mRNA expression (Supplementary Fig. 5e). These data suggest that matrix stiffness-regulated gene expression of MMP-9, MMP-11, MMP-12 and MMP-16, unlike the integrin α6 subunit, may occur via AP-1-independent mechanisms. It is currently unclear if matrix stiffness is a cause or consequence of organ fibrosis63. There is accumulating evidence that mechanical interactions between myofibroblasts and stiffened matrix provide a feed-forward mechanism that maintains pro-fibrotic myofibroblast phenotypes and, therefore, perpetuation of fibrosis13456. In rat carbon tetrachloride model of liver fibrosis, it has been observed that matrix stiffness increases before myofibroblast differentiation and fibrosis6465. This early increase in liver stiffness can be blunted by inhibition of collagen cross-linking enzymes of the lysyl oxidase family64. These interesting findings suggest that changes in the mechanical properties of the ECM may not only sustain myofibroblast phenotype but contribute to the emergence of myofibroblasts in early liver fibrosis. Altogether, these studies imply that new therapies that target deleterious mechanical signals may be effective in preventing or arresting the progression of fibrosis. In summary, the findings from this study support an essential role of the mechanosensing α6-integrin in mediating myofibroblast invasion and lung fibrosis following injury. Importantly, this novel mechanosensing pathway represents a target for developing new anti-fibrotic therapeutic strategies. Strategies for blocking the deleterious function of mechanosensing α6 may include the development of specific antibodies against fibroblast α6-integrins, specifically α6Bβ1 or pharmacological disruption of the mechanotransduction pathway involved in α6-expression. Interestingly, miR-29, an anti-fibrotic master regulator capable of blocking and reversing pulmonary fibrosis6667, directly targets both α6-integrin and laminin68. Future studies that focus on targeting the invasive phenotype of myofibroblasts, in addition to other pro-fibrotic properties such as apoptosis-resistance, may prove to be effective in treating fibrotic disorders.

Methods

Lung fibroblast isolation and treatments

Human lung fibroblasts were established from tissue samples from patients undergoing lung transplantation. Previous studies have shown that lung myofibroblasts isolated from patients with IPF acquire an invasive phenotype, whereas normal human lung fibroblasts do not invade20. IPF lung myofibroblasts were used in this study. The studies involving human subjects were approved by institutional review board at the University of Alabama at Birmingham. Participants have been provided with written informed consent. Lung fibroblast isolation, culture, transfection, sorting and treatment were described in Supplementary Methods.

Matrigel invasion assay

Fibrotic lung fibroblasts were cultured on soft (1 kPa) and stiff (20 kPa) PA gels for 48 h. Cells were detached from PA gels by trypsinization. An equal number of living cells (1 × 105 cells per chamber) derived from soft and stiff matrix were plated in Matrigel invasion chambers (BD Biosciences, San Jose, CA, USA). Cell invasion was measured at 7 h after incubation on Matrigel to minimize the potential effect of differential matrix stiffness on fibroblast proliferation1. Non-invading cells at the bottom of invasion chambers were swiped with cotton swabs. Invading cells on the other side of Matrigel membrane were stained with 0.5% crystal violet for 30 min. The number of invading cells was counted under a Nikon Eclipse TE 300 microscope equipped with Spot Insight CCD camera. Invasion index was calculated as the ratio of the per cent invasion of test cells (cells cultured on soft and stiff PA gels) over the per cent invasion of control cells (cells cultured on regular tissue culture plates). In a second approach, an equal number of fibrotic lung fibroblasts were seeded on soft or stiff PA gels. Cells were allowed attachment for 1 h. Cells together with PA gels were transferred to Matrigel invasion chambers with the apical side of cells in close contact with Matrigel (Supplementary Fig. 3). Invading cells were counted at 48 h.

Proteolytic degradation of collagen IV in the BM

Six-well Matrigel invasion chambers were incubated with DQ-collagen IV (Molecular Probes, Eugene, OR) diluted in serum-free DMEM at a final concentration of 25 μg ml−1 at 37 °C in dark overnight. The chambers were briefly rinsed with serum-free DMEM. Fibrotic lung fibroblasts were trypsinized from stiff matrix. In all, 1 × 105 cells were seeded into each invasion chamber in the presence or absence of NKI-GoH3 (10 μg ml−1), α6-siRNA and MMP-2/MMP-9 Inhibitor I (25 μM). Cells were then incubated in a CO2 incubator at 37 °C for 3 h. Proteolytic degradation of DQ-collagen IV in the BM was imaged with confocal laser-scanning microscopy as described below.

CRISPRi

Two 20-base sgRNAs were designed to target AP-1-binding TREs at −2,873/−2,879 nt and −4,848/−4,854 nt in human α6-promoter, respectively. AP1sgRNA1 (5′- CTAAAACTGAGTCATAAGGC -3′) binds to the plus-strand sequence at −4,841/−4,860 nt near the distal TRE1 in human α6-promoter. AP1sgRNA2 (5′- CACCCAACTCTGTTTTACAA -3′) binds to the minus-strand DNA at −2,924/−2,943 nt near the proximal TRE2 (Fig. 1h). Both of the sequences were cloned into pX333 (Addgene) to obtain pX333-AP1sgRNA1-AP1sgRNA2 plasmid. A DNA fragment encoding dCas9-BFP-KRAB domain was amplified by PCR from pHR-SFFV-dCas9-BFP-KRAB (Addgene). The fragment was subcloned into pX333-AP1sgRNA1-AP1sgRNA2 to obtain pX333-AP1sgRNA1-AP1sgRNA2-dCas9-BFP-KRAB plasmid. The latter plasmid and pX333 empty vector were transfected into IPF lung myofibroblasts using a Nucleofector device (Amaxa) as previously described4.

Immunofluorescence and confocal laser-scanning microscopy

Eight micrometre cryostat sections were rehydrated in phosphate-buffered saline for 10 min. Tissue sections were blocked with 5% normal goat serum and co-stained with anti-αSMA (Sigma, St Louis, MO, Cat# A2547, 1:200 dilutions) and anti-α6 (Abcam, Cambridge, MA, Cat#14-0495, 1:300 dilutions) antibodies diluted in phosphate-buffered saline containing 1% goat serum, 0.3% Triton X-100 and 0.01% sodium azide according to manufacturer's instructions. Fluorochrome-conjugated secondary antibodies (SouthernBiotech, Birmingham, AL) were used according to the manufacturer's recommendation. Nuclei were stained with DAPI (Thermo Fisher Scientific, Waltham, MA). Fluorescent signals were detected using a confocal laser-scanning microscope Zeiss LSM710 confocal microscope equipped with a digital colour camera (Oberkochen, Germany). All fluorescent images were generated using sequential laser scanning with only the corresponding single-wavelength laser line, activated using acousto-optical tunable filters to avoid cross-detection of either one of the fluorescence channels.

Animals and experimental protocol

The animal studies were performed in accordance with the NIH guidelines for Care and Use of Laboratory Animals. Animal usage and bleomycin protocols were approved by the Institutional Animal Care and Use Committee of the University of Alabama at Birmingham. To generate mesenchymal cell-specific Itga6 mice, C57BL/6-Itga6 mice69 (a gift from Dr Elisabeth Georges-Labouesse, Institut de Génétique et de Biologie Moléculaire et Cellulaire, Illkirch, France) were cross-bred with C57BL/6 mice carrying a tamoxifen-inducible Cre-recombinase (Cre-ER(T)) under the control of a regulatory sequence from procollagen I gene (The Jackson Laboratory, Bar Harbor, ME). Six- to eight-week-old female conditional Itga6 mice and WT C57BL/6 mice were used in this study. Bleomycin sulphate (Almirall, Barcelona, Spain) was dissolved in sterile saline solution and intratracheally instilled into mice by a Stepper Repetitive Pipette (Tridak, Torrington, CT) as a single dose in 50 μl saline solution per animal (1 U kg−1 bodyweight). Control mice received 50 μl saline. For tamoxifen (Sigma, St Louis, MO) treatment, a dosage of 50 mg kg−1 bodyweight per day over 9 days or an equal volume of corn oil (vehicle for tamoxifen) was injected intraperitoneally into conditional Itga6 mice, 5 days after bleomycin administration. For T-5224 (Apexbio, Houston, TX) treatment, a dosage of 30 mg kg−1 bodyweight perday or an equal volume of PVP (vehicle for T-5224) was given to WT C57BL6 mice daily by oral gavage, 10 days after bleomycin administration. Mice were killed at 21 days. Lung tissues were collected and used for histochemical and immunofluorescent analyses, micro-CT scans and isolation of lung fibroblasts.

Statistical analysis

Statistical differences among treatment conditions were determined using one-way analysis of variance (Newman–Keuls method for multiple comparisons). Values of P<0.05 or P<0.01 were considered significant.

Data availability

All relevant data will be made available on request and/or are included with the manuscript (as figure source data or Supplementary Information files). Additional information is detailed in the Supplementary Methods.

Additional information

How to cite this article: Chen, H. et al. Mechanosensing by the α6-integrin confers an invasive fibroblast phenotype and mediates lung fibrosis. Nat. Commun. 7:12564 doi: 10.1038/ncomms12564 (2016).
  69 in total

1.  TIMP-1, -2, -3, and -4 in idiopathic pulmonary fibrosis. A prevailing nondegradative lung microenvironment?

Authors:  M Selman; V Ruiz; S Cabrera; L Segura; R Ramírez; R Barrios; A Pardo
Journal:  Am J Physiol Lung Cell Mol Physiol       Date:  2000-09       Impact factor: 5.464

Review 2.  The AP-1 site and MMP gene regulation: what is all the fuss about?

Authors:  U Benbow; C E Brinckerhoff
Journal:  Matrix Biol       Date:  1997-03       Impact factor: 11.583

3.  Inhibition of mechanosensitive signaling in myofibroblasts ameliorates experimental pulmonary fibrosis.

Authors:  Yong Zhou; Xiangwei Huang; Louise Hecker; Deepali Kurundkar; Ashish Kurundkar; Hui Liu; Tong-Huan Jin; Leena Desai; Karen Bernard; Victor J Thannickal
Journal:  J Clin Invest       Date:  2013-02-22       Impact factor: 14.808

Review 4.  Mechanosensitivity and compositional dynamics of cell-matrix adhesions.

Authors:  Herbert B Schiller; Reinhard Fässler
Journal:  EMBO Rep       Date:  2013-05-17       Impact factor: 8.807

5.  The androgen receptor induces integrin α6β1 to promote prostate tumor cell survival via NF-κB and Bcl-xL Independently of PI3K signaling.

Authors:  Laura E Lamb; Jelani C Zarif; Cindy K Miranti
Journal:  Cancer Res       Date:  2011-02-10       Impact factor: 12.701

6.  ERK activation protects against DNA damage and apoptosis in hyperoxic rat AEC2.

Authors:  S Buckley; B Driscoll; L Barsky; K Weinberg; K Anderson; D Warburton
Journal:  Am J Physiol       Date:  1999-07

7.  Matrix stiffness regulation of integrin-mediated mechanotransduction during osteogenic differentiation of human mesenchymal stem cells.

Authors:  Yu-Ru V Shih; Kuo-Fung Tseng; Hsiu-Yu Lai; Chi-Hung Lin; Oscar K Lee
Journal:  J Bone Miner Res       Date:  2011-04       Impact factor: 6.741

Review 8.  Functions of pulmonary epithelial integrins: from development to disease.

Authors:  Dean Sheppard
Journal:  Physiol Rev       Date:  2003-07       Impact factor: 37.312

9.  Cell type-specific integrin variants with alternative alpha chain cytoplasmic domains.

Authors:  R N Tamura; H M Cooper; G Collo; V Quaranta
Journal:  Proc Natl Acad Sci U S A       Date:  1991-11-15       Impact factor: 11.205

10.  Integrin alpha4beta1 regulates migration across basement membranes by lung fibroblasts: a role for phosphatase and tensin homologue deleted on chromosome 10.

Authors:  Eric S White; Victor J Thannickal; Shannon L Carskadon; Emily G Dickie; Donna L Livant; Sonja Markwart; Galen B Toews; Douglas A Arenberg
Journal:  Am J Respir Crit Care Med       Date:  2003-06-05       Impact factor: 21.405

View more
  54 in total

1.  Fra-2-expressing macrophages promote lung fibrosis in mice.

Authors:  Alvaro C Ucero; Latifa Bakiri; Ben Roediger; Masakatsu Suzuki; Maria Jimenez; Pratyusha Mandal; Paola Braghetta; Paolo Bonaldo; Luis Paz-Ares; Coral Fustero-Torre; Pilar Ximenez-Embun; Ana Isabel Hernandez; Diego Megias; Erwin F Wagner
Journal:  J Clin Invest       Date:  2019-05-28       Impact factor: 14.808

2.  Why Stress Matters: An Introduction.

Authors:  Daniel J Tschumperlin
Journal:  Methods Mol Biol       Date:  2021

Review 3.  Idiopathic pulmonary fibrosis: Epithelial-mesenchymal interactions and emerging therapeutic targets.

Authors:  Justin C Hewlett; Jonathan A Kropski; Timothy S Blackwell
Journal:  Matrix Biol       Date:  2018-04-03       Impact factor: 11.583

4.  Activation of adenosine A2b receptor attenuates high glucose-induced apoptosis in H9C2 cells via PI3K/Akt signaling.

Authors:  Yi Shen; Gang Tang; Pan Gao; Bin Zhang; Hang Xiao; Liang-Yi Si
Journal:  In Vitro Cell Dev Biol Anim       Date:  2018-04-06       Impact factor: 2.416

Review 5.  Is Progression of Pulmonary Fibrosis due to Ventilation-induced Lung Injury?

Authors:  Richard K Albert; Bradford Smith; Carrie E Perlman; David A Schwartz
Journal:  Am J Respir Crit Care Med       Date:  2019-07-15       Impact factor: 21.405

6.  Outsourcing Invasion, a Novel Function for Extracellular Vesicles in the Lung.

Authors:  Tzu-Pin Shentu; James S Hagood
Journal:  Am J Respir Cell Mol Biol       Date:  2019-03       Impact factor: 6.914

7.  PD-L1 on invasive fibroblasts drives fibrosis in a humanized model of idiopathic pulmonary fibrosis.

Authors:  Yan Geng; Xue Liu; Jiurong Liang; David M Habiel; Vrishika Kulur; Ana Lucia Coelho; Nan Deng; Ting Xie; Yizhou Wang; Ningshan Liu; Guanling Huang; Adrianne Kurkciyan; Zhenqiu Liu; Jie Tang; Cory M Hogaboam; Dianhua Jiang; Paul W Noble
Journal:  JCI Insight       Date:  2019-03-21

8.  Mitogen-activated Protein Kinase-activated Protein Kinase 2 Inhibition Attenuates Fibroblast Invasion and Severe Lung Fibrosis.

Authors:  Jiurong Liang; Ningshan Liu; Xue Liu; Jessica Monterrosa Mena; Ting Xie; Yan Geng; Caijuan Huan; Yanli Zhang; Forough Taghavifar; Guanling Huang; Adrianne Kurkciyan; Vivian Barron; Dianhua Jiang; Paul W Noble
Journal:  Am J Respir Cell Mol Biol       Date:  2019-01       Impact factor: 6.914

9.  Integrin α6 and EGFR signaling converge at mechanosensitive calpain 2.

Authors:  A D Schwartz; C L Hall; L E Barney; C C Babbitt; S R Peyton
Journal:  Biomaterials       Date:  2018-06-02       Impact factor: 12.479

Review 10.  Basement membranes in the cornea and other organs that commonly develop fibrosis.

Authors:  Paramananda Saikia; Carla S Medeiros; Shanmugapriya Thangavadivel; Steven E Wilson
Journal:  Cell Tissue Res       Date:  2018-10-03       Impact factor: 5.249

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.